Sunteți pe pagina 1din 196

O IOAN NANET,A

LUCIAN GAVRILA
DEscrFnîun TATNELE EREDrrAlrr
VOL. I

,:l
CoPErtA dE EPAI}TINONDA TIOTIU
Blank page intentionally inserted

4
PREFATA

Nu eristd un alt domeniu al biologiei atit d.e dinamic co. cel


ala gemeticii.lor sncinn de a scrte a &r,te dp Genetied, este' fmr-
t'e d,ificild, cdci, m,enfinerea tn acfumlitatn docurnentdrii repre-
zintd, o adeudnatd cursd. conhw-crwtnmetru, dabele stiingifice,
unele de rutinó,, iar altele foarte noi, sau chinn nebdnuite
pnd deunózi, apdrînd Tnintr-ttm adeadmt fenonterL de aualangd
inf o,rmnpictrtald.
'Iotodatd, fenvmenul ereditar este ertrem de compler, iar
.;tiinîa ereditd{ii reprezin,td, un dameniu în care trecerea de la
tezd la antitezd. ;i sintezd,, într-o desfdgurare profund dialecticó,
es'te un loc cornun.
Ultimul deceniu o însemnat W$i errcrmi în aprofunzdo"r'ea
stttdiu,lui fenomenului ereditur. Datele mai u,echi despre repli-
carrea semiconseruotiud a ADN au fost cornpletate cu rnod,ele
noi, dem.anstrînd,u-se realitabm unei replicdri segmenfune, dis-
canySinuu. A fast demonstrató, transmitureo, inf ormnfiei ,erediture
de la,^tRN la ADN, aducîndu-se astfel u"n s.erios 'omendoment
la dogmn centtwld a biologiei rntoleculare. Saau ob$inut rezul-
fute rem.arcsbite în stadiul structurii ,rn^oleculotre a .cromozomu-
lui de tip eucario't, bsndarea crarnozomnld reprezentînd o ue'ri-
tv'bild ,,Ao'r-nbd cu origenK penh'u citogeneticd.
S-o dooedit cd, genele prezintd, secuen{e codificatoore. trsn-
scrise ;i traduse ;i secuenfe intercalate printre secuen{ele codi-
ficatmre ;i care sînt transcnse dar nu sînt traduse, genele ansînd
d,eci o structurd m,ozaimtd,. De asemenea, Ia baci;eriofagi, s-a de-
mnnstrnt fenam,enul acoperirii de Eene. S-au descifmt proprie-
tófile gemelor sdritosre pi s-a elobstwt ipoúem ootcoEenrei.
Rezultute dc el:cepÍie ou f ost obfinute îmtr-un domnniu nou
al g,enetùcii mn'lecu.Inre, cel ol mnnipuldrii de Eene cunoscut ;i
sub d,enumirm de dhginerie g'eneticd. Cu oicasta Genetica ca-
pdtd nebúnuite implimiii de ordin ;tiinlific, econotnic, social,
polùtic Ei chinr m,aml, im wuele reslizdri epoele din dorneniul
ingineriei genetice pot fi comptnte ca gwndmte ;i insolit cu
mdrelia pa1i,lor tui Armstrong pe lund,. $tiinfd, cll Wofunde
rezonan,te umnniste, Genetica demonstreazd unicifu.úeo fincúrui
ittdir;i.d umnn, irepetabilitatea .so spafio-temporard. Totodnú.,
genetr,ca aduce în discu[ie, de dnta aceasta pe temeiuri mate-
rialist-cLialecti,ce, eristenfa unui desbin. $i acest destin se nLb
mc;te destin genetic. EL se împline;te cu rígo'we matema;ticd",
fdrd a euea însd implacabilitatea destinului ulnfln dl;in mitolo-
gía greacd.
Conceputd. dupó rrn plan original, cortea de fatd re-
prezhrtd. o încercare, ùt linútele uttui spaf,iu redus, de a da
cititorului o imngine integrald asupra fanom,enului ereditar. În
intenlia auborilor a sta't pe d:e ,o fxtrte pre'zentorca cît mai catn,
pletd a datelor clqsice si a datelor m.oderne priuittd fenornenul
eredit'ar ca ;i o încqcare de interpreffire a datalor dc gvneticd,
clasicd, formnld, prin dntele geneticii mo'leculare. Euide,nt, e&r-
tea de fald este urn din tariantele posíbile.
Pentru docum,enture ne-ant folosit de posibilttdfile pe care
ni le-.au oferit biblioteca Facultd,tii de biologie a Uniuersitd'fii
din Bucunegti, bibliotem d,epartarnentului de Biolngxe gi Bíochi-
mie al Uniuersitdfii Haruo,rd (S.U.A.) precum ;i scltimbul initer-
rwlional de lucrdri ;tiinfifiee, ostÎet încît auborii au auut posi-
bilitwtea de a consulta ntulte tuqdri originale de geneti,cd, cla=
sicd sau m.odernd.
Autorii erpúmd gratitudine tuturor ,acestor institufii ;i tu-
turor celor care le-au oferit, pe o cale sau alta pasibititatea
documentdrii.
Bibliografia este sel.ectiud, gi totodatd. cugnind,e luqdrile
principale deuqrite clnsice sle genetici,i f,orunnle ;i rrualeculnre.
Din ntotiue de spf;iu nu s4 realizat o pennanentó eorelare o
citdrii în tert a autorilor cu Ubliografin firnld.
Lucrarea se adreseazd. speeiali;tilor în geneticd, stud'enfilor
facultd.,tilor de biologie, medicind ;i agronomiie precurn 9i pro-
f esorilor de biologie ;i etexilor de liceu. De osemsnea, ea pmte fi
consultatd de oricine este interesat în descifrarea miw,u;Iosului
fenomen ereditor, cuno;tinfele despre eredifute fdcînd Wrte in'
tegrantú din ceeo ce se poate numi formnlia intelectuald a
omului modern.
AUTORII
CUPRINS

CAP. f. Suhstratul rnaterial al ereditàlii I


l. Delinirea ered.itdlii. I
2. Delinírea substratului chimic aI ereditdlii ll
3. Sl.tuctura acizilor nuclcici. 18
3.1. Scurt istoric 1B
3.2. Structura primarà a ,{.DN l8
3.3. Structura secuudarà a ADN . 22
3.4. Structuri tautomere 30
3.5. Exceplii de la structura bicatenarà a ADN 32
3.6. Cantitatea de ADN gi informalia ered.itarà 33
3.7. Sinteza replicativà a ADN 35
CAP. II. Struetura ARN qi transcrierea genetleú 50
l. Generalildli 50
2. Transcrierea geneti,cà 52
3. ARN nnseger 57
4. ARN ribozomal 6l
5. lnN d,e tronsfer 66
6. I RJV nuclear eterogen. . 73
7. A RN crontozontal 74
8. IRN ttiral 74
9. Reuerstranscrieyea 76

CAP. III. Organizarea materialului ereditar 79


l. Organizarea uiralà - 79
2. Organizarea cclul,ar d 82
2.1. Organizarea procariotà. 82
2.2. Organizarea eucariotà 85
2.2.1. Organizarea genelor eucariote 88
2.2-2. Structura electronomicroscopicà acromatinei
gi a cromozomului eucariot 104
2.2.3. Complexul sinaptinemal 106
3. Caracleri,stici,le organizdrii eucariote 109
4, Procariote-Eucariote, o comparalie . 109
5. Genomul extranuclear lll
CAP. IV. Codificarca biochimieà'gi expresia genieà 116
l. Generalitàli . 116
2. Cod,ul genetic ll7
3. Catacteristicile codului genelic 123
4. Biosinteza proteinicd f28
proteinicà. 129
4.1. DesfAgurarea proc'esului de biosintezó
4.1.1. Inifierea catenei polipeptidice l3l
4.1.2. Alungirea catenei polipeptidice 137
4.1.3. Terminarea catenei polipeptidice 140

cAP. V. Caraeteristleile organizarii qi funcgionóril factorllor oreditnri


(genelor) 145
l. Ciclul de tiald la organismele superíoare . 146
2. Caraateristicile genetice ale meiozdi 117
3. Localizarea genelor pe cromozomi 148
4. Descifrareo naturii genomul.ui (gcnotipului) prin stud,iutr
fenotil>ului (analiza geneticd) (Genetica factoriald. sau for-
mald) r49
4.1. Ivlonohibridarea . 152
4.2. Dihibridarea r5B
4.3. Bxceplii de la raporturile mendeliene de segregare 167
4.3.1. Dominanla incompletà sau semidorninanla 167
4.3.2. Supradominanla 168
4.3.3. Codominanfa 168
4.3.4. Alele multiple (polialelia) 169
5. Factorul Rh t74
6. Variantele electroforetice ;i semnificalia lor 177
7. Interacliunea genelor t79
B. Complementaritate genicd . 181
9. Gene inhibitoare . 182
10. Gene epistatice. 183
ll. Gene duplicate cu e.fect cumulatíu 185
12. Penetran!à. gi expròsiuitate genicà 186
13. Determinismul genetic aI ciracterelor cantitatfue 189
11. Gene letale . .' . 193
15. Pleiotropia 195
B

t
1

I Capitolul I
)

SUBSIRATUI, MATERIAL AL EREDITATII


Motto:'
Spirala este esenfa vie{iir
Goethe

1. DEFINIREA ERBDITATII
,
Îrncà din anul 1863 Spenoer defineEte ereditatea ca fiind
proc€sul cìare detenminà asemànar€a dintre pàrinli Ei descen-
den{i. IJlterior, la 1885, A. Weis,mann în{elege prin eredita't'e
,,'ttransferuù de Ia o genera,,lie la al'ta a unei substanfe cu o con-
stitu{ie molecularà definità36. Prin ac+easta Weisrnann devan:-
seazà cu aproape trei sferturi de veac, conceptia modernà
despre, o bazà molecularà a ereditàtii, iar oonc€ptul sàu de
pl asrnrt gerrnirwt't u d, cu ierarhia strl.c t ur al -f unclio nralà determi -
nanfi-biofsri-idnrúte-ide, este comparabiù cu cnncephll actual
asupra ierarhiei sistremului eredi'tanr care pornegte de la pere-
chea de nucleotide qi ajunge Ia genarTr.
Astàzi prin ereditate se înfelege conservarea specificitàlii
unui sistrem ibi'olqgic dat, în tÍa:npuù reproducerii s,al€, conser-
vare care asirgurà oon,tiuruul în evolufie, legàtuna organicà dintne
generafii, adicà asemànairea dintre acesúea. Totodatà, pe Iîngà
coarlinutul 'evolutiv, apare ca fenomen biologic fundarnentaln
stà,r€,& de neas,ernànane, de discontinuitate evolutivà, adicà vE-
riabilitatea, eea mai generatà lege a naturii. Cele douà procese,
conservatismul ereditar qi vari'abiùitatea ereditarà sînt douà ùa-
turi inseparalbile ,car,e definesc unitatea dialeeticà a organismu-
* Acest panseu al celebrului autor al lui Faust po'ate fi luat, în
lipsa uneia exacte, drept definifie a vie{ii. Geniul marelui poet a pà-
truns esenfa viefi,i, de vreme ce Tem,a, singur,a planetà pe care sàtàguiegte
în.mod cert Viata se ,aflà într-o g,alaxie de formà spiralà, iar macromo-
leculele din interactiune'a càrora irumpe triumfàtorare Viata au li ele în
esen!à o fitrucfurà spir.'alà. (L. Gravrilà Prognese gi Pers-
pective în biologie: Progrese în Genetica - Simpozionul,
molecul.arà Bucuregti, g
aprilie 1981.
r
lui viu. Fieoare organism are propria sa eredi,tate înscrisà codi-
ficat în s,tructuri moleculare specifice sub formà de irrforma-
tie ereditarà. Cu studiul ereditafii Ei variabilitàtii se oeupà
$tiinfa Ereditàtri numità încà Gsslgriss. Ea studiazà meoanis-
mele înregisúràrii, reduplicàrii qi modificarii imforrnafiei eredi-
tar,e precum $i aie fun,cfi,onràrii m,aú,eria,lnrlui enedirtar în conr,r.u*luL
proceseil.or rbiosintetice din organi:srrt car,e conduc I'a ,contur,ar€a
cliferitelor caracteristici a,ie arcestuia.
Cuvîntul eredita,t,e este de origin:re 'latinà (lueredibas =- a rno$-
teni) qi sem'nificà trransmiterea din gen,era{ie în g'Enerafi'e, ou
a unor caractere cai ata,re, ci a, capacità{ii. de a dezvoita aceste
caractere la d,escend'enfi.
Cuvîn'tul Geneticà, dat acestei gtiin{e de càtr,e W. Batesor,
în 1905, provime de la ,,grec€scul genrtao care înseamnà a d,a
naEtere, a gen'era. Principiile de 'bazà ale Geneticii au fost for-
mulate în anul 1865 de càtre Gregor N{endet în {ucrarea ,,tJtber
die Pflan,zer:r hyb'riden6t Ei au la' bazà, conceptul de factcri ere-
clitari (gene) de naturà materialà. Etre au fos,t elaborate' în urma
unor exp€rienfe de hilbridare efectuate îrn,tre diferite soiuri d'e
mazàre. Fàrà a cunoaqte care este natura chirnicà ,r factorilor
ereditari, Mendel a starbilit, prin in'terpretarea corectà a nezul-
tatelor ,experi,errfelor de hibridare, prin analiza fe,notipi,cà,
indirectà a factoril,or ereditari, dubtl artà cle analiza statisticà.
comportamentu[ acestor factori ereditari în conrrdifionare,a
qi transmiterea ca,racterelor eredi,tare. lli,tate pentru m,ai 'bine
de trei deceurii, principiile elaborate, de Mendel au fost con'fir-
rnat,e ia începutu'l secolului nostru, dovedindu-,s,8 a fi universal
valal:ile în lumea vie. Mendel trebuie astfel consldena,t fonda-
torul celei rnai moderure qtiinfe biologice Geneticai. Legînd
factorii er,edi,tari ,mend.elieni de c'roln,o zomi qi dezvol,tîn'd prin-
cipiile memcleliene de ereditah, qcoala iui Morgan a e'lucidat
clesfàqurarea f enomenului eredit'ar la nivel celular, ,constatÍn-
d,u-se ,exis'tenla unui comportam,ent identi,c al factorilor eredi-
tari rn€n;delieni qi al cromozomil'or î'n tirnpui diviziunii celulare.
Ràmin,ea încà n,edescifratà natura chinnicà a faatoriùor eredi,tari.
Deqi în arnul 7924, Feulgen Ei Ross'enbeck ,eviden liazà,, printr-o
metodà selectivà de colorare cu leucofux,inà prezenfa la nivelul
nucleulrui cel'ular qi ,al croln,ozormilor a acid,ului dezoxi,ritbouru-
cl'eic (ADN) nu s-ai putut s'tabiili urici,o ,relaf;ie dintre acas,tà surb
stan!à Ei fac'torii ereditari, a càror 'localizare pe cromozorni fu-
sese clar dernornstratà de Scoal,a lui Morgan"

10
2. DEFINIT3EA SUBSTRATULUI CHIMIC
AL BIBEDITATII
În pr,ocesul de transrni'tere a carac,terel'or ereditare de la o
genera{ie la, alta nu are loc o transmitere ,ca atar,e a unui ca-
raoùer. Bste de neimagiurat ,bunàoarà transmiterea la nivel'ul
zigotului uman a ,,ochilor albaEtri(. Dar la nivelul acestui zigot
,roeva" a'fost trans'rris qi acest ,,cevar(( va face ,cE î'n dezvoltanea
ulterioaià a embriou:ului uman sà aparà nnaurifest caracterui
,,ochi a',libaEtri((.' Ce este acest ,,oeva66 Ei ca,re sînt proprietàlile
sale? Fàcînd o paralelà între legil,e fizicii Ei le,gi'tàfi'le feno'me-
nului eredita'r, E. Schródingep, în 1943, devansînd conceplia
modermà molecularà despre ereditak, a ajuns la concluzi:a cà
gen'el,e 'îEí pàstr'e à,2à struotura lor de-a lungul generaliilor,
deoarece cr'omozomu'l în cane e'le se aflà, repre zintà un fel de
cristal sta,bil aperiodic, compus dintr-o succesiune de elemente
izomerice, caracùe'rizate de peruuneur{à gi a càror naturà exactà
eete de fapt.,legatà de codul genetic. i

Trei trepte ,experimentale au dus la descoperirea a,celui


f,cevars adicà a subs,tratului material al ereditàtii care s-a do-
vdit a,fi s'ubstanta chimicà macrcrmolecularà ADN.
Primp, treaptd, este repr,€tentatà de experienfele medicului
englez Griffitllr, efectua,ùe în 1928 cu agpntul pneumoniei
Diplocoecry . pneur:rnùrnipp sau pneumococ. Aceastà tbacùerie se
prezin,tà, su,b forma a douà tipuri diferite: qnul virule'nt qi în-
capslllat, altul nevirulent Ei neîncapsulat. Caracterele de viru-
lent, qi nevirtr'lent sî'n't ereditare adicà se transurrit constan't d,e
la o gengrat-le celuùarà la aLta
fi,pqt virulent a fiost oro,tat cu ,,Slt deoar€€, crescut pe agar
formeazà, colonii netede (în englezà sm,ooth-- neted). Celu,lele
sale sînt, înconjurate de o capsulà formafta din polizaharide
specifice încît existà pneumococi, de diferite tipuri serologice
Sr, S11,, Srrr.
Tiputr nevirulent nu pr,ezi,ntà capsulà Ei for,rne azà pe a€ar
col'onii rugoase. El a fost notat cu ,,Rtt (rough - ,aspru).
Îm mod spourrtan form,a S se poa,te trans;forima prin mutalie
în form,a R cu o frecventà foart'e micà dar niciodatà nu are
loc mutalia spontanà în sensul .R->S. Rezul,tà deci cà prin mu-
talie naturalà tipul R provenit din diferitele tipuri serologice
aile,lui S poate fi Rr, Rrr, Rrrr.
Injectînd la Eoareci pneumo,coci cu diferite variante expe-
rimentale, Griffi'th a constatat cà:
1. Tipul viruleurt ,,S* produce rboala Ei animalele mor;

11
r
2. Tipul virul,ent ,,Sn ornorit prin fierbene nu produce
boala;
3. Tipul ,nevinulent ,,R( 'n-u produce boala;
4. Dacà la aeelaqi $oarece se injectEazà simultan tipuriie
dirn variantele 2 Ei 3 animalul pr.ezínl,i,boala Ei 'moar,e. Din ssre-
menea animale s-au putut izola celule vii capsulate qi deci 'viru-
lente de pnreumococ. Experienla a t'ost riguru,s efectua€n exclu-
zîindu-,se posirbili'tatea învierii celule'lor de tip S omorlte prin
fierbere, încît s-8 impus o singurà concluzie: celulele vii 'ale
tipului R nevirulent în amestec cu celulele moarte ale ti:pului
S se transfo'rmà în celule viru,lente. Fenom,enul a fost numit
T RAIVSFOR MARE GEN ETIC 4..
Transformarea geneticà se desfàEoarà cu pne'cizie, pàstrîn-
du-se tipul serologic inifial: dacà în amstecul iniectat ,au intrat
celule de tip Sr omorîte prin fierbere qi celule Rrr vii, din
animale !-or putea fi izolate celule de tip 51 vii qi cetrule Rn.
Dintr-uo asemerlea arnestec ,nu vor putea fi izolate celule de
ti,p S ttt sau Sr rr. Acest lucru ar fi posibil numai în urma unui
fenomen de mutafie spontanà, dar un assrn€nea eveninrent esùe
pe de o parte foarte rar qi necesità P€, de al'tà parte un timp
cu mult rnai îndelungat decît dureazà experienfa de 'mai s:tls.
Celulele virulente de tip Sr renrtate prin tnansformarea c€-
Iulelor nievir"ul€nte de ti,p Frr aflate în prezen{a celulelor S
omorîte prin fierbere 'trsnsmi,t cu fidelitsb, în'generafiile celu-r
lar.e ulteiioane, caracùenrl de virul,en!à. Transformar,sa arìe astfel
carac,ter permanerr,t, virulenta fifuld înscrisà în 'baza eteditarà a
Rrt. Griffift nu a puhrt da o expLicatle csrespunzà-
c,e1,,u,1e1or
toare acestui pruces de transforrnare geneticà, dar el are un
merit de,osebit deoarec€ l-a sernrnralat penúru prirnar datà, iimput-
sionînd lumea qtiintificà la elucid,area mecanismul'ui sàu.
A doua treaptú în elucidar€a mecanismului transformàrii
est,e reprezentatà de experientele lui Al'loway efectuate în 1932
Ei de experienfel,e lui Dawson qi Sia din 1937. AceEtia au r.euEit
sà determine tra'nsform'area geneti,cà prfur cr-ll'tivarea cel'ulelor de
tip ,,R" în mediu lichid la care au fost adàugate extracte filtrate
obtinrute din Liza, celulelor de tip ,,S".
Deqi nu au precizat natur,a agentului transformant aceEti
autori au putut astfel excliude implicarea materialului capsular
în pnoces,ul transformàrii. Tnebuia càutatà aità substa,rrfà cu
pr'opri etàti transfortn an'te .
A trein trmptd qi c€a d'ecisivà în ,elucidarea naturii agentu-
lui transformalrt ,este repnezentatà de experienlele americanilor
O. T. Avery, C. M. Macleod qi M. MacCarty al'e càror rg2u,ltate

L2
sint publ.icate în 1944 într-s lucrare devenità clasicà. În aceastà
lucrare se aratà ,cà în urma cultivàrii eelulelon de tip R ftl pne-
rcrtta ADN înaùt purificat, extras de la celulele de tip S se poate
obline o transforro,arìe efectivà a cehrlelor rrevirulenrte R în
celule virulente, S. Descoperirea era suprinzAtoare (Wabon a
numit-o ,,bomba( lui Avery) pe fondul tmei' gîndiri dogmatice
dominatà de acceptar'ea generalà a ideii cà sulbstantele pno-
teinice au rol de rnateri'al ereditar, f,apt ce a fàcut ca '1a' început
chiar lui Avery sà-i viarà ,greu sà creadà în propri,a sa descope-
rire epocalà ! Di,n aceastà eauzà, reznrltatele unei asemenea ex-
perienfe trebuiau verificate riguros prin efeetuarea diferiúelor
teste. Astfel, testele senoLogice au ,el"iminat posi'bilitatea conta-
minàrii 'extracfului de ADN cu polizaharide. Testele proteoli-
tice, în Llrma càrora extraetul îEi pàstra activiùatea transfor-
mantà au eliminat posibilitatea ca proteilrele sà fie irnpli-
cat,e înr, fenomenul transf,or,màrii. În sfîrEit, ;tes'tul de drrgestie cu
dezoxiri,bonucleazà (errzimà ce hidroLíze,anà rnolecula polimericà
de ADN) aratà cà extrashrl îqi pierde proprieúatea transfonm€uî.-
tà. Era dovada peremptorie cà agentul transformant este ADN,
Prin aaeas'ta s-a pus piatra de ,tqmelie Ia zidirea g,enetici'i rnole-
culare, Etiin!à prin care biologia secolului XX qi a celor ct U
vor unna se va înscrie ca un domeniu rerrolu-tionar al qtiintelor
naturii. Descoperirea lui Avery qi colaboratorilor sài declan-
qeazà o febrilà aetivitate în toate labora,toarele lumii, Se de-
monstreazà ro,lul transfor,matrr't aL ADN qi la alte bacùeri.i apoi
Ia plante qi anima'le, fenomenul ,tmnsformàrii dewnind în cele
din urmà e cale prin care este transforrnatà dirijat ereditatea
in cadrul ingineriei g'ene,tice.
O altà dovadà a rolului geuretic al ADN ra l€prezentat-o des-
coperir,ea conjugórii fucteriene de càtre Irederberg gi Tatum în
1946. Acesta este un proces na,tural prin care ADN al unei
bacterii este direct transferat unei atte rbact'erii. Bacteriile se
deos,e'besc dupà tipul sexua't. Astfel sint bacterii de tip sexuat
mascul clesemnate F+ qi d,e tip sexuat fernel, desemnate F- între
el,e fiind un tra,nsfer unidir,ecfional de material gearetic de la
F+ l,a F-.
Capacitat'ea d,e a transfera gene o au numai acele bacterii
care posedà un factor ereditar numit frctor de fertilitute (F).
Aceasta repnezintà tot o moleculà ADN, localizatà ln citoplas-
ffià, adifionalà cromozomuiui bacteria,n principal. El se poate
integra în cromozomul, principa,l devenind ceea ce se numegte
u,n episom. În stare integratà faetorul F conferà bacteriei capa-
citate,a de a transfera cu o frecventà înal'tà gene la tipul femel

13
$i as€rn€rr€a tulpini au fost desemnate Hfr càci tra,nsferînd ge-
nele cu o mare frecven!à determimà totodatà o inal'tà frecvenfa
de reeorn,bi,nare a gemelor în popul'afia [bacterianà considera'tà.
Tnansferul de gene se face într-o manierà ,unicà, s'ecvenfialà qi
orientatà, pe ,baza sa stabilindu-se ordinea genelor pe cr€mozo-
mul bacterian (cartare,a geuricà) qi totodatà s-a conchis cà ,acesúa
are forrnà circularà. Conjugarea baot'erianà explieà rolul pe
care î1 are ADN în ereditate, statutul sàu d,e substantà ere-
di'tarà.
,În annrl L952, N. Zinder qi J. Ledenber,g descoperà transferul
de gene între diferite tulpini bacùeriene mediat prin transduc{ie
fagicd. Bocteriofagii sînt virusuri ale bacteriilor descoperit'e în-
cà din 1917 de cà'tre d'Here1le gi cane se ,mai nurnesc simplu
fo,gr.Fagii se multiplicà în celulele bacteriene lizîndu-le (ciclul
liúic) sau îEi integre azà ADN lor în cromozomul c,elulei 'bacte-
ri'ene (-ciclul lizogen). Ciclul litic Ei ciclul lizogp6l sîrnt rever-si-
biLe. Integrat în cromozomul bacterian La iegiree din acesta
ADN fagic poate smulge gene baeùeriene pe care sà le trans-
fene la, o al'tà tulpiurà (Ftg. 1). În aceln+i an, A. H,er-
'bàcteriaura
+--+ SUfftune 5t
presiune
alt'ernariL

(Ohe- f r P- mef r 'lis+,


lA Z( phe + lrp, qet- nis- I A
22

protof rof i ( phe+ trF+ nef+ hts+ )


atI dpdr prototrofr

Ftllru de
Fig. î. Experienfa de transducfie efectuatà de Zinder gi Lederberg în 1952.
Douà tulpini auxotrofice de Salmonella typhimuri%ffi, LA22 qi LAZ au fost
plasate fiecare într-un bral separat al tubului Davis de forma literei It. Brafele
sînt separate printr-un filtru d.e sticlà care nu permite schimbul de celule dar
permitè trecerea mediului lichid dintrun-un braf în celàlalt, astfel' cà cele d.ouà
tulpini sînt de fapt crescute pe un acelagi med.iu. Formele prototrofe apar numai
în bralul care confine tulpina LA22 nu însà gi în acela care confíne tulpina LAz.
Cu alte cuvinte un ,,agent filtrabíI" (FA) activ genetic apare legat de tulpina
LAZ care poate produce prothtrofi La22. S-a d.ovedit cà ageutul filtrabil este
de fapt un fag temperat care a trecut odatà cu mediul de culturà prin filtnr de
stidó de tulpina LAz la tulpina LA22 pe care o lizogenizeazà,, transfedndu-i
genele de tip sàlbatic (poe+, trp+) d,e la tulpina nelizogenó LAZ gi transformînd-o
astfel într-o tulpina prototrofà. Acest fenomen d.e trecere a unor gene de la o
tulpinà bacterianA la alta imediat d.e fagi s-& numit transducfie fagicà. F*gul
transductant a fost desemnat Prr.

T4

i.
.. 32
o'p- p ce rntró în ADtl
rta fonto.r,o ' 35 S ce intró ín
f.tgicó ProtetnEls
[tà. copsrdeu
$i
ZO-
/-- , -bGCterie"
;ta
pe
ìg_

Fig. 2. Demonstrarea rolului genetic al ADN prin studii autorad.iografice efec-


tuate de Hershey qi Chase (1952). a.b. - radioactivitatea însofegte numai ADN
qi se deceleazó" în interiorul celulei; c, d. - radioactivitatea însofegte numai pro-
teinele gi nu apare în interiorul celulei bacteriene gazdà.

shey Ei Martha Chas'e, demo,ns'tre azà. rolutr în ereditate a,l ADN


fagic, excluzînd totoda;tà orice implicalie dir,ectà a proteinelor
in fenome,nul 'ereditar (Fig. 2). Fagii pàtrund în celula bacteri,a-
nà unde s,e mu:ltiplicà pe sea,ma componentelor celul,ei gazdà qi
apoi, în urrna lizei celulei bacùeriene se elibereazà noiil.e parti-
cule fagice. Bacteri'ofagii au a1càtuire foarte simplà. Ei prezin'tà
o capsidó, proteinicà cane încon'jurà u,n miez de ADN. Auú'orii
au f'olosit bacteriofagi de 'tip T2 ca're conlin coa 400/o ADN $i
6A0/a proteine. Capsida proteinicà, î,n interiorul càreia s,€ aflà
ADN form,e azà, capul rbacteriofagul'ui care se continuà cu ,o
,,coadà33. Cu ajutorul eozii, 'bacteriof,a,gul se ataEeazà la peretele
celu,lar aI celulei bacteri,€n€, coada avînd la partea sa distalà
o placà h,exagonia[à cu gas€ spini scurfi qi nurnenoase fibrile Ei
posdà activita,te li'zozimicà prin care peretele celulei baeteriene
este dizoivat local. Pe a,ceas,tà cale ADN fagic este injectat în
rnt'eriorul celul,ei bacteriene, înveliqul proteinic a,l fagului ràmî-
nînd la exterior sub for,mà de ,,fantomàí fagicà. Prin experienfe

15
I de marcare cu izotopi radioactivi, Hershey Ei Chase au de-
murstrat carre este funcfia ADN (Fig. 2). Comptrlen,ùele bacterio-
fag{ilui au fost marcate ,f rînd, proteinele capsidei cu 3qS qi
32P. 35S
4DN fagie cu Ei 32P diferà în intensÍ;tntea energiei ra-
diafiilor B pe care le emit fiind u$or de distins. Cu asémenea
bacteriofagi marcali au fost infectate culturile ,bacterien,e. Prin
urentrifugare au fost î,ndepàrtafi bacteriofagii urea'taqatt iar prin
agitare puùernicà s-au putut separa ,,fantomre,le6s fagice. Cînd
s-au marcat pruteinele cu 35S s-a eonstatat cà ùrtre AO qi g7o/o
din 3qS este asociat cu fracfiun,ea proùeinicà a ,,faurtomelors fa-
gice. Cînd s-a marcat ADN cu 3ZP s-a consta,taú cà cea mai mare
parte a radioactivitàtii apare în interiorul celulei bacteriene. S-a
tras concl,uzÍa cà îilr. timpul ilrfecfiei fagice ùr celula gazdà nu
pàtrunde întreg lbacteriofagul ci numai ADN-uI sàu. Ac€sta stà
Ia tle;za rnultiplicàrii fagului cu aparifia de noi partieutre f'agice.
identice cu eea inifialà. Deqi în celula gazdà pàtrunde doar
ADN, dupà 30 minuúe rezultà panticule vira,le întregi care
conlin atît acid nucleie cît qi pnoteirÌe. Rezultà cà ADN con-
line toatà furforrrnafia eredi,tarà, atît pentru propria sa sintezà
cît Ei penrtru sinteza prote,inelor virale.
Aceste douà cate,gorii de experienfe d,e ,transformare Ei
de infecfie fagicà au demonstrat faptul, cà ADN-'utr reprczintó,
mnfurinlul gtenetzc, substratul chimic al ereditdfii, otît ls, uiru-
suri cit fL la sistemele Aiobgice celulare.
Dat fiind faptul cà uurel,e virusuri rùbouiru,suril"e pr,e-
zintà ca rniez de acid nucLeic acidul ri,bonucleic (ARN) s-a pus
în mod firesc problema cin'e îndeplfureqúe, în acest caz rolul de
material ereditar.
Experienlele lui Fraenke,l-Co,nrat, Singer Ei Williams pe d'e.
o par,te Ei ale lui Gi,erer qi Schrarnm pe de alta, desfàqurate,
între 1955-1956 au adus dovezi sigure, dupà care la ri,bovirusuri
ARN viral. îndepliureEte rol de material er.editar (Fig. 3). Aceqti
autori au lucr,at'ctl virusuù rnozaicului tutunului (VMT) oare are
formà cilindricà în interior aflîndu-se ARN (60/a) ce ,este încon-
jurat de proteinà (94o7o| avî,nd o lungime de 300 pm gi o 'làfime
de 15 pm. Pe cale chirnicà proúeina viralà poa'te fi separatà de
ARN. Cele douà compon,ente pot fi astfeL in,ocul,a,te separat la
plante de tutun. S-a constatat cà proteiura viralà nu estre capa-
bilà d,€' a determina infecfia vira,là pe cîn,d ARN viral are'
caracùer infec{i,os.
Cînd Gi'erer gi Sc,hramm au fol,osit ARN pur izolat de la
VIW| spre a infeota pla,nte de tutun, BU constatat cà se produce

16
3. STRUCTURA ACIZ,ILOR }IUCLBICI

3.1. SCURT ISTOR,IC

Acizii nucleici sînt acizi ,orga'nieí car'e aonfin f,osfor, r'spre-


zerr-tînd substante macromoleculare din grupa,biopolimerilor.
Descifrarea structurii ADN a fost îndelung pregàtita. În
anul 1868, studentul elvelian de numai 24 d,e ani, F. Miescher
descoperà în nucleii celulelor prele,vate din plrroi uman, ,c8 de-
altfel qi în lapfii d,e somon qi sperma altor animale o substan!à
cu un înalt confinut d,e fosfor pe care a nu'mit-o nucleinrt Ei pe
care, în 1872, 'c considerà a fi materialul genetic activ at sper-
matozoizilor. Mult timp aceastà idee nu a fost îmtbràliqatà de
iurnea biologilor. Abia îrn 1939, Astbury Ei Caspersson, în ca-
drul celui de-al VII-le,a Congnes de Geneticà, vor avansa ideea
cà acizii inucleici ar servi ca matrifà pentru siurteza proteinelor,
asigurînd reproducerea materiei vii.
În 1899, R. Altmann identificà în mucleina d'e d'rojdie o sub-
stan!à macromo,lecularà pe care a numit-o acid nucleic. În anul
1909, P. Leven,e aratà cà acidul nucleic de drojdie oonfine patru
baze aza,tate: odenina, gunnina, citozinn qi unacilul precum Ei
acid fosforic qi o pentozà riboza. În 1930, ac'elagi autor ana-
Iiz.eazà cornpozifi,a chimicà a acidului nucleic din 'timus Ei con-
statà cà acesta cornline adnnind,, guanind., citozind qi timind, ca
baze azotatn precum Ei acid fosforic Ei d'ezstirùbozd. La acea
vreme, ,acidut care es,te nucleic de la drojdie a prinit denumirea
de acid riborw"cleic (ARN) i,ar c.el din timus de vigel a fost numit
acid timonucleic, de fapt acid dezoriribonucleic (ADN).

3.2. STRUCTURA PRIMARA A ADN

Unitàlile structurale al,e ADN, rnonomeri, se numesc nr,t -


cleotid;e. D'e aceea acizii nucleici se numesc polinucleotide, adi-
cà polim,eri de nucleoticle. În anul 7952, Todd a s'talbilit ;tregà-
turile chimice dirr-tre co,rnponentel'e de lbazà, ale nlacromolecu-
lei ADN. U,n nucleotid este alcà'tuit dintr-o bazà, anotatà, o
mroleculà de dezoriribozd, Eiun rest fosforic. Bazele a:zofra,te sînt
de tip organic, relativ hidrofobe. Ele sînt de douà feluri : puri-
nice adenina (A) Ei guanina (G) Ei ptrimidinice citoziura
(C) Ei timina fI). Nucleul purinic este ,un dublu heterociclu al-

1B

t
C
H
r'N Hr
N,/ùc/r\ ,,r49\c/\
''l il cH
[ ;lr /
E
di|/ \cz \
nJ

HCs.#Ò--
Nil g
à..
HC f.. ,-C--. ,/
NN
ril
/'c\^-
n
\.,

H HzN NH

Fig. 4, Nucleu purinic. Fig. 5. ddsnina. Fig. 6. Guanína.

càtuit din 4 a'tomi de ar'ot (N) Ei 5 atomi de, carbour (C) (Fig. 4).
Adenina este o 6.aminopurinà- (Fig. b), pe cînd guanià"-este
2-amino, 6-oxipuri,na (Flg. 6).
Nucleul pirimidinic este un heterociclu aroma,tic alcàtuit
din 2 atomi de azot qi 4 atomi de carbon (Fig. 7). Timina este o
?,6-dioxi, 5-*gtilpirimidina (Fig. B) iar citozina este o 2-oxi,
6-armiuropirimidfutà (Fig. 9). Bazele azota,t'e A, G, T, C, pred.o-
minà în ADN de Ia marea majoritate a speciilor. În unele ca-
zuri însà, 'bazele azotate obignuite pot fi ilrlocuite de unii deri-
vatt ai lor (Frg. 10-13). Astf€I, la grîu circa tlq din resturile
citozinà apar ca 5-metilcitozinà, care are pnoprietàli de îrnpere-
chere asernànàtoare citozinei. Acest derivat al' citozinei apare qi
la alte gramin@, 6ealtfe'1 Ei la mamif'ere.
[,ar fagii de tip"*T ai ,bracteriei Escherichia co:|,i, (8. coli,) cito-
zima este întrocuità compleú ou 5-hidroximetilcitozina care de
regulà este conrjugatà cu gil.ucoza. De asemenea, la unele viru-
suri se aflà 5-hidroxirneti'1uraci,lu1, iar la unrele lbacterii se aflé
O-metilpurinà.
Purinele qi piri,midinele oomfin dutble legàturi sau legaturi
conjugate, din care cauzà ele se po't pnez'enta sub forme chimice.

o NHr
lL
rll
**[' -f -cHl
C
C y1 2 \..cH,
x/ù cH iil
tl\ :il
3-'C H 1,.-*'cH
htc
N H
or-*-ci-i'
Fig. 7. Nucleu Fig. 8. Timina. Fig. 9. Citozina.-
pirimidinic.

19r
6- netrlaninopurìna 2 - anrnopurina

[-t N -c Hl htpoxanfina

v NA*zri N
\r

Jt-*A_) rrí
{ HzN-L-*
H
\
N
A nalcai ai edentfrèí n tralog al guaninet
Fit. 10. Analogi si adeninei : &metilami- Fig. I î. Amlog al
nopurina gi 2-emlnopurine. guanineí; hiporen-
tina.

ura c ilul 5-bronouracil r \. 5- fl uorouractÍ

o ''o \ \o
**r\Br' HN )ly,
* o^d "' Al
A na logi ai uret'iluluì
Fig. '12. Analogi ai uracilului. Uracilul ; S-bromouracil ; S-fluorouracil"

5 -nettlcrfoztnà 5 - hid r ox t n e ! t i c : !' o z ì n i 5 - b ro moc tloz;n t


NHr NJ H2 NHr
IL l'
N* cHr
LcH2oH N,ry*
0
L) NH oLJ
N
lil
,,4.'/
vN

Analogì aì citozinei
.Fig. 13. Analogi al citozinei. S-metilcitozinà; S-hidroximetilcitozinll; S-bromoci-
tozinl,.

20
diferi.te, cun,oscute sub d'enumirea cle structuri fut^ttompre. Ast-
fel, rnucleel,e, structurale ale macrornoleculei ADN se caragùeri-
zeazà, ,atît printr-o mare stabilitate structuralà, cît Ei prin posi-
bilitàti de a se prezenta sub variante structurale. Asemeneà
àspecle c'o,ntra'dictorii stau l'a baza dialecticii fenomenului ere-
di tal'.
Purin'eLe Ei pirimidi'nele pot r'ealiza legàturi chimice cu pen-
tozele. Atomii de carrbon ai pentozel'or sînt num€'rotafi l' , 2' , 3',
4' gi 5'. Cat'bonul I' a,l pentoz,ei ,s,e leagà cu a'tom'ul dre azot din
pozifia 1 al pirimidinei sau cu ato'mul de arnt dfur pozifia I al
purinei. Prin intermediul restului fosforic s€ rsalizeazà 'lqgà-
turi între caflbonul 5' al dezoxiriibozei unui nucleotid qi carbonul
3' al dezoxiritbozei nucl,eotidului urmàtor, forrnînd{"r-se serii
lungi de asemen,ea legàturi 5'-3' sau 3'-5' în cadru,l polime-
rului care stau la baza structurii primare a'maeromol,eculei ADN
nepresent'atà de ro catenà polinucleotidicà de 'lungime variabilà,
specificà fiecàrei specii. fuegà'turile 5'-3' sau 3'-5' r,eprezintà
legàturi internucleotidice fosfo-diesterice poval,en'te, realizate
i,ntre acidul fosforic qi grupàrile hidroxi'lice (oxidrilice) al'e
glucidului din pozifiile 3' gi 5', avind loc esteri,ficarea a douà
grupàri hidroxilice al'e restului f'osforic:
R1
I

o
I

C) _-P-OH
I

o
I

R2

Legàturile, fosfodiesterice sînt foarte puternice' Ei deci stabile,


pe s'eailt& lor realizîndu-se o structurà f,iniarà, nepr€zen,tînd o
adevàratà coloanà vertebralà a monocatenei ADN. În structura
macr,omoleculei ADN iur,trà patru tipuri principale de nucleo-
tide: dezoxiadenozintrifosfat (dATP), dezoxitimidimtrifosfat
(dTTP), dezoxigu'anozintrifosfat (dGTP) qi dezoxicitidintrifosfat
(dCTP). Cînd se asamibLeazà, în monocatena po,linucleotidicà
acreste nucleotide ràmîn sub formà de dezoxinucleotid-5'-mono-
f'osfat.
Nucleotidul prezintà o regiune specificà, ,r€pnezentata de
baza arntatà Ei o regiuure nesp€cificà reprezentatà de dezoxiri-

2l
r
r

bozà Ei res,tul fosforic. În cadrul macr,omol'eculei, pun{ile fosfo-


diesteric,e s€ stabilesc î,ntotdea,una între aceleaEi grupàri care
sînt grupàri nespeci,fice, ceea ce conferà acestei pàrti a rn,a,cro-
molec'ulei o mare regu,laritate, respectiv uniformitate, ce ca-
racterizreazà, ,toate ,moleculele de ADN, d,e, oriee provenien!à ar
fi. Nu acelaEi lucru s€ poate spune despre bazele azotat€, care
repreziultà r,egiunea specificà a nucle,otid,elor, a càror înqiruire
de-a lurrgul catemei pol,inucleotidice variazà de la o m'oleculà
de ADN ,La alta, adicà de la o specie la alta qi aceastà orînduire,
secverrfà de 'baze, az,otate, specificà fiecàrei specii, r€prezintà
modul în care ,este înscrisà, (surb formà codificatà ibiochimic) îr .^
macromoleflila ADN infonnatia geneticà ce dirijeazà r,ealiza-i
rea diferitelor caractere ereditare.

3 3 STRUCTURA SFCUNDARÀ A ADN


:

Pen,tru d'escifrarea struchrrii secun dare a, ADN au fost f o-


losite metode precum spectrofotometria, rezonanta m,agneticà
nuclearà, albsortbfia în ultraviolet, crofrnatografia î,n raz,e X etc.
Difrac{ia îm raze X a dat cel,e mai bune rezultate în d'escifrarea
structurii secundare a ADN.
Primele cer,cetàri privind descifrarea structurii ADN prin
analíza imaginilor difracfiei în raze X au fost într,eprinse de
càtre Astbury în anul 1938. În acelaEi an Astbury qi Bel,l ,arr
aràta,t cà macromolecula de ADN ane ro structurà fibrilarà, iar
pe axa sa Lun,gà bazEle azotaúe stau perpendicular, între d,ouà
baze azobte vecine fiind o distanr!à de 3,4 A. Cele mai bune
imagini ale difracliei în rare X sînt însà otbfinute în periroada
1950-1952 de càtre M. H.F. Wilkins Ei Rosatlind Franklin. Prin-
cipiul difracliei în raze X este urmàtorul: un fascicul, de raze
X trece priurtr-o substan'tà Ei cade apoi pe o placà fotografi,cà.
Dacà substanta prezimtà un aralrja,m,ent ner,egulat a'l unitàfil'or
sale structurale r,azele X votr produce pe pJ.aca fotograficà o
patà centra'là repnezentînd pozilia fascicului principal. Dacà
subr-rnitàfile substanlei prezintà u,n aranja,ment ordonat, ra-
zel,e X vor fi d.eviate îm anumite direclii rnai mult decît în al-
úele. Dacà aranjamentul subuni'tàlitor preziurtà un mode,l ce se
repetà regulat, pB placa fo,tograficà vor apare benzi foarte dis-
tincte între care 'existà spalii fo'arte clane. S-a constatat cà ADN
care provine de la sun$e f'oarte difurite produce prin difraclie
în taze X un model de benzi foarte clar qi aproape Ídentic
22
ceea ce deno,tà aranj,amentul ordonat al rnonomerilor în ca-
dnul, macrornoleculei ADN. Ma,i m,ulú, modelul de difracfie în
raze X a sugerat cà macromolecula ADN ar,e o struchrrà heli-
coldaià (Frg. 14).
De o deosebità importa'n!à în elucidarea structurii secundare
a ADN s-au dovedit a fi cercetàrile lui Chargaff dful 1950, prin
care ,s-a stahilit, contnar pàreril,or oomune dominate de con-

rq A

f O fi ---- )
.Fig. 14. Structura secunsari a ADN Stlonstantele fizice ale mactomoleculei.

23
ceplia ,tetranucleotidului lui Levene (macr'omoleculà ADN/1a
toate speciile rezultà printr-o repetare uniformà a celor pa,tru
nucleotide), cà cele patru baze azotate principale care, 'intrà în
stntctura ADN nu sînt prezente în propor{ii e,gale la diferiùele
specii. Mai mult, el a staibilit r€gula echivalenfei dupà care ,t,ot-
deauna cantit'atea de adeninà (A) este ega'tà cu ace€a a timinei
fI) iar canti,tatea de guaninà (G)-este "Suta cu ac€ea a citozirrei
(C) de unde rezultà un raport T/A-C/G
foa'rte diferirte precurn Mgcofu:ctqium tubercrrtosis ansium" Soc-
charomryces cereuisine, Bos tantrus sau Homn sopnens. Aces:te
constatàri cunoscute qi surb denumirea de legile lui Charga,ff au
reprezentat un punct de sprijin de mane importantà pentru ,ela-
borar,ea ideii împerecherilor de baze, piatrà de temelie a mode-
lului propus de Watson Ei Crick în 1953 pentru structur,a se-
cundarà a ADN.
Pe de altà parte studiile de hidrolizà, urmatà de s,epararea
cromatograficà a bazelor azotate Ei estimarea lor cantitativà în
spectrofotometrie în u'ltraviolet, efectuate de càtre Chargaff gi
colaboratrorii în 1949, au aràtat cà ADN d,e la cele patru specii
menfionate anterior are o compontie în baze azotate foarte di-
feri,tà, raportul A + T/G + C fiind foarte variabil la aceste
organisme, independent de lesutul sau de individul de la care
este ex,tras ADN
Tabelul î
Compozlfin tn baze a AIIN

Proporfia în u/o
Specia
alrlclc
Om (spermà) 31,0 31,5 19,1 18,4
Somn (lapfi) 29,7 29,l 20,8 24,4
Arici de mare 32,8 32,t t7 ,7 17,7
Drojdie 31,7 32,6 18,8 17,4
Mycobacterium tuberculosis l5,l 14,6 34,9 35,4
Escherichia coli 26,1 23,9 24,9 25,1
Virusul Vaccinia 29,5 29,9 20,6 20,3
Bacteriofagul Ta d.e E. coli 32,6 32,6 18,2 16,6*

* S-hidroxímetilcitozinà
Apar varia{ii mari în raportul A+T/G+C la di-ferite orga-
nis,me (ta',belul nr. L). L'a plante,le Ei ani,malele superi,oare apare
un exces de A + T fa!à de G + C. Varia{iile acestui raport nu
sînt întîmplàtoare. Raportul A + T/G + C este specific fiecàrei

24
speci.i, fiind ,mult mai apropiat la rorg€Inismele înmdite filoge-
netic.
Sintetizînd în mod magistral date,le ecumulate în literatura
de specialitate, bazafi Ei pe ,experienlel'e proprii incluzînd tno-
d,elarea molecutrarà, în anul 1953, Watson qi Crick au propus
modelul de structurà bicateurarà a ADN (Fig. 14). unanim BC-
ceptat, reprezentînd una dintre cele mai mari descoperiri din
istori,a Etiinfei, pentru care autorii au primit pr.emiul Nobel.
Mod,eluL propus de Watson gi Crick se deos€tbea radical de
modelul ,tricat€rr,àr propus de Linus Pauling qi Corey în care
baz'ele erau dispuse la exteriror Ei în care nu existau forte care
sà asigure stabilitatea structurii tripiu catenare, iar unele dis-
tanfe uan der Waals ,erau prea mici (Wabon $i Crick, 1953).
I)e asemenea Watson qi Crick aÌu adus argumente qi îm,potriva
mod'eiului tot tricatenar propus de Fraser, înaintat spre pu,bli-
care chiar în perioada în care apànea lucrarea 1or. Ei au propus
modelul de structurà ibicatenarà, în cane fiecare catenà heli-
calà s,e ràsucneqte în jururl aceleia$i axe virhrale Ei 'constà dilr
grupe fosfodiesterice care unesc nesf,urile B-D-dezoxiribofuralto-
zice cu legàturi 3', 5'. Am,bete catene sînt orientaùe dertral,
dar s€cv€nfele a'tomilor in cele douà catene sînt ori,en,tate în
dir'ecfii opuse. Bazele se aflà spre interiorul helixului iar gru-
pele fosfat în afarà. Zahàrul este perpen'dicular pe bazà. Struc-
tura, prezin'tà repetifii (pasul eìicei) dupà fiecare 10 resturi pe
fiecare catenà, adicà dupà 34 A, existînd cîte un rest (baza) pe
fiecare catenà la fi'ecare 3,4 A. Distanta aùomuLui d'e fosfor fatà
cl,e axa fiibrei este de 10 A. Fiind dispuse la exterior, gnrpàrile
fosf,at sînt uEor accesibile' cationilor. Aceasta ,este o structurà
deschisà Ei con{inutul sàu de apà ,este mare. Planurile lbazelor
sînt perpendiculare pe axa fibrei. Ele 'sînt r.rni'ùer prin pun{i de
hidrogerÌ, formînd perechi specifice de b,az'e càci to'tdeau,na are
lroc uÈirea unei baie purinice cu una pirimidinicà Ei viceversa.
Astfel, ADN se prezintà ca ,o suibstan!à ma'cro,molecularà rbi-
cat,enarà, adicà alcàtuità din d,ouà lan{uri polimerice (catene)
ràsucite ;plectonemicul unul în 'jurul celuilalt dupà un ax vir-
'tual, rezul'tîurd structurà 'bic,aten,arà he[i'coidalà numità dublu
nttK*-^t*t
dubtutui helix,este de 204 avînd un pas (spirà)
de 34 4.. spirà a dublului helix ADN cuprinde cîte 10
Fiec,ar,e,
nucleotid'e, ceea ce înseamnà cà dimensiu,nea fiecàrei baz.e este
de 3,4 A.
C,e[e d'ouà lanfuri polinucleotidice sînt antiparalele, adicà la
unu,i legàturil'e f,osfodiest'erice, s,e r,ealizeazà între C 3' al dezoxi-

25
7

rirbozei unui nudleotid $i C 5'


al dezoxiri;bozei nucleotidu-
lui vecin, pe cî,n'd la niveflul
celuilalt lan! polinucleotidic
legàturile fosfodiesterice se
rearlizeazó, în seos, inver-s C 5'
dezoxtribozà Q 3' . Rapor,tu.l A/T -
---v
G/C: 1 a sugerat realizarea
ciîosinà guaninà unor împ'erecheri, d'or,'eclite a
fi real'e Si prin modelare mo-
lecularà, între A $i T r'espec-
'' I tiv G gi C. Împerecherea de
delr.ri ri boz6
dczoxiribozà
baze azotate are la bazà prin-
cipiul compl€mentarità{ii, cel
mai de seamà în organizarea
Fig. 15. Perechile specifice de bazà A:T
Ei funcfionarea rnaterialului
gi G : Q eare stau la baza structurii
bicatenare a ADN. ereditar. Astfel, A se dove-
deEte a fi complementarà lui
T iar G lui C, adicà hazele
purinrice prezintà complementaritate chi'mico-spafiatà pentnu
cele primidinice, iar bazele pri,midiuricre' prezimtà compleme'n-
taritate pentru cel'e purinice (Fig. 15). Asem€in,€,a perechi d,e
baze prezin'tà dirnensiuni egal'e conferind ma,cromolecvulei. ADN
un diametru uniform pe toatà lungim,ea sa. O împerecher,e
purinà-purinà sau pirimidinà-pirimi'dinà ar depàqi sau ar fi
mai, mica faF de diametrul de 20/^ cît are în mocl nor"m,al
dub,l'url he[ix ADN lipsimdu-l de reg'ulari'tate. Îm'perecherile cle
barn se realizeazà prin intermediut u:rror punli de hicirogen,
douà între A qi T qi trei între G qi C. Î,mperecherile sint, re-
ciproce: A-T, T-A respe,ctiv G-C, C-G.
Dar legàturile de hidrogen joacà un rol foarte important în
reacfiile biomoleculelor, formîndu-se Ei dezorganizîndu-se cu
uqurintà fàrà a necesita surse energetic'e speciale, avînd totodatà
rol esen{ial în reacliile car,e imp,licà recunoaqterea de, structuri
compleurrentare cum ar fi replicarea, tra,nscrierea Ei repararea
ADN ca Ei în traducerea me,sajului genetic.
Structura bica'tenarà a ADN prezintà de regulà o mare
stabilitate' rizicà, asi.guratà pe verticalà d,e' punlile fosfodieste-
rice intraca,tenar,e, iar pe orizontalà de punfile de hidrogen in-
tercatenare qi de stivuirea (stacking) perechil,or de baze ,a'za-
tate în cadrul dub'lului helix, 't,oa,t,e acestea fàcînd ca ADN
duhlu-catenar sà aparà ca o structurà CIarecum rigidà, para-

26
cristalinà. Caracteristicile structurale finale ale ADN dublu-ca-
l
tena'r sînt dictate însà de moieculel'e de dezoxiribozà care se
aEazà cu ,oxirgenul inelului orientat în sus Î,n cadrul unei catene
qi ,orienta't în jos în' cadrul catenei complemen,tare. Din eauza
acestui aranjament opus al moleculelor de dezoxiri'bozà în cele
douà catene Ei d'eoarece zahàrul 6e leagà la o pozitie exc€ntricà
a b,azei az'otate, întreaga mroleculà de ADN este obligatà sà se
ràsuceascà, sà se spiraliz'eze, rezultînd nu o s'tructura dreaptà
bicatenarà ci una spiraiatà dublul h,eli,t, în care fiecarre p,e-
reche succesivà de baze azotate se întoarce cu 36 " în direcfia
acelor',de ceas,onnic, dublul helix fàcînd u,n úur complet (360o) 1"
fiecare X0 perechi cie ,baze.
Structura polimericà a macromoleculei ADN permite în-
scrier',ea în aceasta, sub formà codificatà, a unei cantitàfi de
informaiie geneticà teonetic nelimitatà. Nu,màrul, permutàrilor
posi{bile este de 4n, în ,car,e n reprezin'tà numànrtr nucleotidelor
de-a iungul u:n,ei catene ADN. Cunoscînd cà cele mai rnici virr.'-
suri au în ADN cel pu{in 1500-3000 nucl'eotide, aceasta fiind
limita inferioarà dirnensionalà a genom,ului pentru sistemele
biologice, pute'm a:vea im,aginea enormei diversi'tàti informa-
{iornaie a siste,melor 'ereditare din lumea vie, Ei ne ptrtem ex-
plica, de c€ este ,posiibll ca fieca,re specie sà ailbà pnopria sa in-
fonmafi,e ereditarà, rdiferità de a altor specii.
Rece,nt douà eohipe de cercetàùori, una americanà condusà de
A. Rich de la Massachusetts Institute of Technology, gi alta
ol,and ezà (J. H. van Boom qi Gijs van der Marel) de ,la Uni-
\rersitatea din Leyda au descris la nivelul unor polinucleotide
sintetice de tip p,oli d (G-C) duplexuri ADN cu spirala orien-
tatà se,nestrLt (ADN de stîn*ga) avînd conformalie dife,rita de
ADN ,normal cuno,scu't ca ADN de dreapta. ADN de stî,r\ga pre-
zintà aceeaEi regularitate internà, 'aceleaqi asocieri de baze
az,otate ca Ei ADN de dreapta, dar Ei unele difer,ente stnrrchr-
rale consid'erabile. Astfel, în ADNT de stînga grupele fosfat se
dispu,n, nu dupà uin traiiect rectiliniu, ci dupà 'un tra'iec*t îm
zLg-zag, ADN de stînga, numindu-,se Ei ADIV-Z. În ADN de
stîng,a perechile rd'e ibaze sînt expuse mai spre exteriorul dutbl,u-
lui helix Ei pasu[ elicei c,uprinde, nu 10, ci doar 6 perechi de
b,aze, din care cauzà, forfe'le de stivuire sînt mai mici iar mole-
cula cle ADN-Z apar,e mai fragilà, avînd un dia'metru ceva
ma,i mic.
Plasarea perechilor de bazre' ,azo'tate mai spre ,exteriorul rna-
cromol,eculei ADI.{-Z face ca su,bstanlele reactante sà interacfio-
n,eze rnai usor cu ibazele azotate. Dacà a'ceste su'bstante sînt can-

27
r
I

cerig€re, ADN-Z poate sà condilioneze transformarea rnal,ignà


a celulei. StructurA de fip ADIV-Z poate sà aparà în anurnite
condifii chiar în cadrul structurii normale de ADN nativ l'a ni-
velul unor anlunite segrnente ale acestuia.
Conformafii sen,estreau fost descrise la nurn,eroase polinucleo*
tide sintetioe de 'tip pali-d (GC), poli-d (GC) sau poti-d (AC).
poli-d (GT). Se aratà cà structura sen,estrà este accesiibilà ori-
càrui segment de ADN cu o s'ecven{à de 'baze alter'native puri-
nà-pirimidiurà (Arnott Ei colab., 1980). I)escoperirea, confcrma-
{iei senestre a ADN extinde eno'rm limitele structurilor $ecun-
dar,e cunosc,ute pentru duplexurile ADN. El,e pot fi implicate în
multe aspecte referitoare la schi,rnibàrile conform,afiona'le ale du-
plexu'lui ADN în replicare, dena,turare, transcrier,e. Regiunile
dextre Ei s,enestre dintr-o moleculà de ADN pot fi separate dcar
de 2 nucl.eotide.
P'e baza datelor de structurà a ADN se poate deduce funclia
sa de rnoleculà informafionalà Ei se poate defini unitatea func-
fionalà de transrnitere a caracter,el'or ,ereditare care a fost nu-
mità gènd,. Genq, reprezùntd lLn se'gmeflt, o por[iune din lnfrero-
m,alecula de ADN la tost'e sisternele biologice sau de ARN (l,a
ribo'uirusuri) de lungime uarinbild care define sub farmd codi-
ficatd informn{ia ereditard ce dirije'azd, sinteza unei ca'tene po,li-
peptidice. Gena c,on{ine în m'edie între 900 Ei 1500 perechi de
nu'cleotide. Peste arrrumite limite de temperaturà (într'e 63aC .9i
100'C) stabilitatea legàturilor de hidrogen cedeazà avînd ioc
desfacerea dublului heiix.
În c'eLe douà catene complem,entare, fenomen ,numit clena-
turare termicà. Cea mai scàzutà ,temperaturà de denaturare cu-
noscutà este' 65"C qi se Înregistreazà în cazul den,aturàrii poli-
nucleotidului sintetic poli d (A-T). Dacà amest,ecul monoc&t,€n€-
lor r,ezultate din denaturarea dublului helix de ADN se ràceqte
brusc ele rà'mînd permanen,t separate' gi un asemenea ADN se
llumeq.te ADN denntLdtr'at. Dacà amestecul de rnonocatene se rà-
ceEte lemt, treptat, are loc o reasocier,e a catene'tror cu refacerea
legàturilor de hidrogen di,ntre el,e, r,estaibilindu-se structura bi-
cat'enarà a ADN. Acest fenom,en s-a numit rennturareq ADN
(Fig. 16).
Temperaturà de denaturare p,oate constitui un indiciu indi-
rect privind prooentul d,e baze azotate din struct,ura ADN. thir
ADN în care predominà perechile A-T, între care existà 2
punfi de hidrogen, v8 prezent,a o temperaturà de denaturare mai
micà deeît un ADN în' care predo,minà perechite G-C care,
prezentÎnd trei punfi de hidrog€D, sînt mai rezistente la dena-

2B
il
Af, cíe'cturare

a
H
AD I{
-
qnr
z,"qJ

r &4: j: gj:

ADN AR N ir,rlerenicn
Fig. 16. Denaturar_ea.gi renaturarea aDry (A). Denaturarea gi
hibridarea molecularA (B).

"toC*C
100

BO

Hycoba cterrun phlei


60

40

Fit. 17. Temperafura de de-


aefurare a ADN de la diferite ?0
surse, avînd un confiuut va-
riabil G+C (dupA J. Marsrur
$i P. Doty, 1959). 0

29
F-

turare, nec,esitînd pentru aceasta o temperaturà mai ridicatà


(Fig. 17).
Prinr denaturare-r€rrsturare se pot rea,liza hibrizi ,moleculari
între ADN ,ce provine de la diferite specii, putîndu-se aprecia
gradul de înrudir,e dintre specii pe criterii rnoleculare. Astfel,
dacà renaturarea ADN homolog e,ste teonetic de 1000 , renatu-
rarea ADN heterol'og (ce provine de la specii diferite) esúe în
fr-rrrcfie de apropierea filogeneticà a speciilor (7So7o între ,om Ei
maimuta Ei 250/o în,tre om Ei goar,ece, bu'nàoarà)
Hilbrizi moleculari pot fi realizali Ei între ADN Ei ARN, iar
cînd aceastà hibridare se realiz eaz,à, in si;tu, se pot loca,liza pe
cr'omozomi genele care dirijeazà sinteza diferitelor categorii d,e
ARN celular.
3.4. STRUCTURI TAUTOMERE

Prin deplasarea unor atomi de hidrogen de la un atom de


azot sau ,oxigen d'e la o ,grupare l,a alta a nucleului purinic
sau pirimidinic, fenomen numit migcare tautomerà apar formele
tautomere ale inelului purinic sau pirimidinic care 'trec de la
l-l
I

NJ-H NH
I ti
C -N
1;':-/'-\C/\
\ **r' \C


rll
illr'Hà
Cì'.-1 rr/C\ / HC\ ,/\-,t'
tl \.u
r,l NH NNH
Adentna :f orna antnOJ Adentna ( forp; tmíno,

roe ra
OH
,e''aÚtúA
-T
ó?''/ il l^
I

y/ \ c-c H.J
\r,

%,'cx t'c-cH"
O:C
t I --'> i ,/cH
o=i\
lL,,
\ ./cH NH
NH
Itnt. ) {rornA: cetonrca) Ttornà ( forn.: enoliciI
Fig. 18 Structuri tautomere.

30
forma amino (NHz) la forma imino (NH). AceIaEi lucru se în-
tîmplà ctr atornii de oxigen legali de atomii C6 ai guaninei qi
timinei cane au în mod normal forma aeto (C:O) qi care În
urma miqcàrii tauto,mere trec în forma enolicd (C-OH) (Fig. 18,
19).
MiEcarea tautornerà creeazà posibilitatea împerecherii gre-
site de baze azotate de tip A-C qi G-T, fenomen care poartà
în sine ca'uzele apariliei de mutafii spontane (vezi procesul mu-
tagen).

/(

A ( oornalà antno )

,W,ì
-
4/
w ')n,n,

í-- . .-

NHz
-'' rv N Hz.

6 (nornalà ceto) G4 (f orna rarà enattrè )

NH
1/\
t,---r/

,0 \r
,N
C r4ornalé anino) Cf r f orna rarà inino;

Fig. I 9. Tranziliile tautomerice d.e la formele comuue, stabile ale bazelor azotate
(A, T, G, C) la formele rare, tautometice (A*, T*, G*, C*).

31
3.5. EXCEPTIE DE LA STRUCTURA BICATENARA A ADN

Cercetàrile lui Sinsheimer (1959) efectuate la bacteriofagut


g XL74 a:u aràtat cà ADN la acest virus prezin,tà o structurà
care nu se încadreazà în modelul de structurà bicatenarà. ,El nu
prezintà o structurà complementarà, fiind atacat de càtre losf odi-
ester'ozo, extrasà din E. col;i, acliunea acnestei enzime fi,iurd in-
eficace pe structurile bicatenare de ADN. S-a tras aoncluzia
cà ADN de q X174 este monocatenar, adicà s€r prezintà în mod
n,ormal ca structurà primarà, apàrînd ca o mol'eculà ci,rcu'larà
de ADN mornocat'enar (Fig. 2q. O situa{ie asemànàtoare s-a evi-
denliat gi la atli bacteriofagi precum q^R Ei StB. Asomenea ca-
zurí în care ADNT se prezintà îm s,tare naturalà ca strucfurà
monocatenarà ne sqgerc azi cà de fapt la toaùe sistemel'e tbio-
logice ar fi po'sibiià înscrierea informaliei ereditare în structuri
monocatenare. Starea dublucatenarà nativà a ADN Ia covîrgi-
toarea m,ajoritate a 'sist,em,€1,or biologice este o stare redutantà,
r'eiteratà. Dar cum înseEi s,tructurile monocatenare devin în
timpul replicàrii structuri dutblu-catenaffi', însea,mnà cà natura
a avut o anumità ,,rafiune( de a-gi baza realizarea fenome-
nului ,ereditar pe structuri dublu-catenare. Dealtfel natura face
un foar,te interesant joc de duplicitate, începînd d,e la pereehea
de'baze azot'ate specifice, structurile du'blu-catenare, structurile
cromozomale bicroma,tidice, existenîa structuril,or sernicnomati-

Fig. 20. Bacteriofagul OX 174. a. particule fagice intacte colorate cu ecetat d,e
uranil ; b. cromozomal circular (ADI{) moîlocatenar de OX 17 4 (dupà Finch,
Dressler gi Wolfson, din Goodenough gi Levine, 1971).

32
dice qi contiqruînd cu existenta a d,ouà seturi de cromozomi în
garni'ttrra diploidà (numàrul, d,e cr,omozomi variazà 'd,e la 1 la
precariote tra cel pufin 2 (Ascorris megaloceplwla uniuq,tm,s) sau
4 (HWlopappus gracilis compozità) qi ajurgfnd la ordinul a
B, 10, 20,100 qi mai mu,lfi la al,ùe eucariote (Lima-de-Fari.a însà,
consiclerà cà oric,e celulà 'eucariotà are de fapt nevoie doar de
3 crornozomi: un autoz'o,m pe care sà fie plasat'e majoritatea g€-
n'elor, un cromo zom de sex care sà intervinà în determinarea
s,exului qi un cromozom organizator nuel'ear eare sà posede,
genele nucleolare) apoi douà sex,e separa,te, implicînd douà ti-
puri Ce gameli diametral ,opuse qi terminînd cu larg raspîndi-
tele cazuri d,e simetrii ale naturii (sà luàm doar fiin@ timanà,
doi ,ochi, douà urechi, douà nàri, douà mîini, douà pícioar€, . . ,
e,te . . .). Complernentaritatea apare ca o condi{ie esenlialà în
desfàgLlrarea multor fenomene ale naturii. În cazuL ADN, com-
plementaritatea catenelor din structura dublu-catenabà est'e
esenfiaià în procesele de replicare Ei transcriene, iar 'existenta
a clouà caten,e apare ca o ,,grijà( a naturii de r asigura ,trans-
miterea fidelà a informaliei ereditare în condiliile în carre feno-
menul mutagen ar afecta urr-à dintre cele douà catene. Dacà mu-
ta{ia afecteazà o structurà monocatenarà gansa d'e a transmite
fidel irnformafia ereditarà este practic nmlà, p€ cînd în cazul
structurii dublu-catenare aceastà qansà este de 500/* Dealtfe},
vom vedea cà în cazul reparàrii 'leziunilor din ADN induse de
mutageni, integritatea uneia dintre cele douà catene ale dublu-
lui helix ADN devine esentialà, condifie sine qua non a reuqitei
repaieirii. Este d,e la' sine înleles cà aceas'tà ,,gii;à" a ADN, spre
a-$i asigura înd'eplinirea funcfiei sale,' ru are nimic d'e-a faoe
cuaspeót"d,eteléologie. ''' :l

3.6. c.$urarEA DE aDN gr TNFoRMATTa EREDTTARA

Canr' fuuu relativà de ADN poate fi apreciatà citofoto,metric


prin anatifa nucleilor interfazici colonafi cu leueofuxinà (meto-
da Feulgen-Ross'enbeck). Cantitatea dp ADN este specificà fie-
càrei specii, €a menfinîndu-se consta,rftà de Ia o generafie celu-
larà ia alta. În ciclul celular (perioada dintre douà diviziuni suc-
cesive alcàtuità din in,terfazà Ei mitozà) se r,emarcà o.trecere a
cantitàtii de ADN de la ,o valoare considera'tà diploidà .tipicà
pentru fiecare specie (2 C) gi care se înregistreazà ,1a' sfîrEitul
diviziunii nuclear€,' cînd nucleii fii trec în interf azà; la dubla-

3 - Descifrînd tainele ereditóiii, vol. I 33


rea ac,6tei cantitàti de ADhT (4 C) în timpul interfazei. La ur-
màtoarea diviziune nuclearà prin intervenlia aparatului mitotic
cantitatea dubtà (4 C) de ADN va fi distrirbui'tà echilibra,t în
c,elulele fiice, acestea primind o aceeaEi canti'tate diploidà (2 C)
de ADN.
Mitozn apare astfel ca un mecarrism ,bi'ologic fundarnental
car s asigurà constanta cantitativà a ADN-ului în succesiunea
g'enerafiilor celulare. Nlitoza apare astfel ca e permanen:tà le-
gàturà între trecut Ei prezent, asigurînd transmi,t,erea unei ace-
leiaEi' cantità{i de informalie geneticà de la celula ma,mà la
celulele fi.ice (Gawilà Ei Dàbalà, 1975).
S-a mai constatat cà în gamefi (celule sexuale) cantita'tea
.le ADN este r'edusà la jumàtate fa!à de can,titateia dipl,oidà ca-
r,acteristicà speciei considera,te (2 C). Din aceastà cauzà, gaffielii
sînt haploizi (cantitatea de ADN:lC). Totodatà s-a constatat
cà în gameti numàrul de cromozomi,est,e redu's Ia jumàtate fa!à
de celulele somatice (toate celelalte celule a1e organismului. Prin
unirea gamefil,or de sex opus, în pr,ocesul fecundàrii, s,e re-
stabileEte cantitatea, n,ormalà de ADN caracteristicà speci'ei date
(1C + 1C=:2C). Ga,melii apar în urma unei diviziuni celulane de
tip specia'l numità meiozd,, aceasta fiind de fapt o diviziune de
reducere (îniumà'tàtire) a numàrului de cromozoml Ei t,otodatà
a cantitalii de ADI.I. Meioza apare ca u,n mecanism compensa-
toriu al fecundàrii, obligatoriu la or€anismele cu reproducere
s'exuatà care previne màrir,ea exponenfialà a cantitàtii de ADN,
ce ar avea loc în condiliile unei fecundàri a gamelilor a càrror
cantitate de, ADN nu ar fi redusà la jumatate comparativ cu
celule,le somatise.
ADN-uI se caracterízeazà printr-o nemarcabilà c'onstan!à
cantitativà riguroasà dea lun,gul generaliilor c.elulare, ceea ce
n,u 'este eazul altor com,ponente macromoleculare atre' celulei
(proteine, acizi ribonucleici etc.) care prezintà varialii canti"ta-
tive evidenùe nu numai de-a lungul generaliilor celulare dar
ehiar în cadrul diferi'ùelor ce'lule ale aceluiaEi organ'ism ia un
m,ome,nt dat. Recent, s-au adus multe date în sprijinui unor
exc,epfii de ]E rqgula cronstenlei valorii canrtitaúive a ADN, în
ciclul celular, rearlizînd'u-se vari,alii aùe cantitàlii de, ADN prin
mecanisme de replicare diferenfiatà a ADN (Nagl, 1978, 1979).
Prin experirenle de marcar,e cu izotopi radioactivi (1tr3, CI4,
P31 s-a constatat, cà radioactivitatea odata încorporatà în ma-
cromoleeula de ADN (de exemplu timidina tritia'tà timidina
H3 este încrcrporatà în' ADN în locul timinei fiind un pre-
cursor al acesteia) nu o mai pàràseEte atîta timp cît celula trà-

34
ieSte, c€ea ce înseamnà cà, odatà sintetizatà, rnacromolecul,a de
ADN nu ma'i este dezagregatà spr€ a fi resinrtetizatà. Aceasta în-
seamnà cà spre deosebire de alte oomponente macromoleculare
care sqrferà turnover rapid (degradare Ei resintezà ,cu sctrirnib
continuu de ,atomi) macromolecula de ADN se caracterizeazà,
prfu:tr-o,rnare stabilitate.
Urmàrind cin,etica' renaturàrii ADN-ului denaturat car€ apar-
line la specii diferite se coxLstatà cà cu cît specii'le sint rnai apro-
piate filogenetic cu atît proeenúul de refacere de strtreturi du-
blu-catenare este rnai mare, ac€;asta deoarrece speciile a'propiate
din punct de vedere fiL,ogenetic prezintà într-o proporfie mai
mare succesiuni similare de baze azotatn în macromolecula lor
de ADN, adicà pr,ezintà u,n anumit fond de informafie eredi-
tarà co,nnunà. Acest fapt ne face sà gîn'dim cà ,evolufia speciilor
s-a desfàqurat în principal la nivel molecular.

3.7. STNTEZA REPLICATIVA A ADN

Deoarece ADN confine informatia geneticà a celulei, sinteza


sa este unul dintre cele mai importante evenimente din via,fa
acestei,a.
Realiza,tà prin intervenfia unui cornplex aparat errzimatic,
sinteza ADN este o reaclie de tip repficativ, fiind ,rrnicul caz
din lumea biomoleculelor în care o substantà îqi dirijeazà prc-
pria 'sa sintezà. Complexul de replicare care include aparatul
enzimatic Ei molecula, de ADN în replicar'e se num'e$te repli-
to%ouotura
tbic,anrtenarà se dov'edeqte €ù avea implicafii ,biolo-
gice dintre ,cel,e mai profunde, dar prezintà Ei un foar,'te iqLtere-
sant punet de dezbatere filozoficà ea expl,icînd, cel pulin în
parte, unele dintre misterele vielii.
In uirso, sintez,a aeí,zilor nucleici (ADN gi ARN) s,e d.esfàqoarà
în trei etape:
a) stnteza precursorilor nucleotid'elor purinice qi pirimidi-
nice adicà a acidului uridilic Ei a acidului inozinic (Frg. 2I);
b) sirnteza nucl,e,otidelor propriu-zise care intrà direct în al-
càtuirea macromoleculelor acizilor nucleici (dezoxiadenozintri-
fosfat (dATP), dezoxiguanozintrifosfat (dGTP), dezoxicitidintri-
fosfat (dCTP) qi dezoxiti'midintrifosfat (dTTP) pentru ADN;
ad'enozintrifosfat (ATP), guanizintrifosfat (GTP), citidintrifosfat
(CTP) qi uridinúrifosfat (UTP) pentm ARN;

35
Acid uridilh ( UMP,

f u'io;n Dezoxitimidin Ì
lrilosfot ( Uf P) lnterconrersb trifosfat (dTTP)
pirimidinnudeo-
I
tldicó
Citidin Dezoxicitidin
2
tritosfot (CTP) trifosf ot (d CTP )l= I

É. !cr
Guonosin Dezoxíguonosin
lo
trifosîot (GTP) lnFrcqrversie trifosfot (dGTP).
I
prrh-rruc.leo-
Adencín Dezoxiodenozin i
trrfosfot (ATP) trifosfot (dATP) t
l

Acid inosinic ( IMP)

Fig. 2l . Cóile bioslntezei nucleotidelor.


t

c) polirn,erizarea ordona,tà a nucleotidelor într-o secventà


camplementarà unei matrife (dupà modelul semiconserl'ativ) sub
cataliza unor enzime polimerazice celulare.
Sinteza in uitro a ADN a fost realizatà de càtre A. K,orn-
berg, I. Lehma'n,n, M. J. Bessman Si E. S. Simms în 1'J56, în
sisterne acelulare folosind un echipamern't enzimatic polim,era-
zic extras de la E. coli (ADN potimeraza I sau enzirna lui Karrl-
berg) în prezenfa ionilor Mg++ $i a unei matrile ADI{ înait-
poiimerizatà.
Sinteza in uitro a ARN a fost realizatà pentru prima Catà
de càtre Marianne Grunberg-Manago Ei Severo Ochoa de La
Universitatrea din New York, în anul 1955. Pentru aceasta au
folosit un sistem ,enzimatic ARN polimerazic, ionii metalici ,bi-
valenli (Mg++) Si un segment ADN ca matri!à.
Mecanismul de replicare ssmiconseruatiud, a ADN pr€:supune
separarea ca,tenelor complementar,e prin desfacer,ea punlilor de

36
hidro'gpn, fiecare catenà servind drept matri!à pentru sinteza
unui noi catene, complementare, refàcîndu-se a,stfel structura
bicatenarà a noilor macromol,ecule ADN care vor avea astfel
cîte o cat,enà veche Ei alta nou sintetizatà,. Acesta este modelul
sernicanseruatiu de replicare a ADN. Prima dovadà experimen-
tatà în spriiinul m,odelului semiconservativ de replicaró a ADN
este aclusà ia nivel cromozomaì de càtre H. Taylor (1957, 1958)
în sistemele eucariote qi în acelagi timp, la nivel molecular', de
càtre meselson qi Stahl (1958) în sistemel'e procariote (8. coli).
+vr
Incà din anul 1950 Srvift aràtase cà replica'rea ADhl în
celulele eucariote este restrînsà doar la inteif azà, la un stacliu
pe care Flowarcl qi Pelc l-au numit stadiu ,,So', separat cle ctivi-
ziunea pr,ecedentà printr-un stacliu G1 (de gol sintetic) qi urmat
de trn stadiu G2 în care, de asemer€a nu se mai sintetize'azà
ADN. G1 este f'oarte varia,bil durînd de La 3-4 ore, la zile, sàptà-
mîni qi luni, depinzînd de tipul de celulà gi starea fizioiogicà
(Gavrilà gi Dàbalà, 1975) . G2 este mult, mai constant, clurînd
2-5 or,e iar S clureazà 7 ore. Pregàtirea nucleului pentru re-
plicarea A.DN se face . în -B Gt, fapt demonstrat de expuner,e,a,
prin transplant a nucleilor, Ia citoplasma celulelor aflate în
Gr (nu qi în atte f.aze) care aratà cà ace;ti nuclei i,ntrà de îndatà
î:n stadiul,S, de sintezà a ADN. În 1957 Taylor, W.oods $i }lughes
au efectuat experienfe ,autoradiografice la cromozomii cle Vicia
faba, folosind timidina tritiatà (3H) precursor al timinei. Radi-
celele crescute pe mediu cu timidinà au pr,ezen,tat crorrt:o-
zomii uniform rnarcali pe toatà lungimea -3g 1or. Ele au fost apoi
transferate pe rnediu fàrà timidinà tritiatà (mediu ,,rece'(). Iì,a-
dicele au frost tra,tate cu colchicinà pentru a fi prevenità for-
marea fusului de diviziune astfel cà produgii replicàrii fiecàrui
crom,ozom ràmîn unili la nivelul centromerului. S-au efectuat
preparate citologice pentru cromozomi dupà un ciclu cle divi-
ziune, dupà douà cicluri etc. Cînd au fost analizat'e autoi'aclio-
grafic aceste preparate, autoradiogramele cromozomiior" clin
radicele cultivate pe m,ecliu cu timidina tritiatà prezentatr am-
bele crornatide marcate radioactiv (FiS. 22). Cînd s-au efectuat
preparate din raciicele cultivate pe rnediu radioactiv qi apoi
transfera.te pe mediu neraclioactiv (fàrà timidinà pentru
-lH),
un singur ciclu celular (o si;ngurà diviziune). cromozomii din
aeeastà a doua rnetaf azà, statrn'ochineticà cl'e clupà mal'care
prezentau o cromatidà rnarcatà qi alta nemarcatà. Aceasta a
fost prima dovadà experim'entalà certà în sprijinui modelului
serniconservativ de replicare a ADN. El a fost dovedità gi la
alte organisrne veg€tale pi:ecurn Crepis gi Belleuolia. Dar ela

37
r

:/

a doua nefafaú
duprcare ctt :[:#,!;:::í;3 c,tpticare ràri sf afncchineticà
lintdinà frÌtrafà dupà marceie linrdinà frifíatà drp; mdi'ca re
(anbele cranalide
( o c í'ona f ,,Cà rna rcafí
narcaf e ) ' si a rf a na narraté I
Fig. 22. lVIodelul replicórii semiconservative a cromozomuiui eucariot (duplt
(Taylor, Woods gi Hughes, 1957)

o d,ovadà inclirectà a replicàr:ii ADN, prin care de 'fapt s,e do-


vedea replicare,a semicons,ervativà a cromozomi'lor.
Dovadà directà, la ni.vel m,olecular, a replicérii semiconser-
vative a ADN a fost adusà în 1958 de càtne Mese,lson Ei Stahl,
prin experienfe de transfer izotopic (FiS. 23). Autorii au cres-
cut pentru multe genera{ii ceLular.e E. col,i pe mediu în car'e în
Mode(e de obsorbfre UV dupò
centrilugort lnbrptltqre
in tcrm6É deruptrcore
Aspcctut. - ccmiatìserntivó
totogrcfterit tn
UV

ADN
Crenerofic
extros din
!,octerii trons-
1
:ffi J
f r:rote pe mecíu
cu lltN

^
/\,r!

: u$or'i"S;tilr J" ;^ó:Tffi*i:t(til


Fig.23. Reqrezentarea graficà a experieufet lui Meselson Si Stahl (1958) .L - light
ffi ilHPir#r.- heavv

3B
sursa, de anlt (NHrrCl) iurÉra nu azotul normal' 11'N ci iz t,opul
sàu greu 15N, astfel cà în macromolecula ADN atomii cle N
erau r€prezentanli de 15N. În prealabil s-au fàcut cercetàri de
ultracentrifugare qi s-a constatat cà ADN cu 1r'N bande azà di-
ferit (mai sus în tubul de centrifugà) fata de ADN cu 15N care
hande azà la un nivel inferior, spre fundul tubului de centri-
fugà. Dupà cre$terea bacteriei pe mediu cu 15N pentru rnult,e
generafii, celulele sînt transferate pe mediu cu t4N pentru a
desfàgura un singur ciclu de diviziune (a càrui duratà era
precis deterrninatà 90 minute). S-a extras ADN Ei s-a ul'tra'-
centrifugat. S-a c,onstatat cà a,cest ADN ,bandeazà la un nirtel
intermediar în,tre 14N qi 15N. Cu alte cuvinte acesta era un ADN
hibrid, în care o catenà prezenta ca atomi de N, azotul normal
14N iar catiena complementarà prezenta izotopul greu al, acestuia
l5N. Dupà douà generafii celulare d€ 'la transfei pe mediu cu
14N se constata cà prìopor{ia de ADN hibrid 14N 15N scade la
jumàtat,€, cea,laltà jumàtate fiind repr€z€ntatà de - ADN cu 14N,
dupà trei generalii raportul dintre' cantitatea de ADN hibricl qi
ADN c,u 14N este de 1 : 3 q.a.m.d. (Mode1 semiconservativ de
replicar€ s ADN propus de càtne, Wafuon gi' Crick în 1953)"
Mod'elul semiconservativ de replicare a ADN asigurà o
continuitate a fenomenului ereditar, càci cele douà noi' mole-
cule bicatenar'e de' ADN sîn,t identice pe de o parte între ele,
iar pe de altà parte sînt identice cu uurcromolecula inilialà
(parentalà) de ADN ca,re $i-a ,,topit(( iidentitatea în sinteza
rnoleculelor fiice. Primul eveniment a} replicàrii ADN ,este
desfac,erea, separ,area catenelor complementare aLe dublului he-
lix din care cauzà molecula de ADN }'a punctul de replicare
are formà de U, aceastà structurà fiind,,, numità bifurcagie de
replicere. ADN este replicat cu ajutonil unui complex multi-
enzimatic nurnit' ,,aporat de rep1icare66. Ansamb,lul de eveni-
rneur,te care realizeazà, replicar,@ ADN a fost conve,nfi,onal îrn-
pàrlit în inifierea, continuarea Ei terminairea replicàrii, etape
care se pot întîlni Ei în sinteza altor 'rnacrornolecule informa-
fionale' (ARN Ei pro'teine). ADN natural se aflà sub formà de
structurà ter{iarà, structurà în car€, el este superspiralizat. La
eucari,ot,e tururile superspiralizate din ADN liniar rezultà în
urrna asocierii sale cu proteinel,e bazice, hist;one; pe cînd
la procariotele, Ia care macromolecula ADN ,este circularà, tu-
rurile superspiralizate sîn't formate prin intervenlia unei en-
zime speciale care s-a nu,mit ADN Eirazn, aceasta aclionînd
chiar din, m,omentul replicàrii. Tururile superhelicale pot sà
aparà Ei'ca rezultat aI desfacerii (desfaquràrii) dublului helix în

39
r
tirnpul replicàrii. Din cauza vitezel mari cu care ar€ loc. des-
ràsuci{ea dublului helix în fata bifurca{iei d'e replicane, rnai
ales ia moleculele :ci,rcular, .închise rse forrae azà o supe,rspirali-
zare, astfel cà o ,etapà' necesanà, în replicarea ADN ,€ste ,îftd,o.'.
pàrtarea structurilor terfiare superspiializate, În scast, ,proces
intervin enzime care, ralaxeazà, tensiunea de ,,:ràsucire, ,prin
crestat"ea unei catene înaintea 'bifurcafiei gi astupapea ;acestei
crestàturi dupà ce s:-a reaLizat relaxarea. Aceste erìZime, s:€ru
numit enzim,e de crestore-,ast'ttpw€, descrise atît la procariote
cît qi ia eucariote. S-a mai descris Ei ,enzirna Al)N=topoízorne-
TazQ, o enzimà care introcluce ,o crestàturà morl,ocatenarà tran-
zitorie în duplexul ADN, oferind astfei LtR pivot pentru clespi=
raliz.area superhelicelor. : ì

Pentru desfacerea, ,punfilor" de hidrogen dintre ca'tenele corn,-


plementare în veder,ea replicàrii inlervine o enzinrrà destabili-
zatoal"e a dublului helix care a fost numità unusindszd.,
Catenele compl,ementare separate funcfiori.eazà ca rnatrifà
pentru sinteza de noi cate'ne complementare. Nucleotideie 5'*
trifosf at libere din mediu se aliniazà pe matri{à, împerechín-
clu-se cu bazele complementare d,e pe aceasta cu italbilirea
unor Punli cle hiCrogen. Enzima ADN polimerozq dependen,tà
de ADiV catalizeazà formaiea legàturilor covalente : fosfodies,
terice dintre nucleotidele învecin",ate. Inilial a fost descrisà €rrr
zima polim,erazicà. ADN polimnraza I sau enzi'ma tui Kot*rt-
berg ca avînd rol esen{ial în replicsr'e, dar cercetà,ri ulterioarq
au stalbilit cà ea intervine ,nu*ui într-,o etapà ulterioarà a pr.o-
cesului ar'înd rol esenfial în sinteza rep.ara,torie. As tàzi estg
urnanim acceptatà, interve'ntia în etapele inifiale a;le,. neplicàr:ii
ca Er în alungirea catenei nou sintet íz,a'te a enzim,ei polim,era-
zice dese,m;natà ADN pol,imeroaa III. ,

Toate enzimele polimerazice eu capacitatea de a alungi nu-


mai catene polinucleotidice deja existent,e,,rlu însà'Ei de a ini-
tia sinteza ,,de no'vott ,a unei cate,ne. Pentru aceasta ele rl€ce-r
sità un elem'ent ajutàtor prin car,e se: primeazà (i,nifiazàl o as,e-
rn€rr,ea sintezà. În calitate de primer poate fi folosi,t ,un mic
segment de ARN lung de cîteva nucl,eotid'e. De aceea primul
e'v"eniment în replicare dupà destabilizarea (,,topirea{t) dubtrului
heiix este si'nteza prin in,tervenfia enzimei ARN pattmerazd, 'a
unu$ ARN primer. Acesta oferà ADN polimerwzei un capà't
3'-OFI liber al càrui nuclmtid,este împerecheat cu,o bazà oorn-
plementarà din matrifà. Acurn, ADN pcttimero,za, catalizeaz,&
reacfia de cond,ensare a acestei grupe 3'-OH a prim,erului ,$i
a gr.upei 5'-f,osfat a', primului nucleotid 5:-trifosfa.t a,l.iniat pe
40
rnatritrà,'',cui realizarea primei ,le,gà'turi covalente f,osfodiesterice.
Replicarea ,ADN este ,astfef ini{iatà. Are loc alungirea noii
catene, ;capàtul ,3f-OlI al fiecàrui, nucle,otid aliniat servind de
fiecare datà ca prim,er, din care eauzà catena de ADIV nou sJn-
tetizatà' se mai numeqte Ei ADN primer. Proeesul continuà
pînà 'ce es.te f,olosità întreaga matri!à avînd loc sinteza cîte
unei caterr-e complementare matri$el'or cu forrnàr€a, . €t douà rno-
lecule fiice identice de ADN.
' Toate' ,ADN pólimerazele dependente de ADN pot cataliza
adàugarea de nucleotide Ia o càtenà primer numai ca ràspuns
(în virtutea eomplementaritàtii bazelor azotàte) Ia secvenla d,e
baze pe'care or gàsesc pe o a doua catenà, batena matri!à. Ast-
fel daeà un grup 3'---OH lib,er de pe o catenà primer stà 'opus
un'ei tirnine pe catena matri{à (ternplate) polim eraza va, per-
mite atagdrea numa,i a unui dezoxiadenozintrifosfat (dATP) la
ca,tena ,pfim€r chiar dacà dCTP, dTTP qi dGTP se aflà fur :me-
diu. Cîttd în mediul de reactje' sé aflà un 'ànnestec confínÍnd
ADN ,polimeraze gi nucleo ztd-trifosfafi împreunà cu fragrnente
dE ADN; ''aceste 'fragrnente pot servi atît ca primer cît qi ca
rn6itfità,. . , ;

Polaritatea opusà a catenelor-matri{à, 3'-+5' a uneia Ei


5'+3' a celeil,alte a, ridicaú problema existentei ,a douà poli-
meraze cane sà dirijeze potiùerizar€a, rtna în- direclia 5':r3' ,
alta în 'directia' 3'+5i, Aici s-a înregistrat dilema centralà a
'

replicàrii ADN dat fiind faptul cà nu au fost descoperite douà


r. a. '
-.'

enzime' p-olimeraziee care sà polimeriz'eze în direcfii opuse.


Cercetàri' recente au stabilit însà cà în repliea,re intenvine o
singurà enzimà esen{ialà , ADN polimereza III, car,e are speci-
ficitate de direc{ie, nu de se,cven!à de nucleotide. Astfel, ,aceastà
enzimà se deplaseazà numai în direcfia 3'-+5' pe anlbele ca-
tene-rna,tri!à, determinînd polimerizarea noilor catene (replici-
lor) numai în direc{ia 5'--+3'. Comportamentul polimera'zei III
nu este în acord cu m'odelul ini{ial d'e replicare propus de
Kornbefg, în qare s,e acorda rol ,esenfial enzimei ADN polime-
raza, I, enzimà care ar fi determinat o sintezà continuà a noi-
Ior catene.' Experienle1e de fftfrrcare pulsatorie (pentru scurt
!imp) cu timidi'na tritiatà ef'ectuate de càtre Okaiaki Ei colab.
fntr-e ,19:59-1970 au adus dovezi ,pentru existenta unui model
discontinuu de r,eplicare în care, noile catene sînt sintetizate pe
segmente mici
cleotide, cpre'apoi sîn! urrile prin punli fosÎodiesterice eovaLen-
te ,Frip 'aetivitatéa enzimei, ,ADN-ligwo în segmente mai mari
qi în ultimà instan{à:,reZUltà,'o'catenà continuà nou sintetizatà,
i
I

I
I
I

I
I
4t
replieà a matri{ei (complem:enta'rà ,ac'esteia). În aces.t caz, sin-
teza fiecàrui fragment Okazaki este prim,atà d,e urr segm,ent d.e
ARN primer sintetiza't prin intervenfia ARN polimerazei. Dupà
sin,teza fragmentului O,kazaki, ARN primer este excizat. Golul
ràmas în urma exciziei este umplut prin activiúatea polim'era-
zei f. La 'nivelul ,bifurcafiei de replicare sinteza fr,agmentului
Okazatki se continuà de pe o catenà pe cealaltà, ADN polflme-
raza III sàrind de, pe .o ca'tenà pe cealaltà Ei det'ermi,nînd pli-
meriza,rea pînà ce întîIneqte originea ,replicàrii în cazul pri-
mului s,egment replicat sau bariera segmentului ADN deja
r,epJicat în cazul urmÉúoarelor segrnente replicate. În ,acest caz
intervine o ,enzimà grtdonuclewicd, care deterrninà o incizi.e ,rno-
n,ocatenarà în segmentul ADN nou sintetlz.at ce s'e continuà de
pe ,o catenà pe cealaltà în urma càreia apare un capàt reactant
S'-OH fàcînd ca procesul de replicare sà s,e continu€, iar bi-
furca{ia de replicare sà se deplas,eze secvenfial de-a lungul în-
tregii matrife avînd loq o progresivà desfàEurare a dublului-
helix (Fig. 24A). Acesta este modelul ,,cufitului qi furcul,itei"
propus de R. Barzilai qi C. Thomas ca o variantà a modelului
pr'opus d'e Okazaki qi colafboratorii în ca,re în cadrul sintezei
A B
3'
? 3',
5'
,"/
g
t'/
tit 5'
y,,/ 3;

1'j
3'l
r I
ctt
'lt
3'f

"5{

Fùg. 24A. Replicarea ADN dupó mod.elul Okazaki-Kornberg. Se prezintà o


secvenfà de evenirnente (a-d) de despiratizaÍe 9i de replicare segmentat5- la
nivelul bifurcafiei uuui dublu-helixADN.ADN-polimeraza catalizà;sinteza ADN
numai în direcfia 5'-+-3', d,eplasîndu-se pe ambele catene-matrifó d.oar în direcfia
3'-;-5', sórind., 1a nivelul hifrrcafiei de pe o catenó pe celattà, a) Despíralizarea
dublei-elice (blocurile negre reprezintó puncte de inifiere a segmentelot Okazaki
putînd fi scurte fragmente de ARN-prímer). A gi B reprezintà catenele-matflla.
b) Pe mà,sura despiralizàrÍi, o po$iune din catena B ràmîne tenporar sub formà
înonocatenaró pînà ce o nouó moleculà de ADN polimerazó pàtnrnde la nivelul
bifurca$iei spre a umple golul. c) ADN polimeraza determinà pe catena A (cate-
na hdding : "**;,:1!fi#;fl:r ;nHffiJf B (tagging :
,:**,*,:ffi:'
42
discon'tinue se sintetizeazà segmente scurte de ADN ataEate la
matri{à numta,i prim intermediul punfilor de hidrogen. Dupà o
scurtà perioadà de sintczà, pe una din matrife, un segment mo-
nocatenar al, celei de-a doua catene parental,e (matri!à) stà
expus. Intenrine o & doua molec,ulà de, ADN pol'im,erazà. la ni-
velul bifurcafiei qi copiaz.à acest sqgment expus al celei de-a
douà ''maf'rite''în direcfie invensà fata de prirna matri!à (data
fiind plari'tatea lor opusà) dar în aceeagi direefie ehimicà per-
misà, adicà 5'+3' ca pe prima matri!à.
Mode.lul de replicare discontinuà propus de Okazaki a fost
unanirn aca€ptat qi s-a dovedit a fi aplicabil la toatq siste,mele
biologice. Este posi'bil ca repficarea pe o caùenà sà fie înaintatà
(sau unires segrnentelor Okaraki sà fie mai rapidà) iar pe cate-
rur comple,mentanà sà fie rnai întîrziatà (Fig. 248).
Replicarea este' reac{fa' cea mai importuntà din lumea vie Ei
desfàqurarea ei cade, dupa cum este Ei firesc, sub incidenla
unui strict control celular. Controlu,l este efectuat la mai
rnulte nivele. L.a, nivel molecular existà mecanisme care asigurà
oorecfia repli,càrii càci o bazà azntatà, greEit î,mperechea,tà cu
b,aza complementarà din ma,tri!à face ca desfàqurarea polime-
rizàrii sà nu fie continuatà pîd c€ nu este îndepàrta'tà baza
aaotatà gregit împerechsatà. La beza unei asemenea activitàti
de corecfie stà re pare activitatsa ADN polimerazei f. Greqetile
de încorporare datorate acfir.rnrii unor agenfi mutageni sau iare-
fieaciúàîii în corecfie a ADN polimerazei I stau l,a baza unuia
dintre ,mecanisme,le de apari{ie a m'utafiilor.
Dacà la ,:ptrocariote (bacteriii , astilLomicete) replica,rear nu
sste restrînsà la o f.azà, anume a, 'ciclului' celular, €B fiind po-
tenlial continuà în condilii optime de'mediu pe parcursul între-
gutui ciclu :celular, la eucgriote replicarea este restrînsà la o
f.azà, b,inó delimitata a ciclului celular plasatà în interf azà. Ei
care a fost numità fazo de sinúezd ,S. Durata fazei S este va-
riarbità nu nurnai 1,& diferitele specii dar Ei în cadrul aceluia$I
individ la nivelul celulelor afliate în difeite stadii de dezvol-
tar,e, fiind mai scurtà în stadiile timpurii ale em,briogene zei
fatà de celulele somatice diferenfiate. I),e as€rr€nea faza S pre-
rnergàtoare meiozei este foarte lungà comparativ cu aceea din
ciclul mitotic.
Cnornozornii euca,riotelor reprezintà totodatà structuri com-
plexe în care ADN este permanent complexat cu proúeine ba-
zice de tip histonà. Replic,ar€,a, cromozornului eucariot se reali-
znazà, asincron nu num,ai între diferiti cromozomi n@mologi ai
comple'm,entu'lui cromozomal al unei oelule dar chia,r la urivelul

43
loooitomerat
Ftla.xarea AI)N- J finN grretà)

tte lirerò
T toroftint rtP' 3''5')
SrpiìiJft3 cafenelo,c

Probrn desbÚi lita foars


Í aheiiwlui A0N {fr0P)
-
Frt,nîld (frùlîutd rin':tî 'n

-
,- ''(nrornlhr molr/
n"o"'na dna 8J
ARtí Pnmen -

A tl N ,toliate,'du fi
E longerea,t2/erter

* fltt; l{
- ('Pilt tt H ; e x tt:;utfea Í,t
Slalîh'P'súm€rttù t'ì

l'8 tl pilìnenta !
-

î,0*tderra tovalcnti I -l- t Dtt liyn


ttle nei

Sryerspinali taret
I 0/1/
. i.Èb J l't-^).íol"r-r-,
\
$,'(,ii,í,.7).,,J;
-fr-,1,/;i,:r":,:í:
3' 5*

Fig. 24. B. SCHEX,IA COM?LEXULUT ENZTMATTC CARE pAnrrcipìt.


/N REPLICAREA ADN.' pentru simplificare se aratà" în detaliu doar sinteza
catenei. succesoare (,,lagging") eare, spre ,deosebire de catena directoare (,,lea-
9irg") are o direcfie de sintezà opusó direcfiei de migcare a bifurcaliei de replicare-
In dreapta schernei se redà d,enumif,ea proteinei sau enzimei particlpante în ,re-
plicare, iar în stînga se trece funclia pe care aceasta o ind.eplinette. În paran-
tezI- este trecntà denumirea enzimelor sau proteinelor detectate la bacteria'F..
coli.
Relaxarea ADN este neeesarà spre a permite înaintarea bífurcafiei tlo repli-'
9a1e, îngreunatà de torsionarea duplexului circutar ADN. Aceastà torsionare este
îndepàrtató prin ac!íunea unor enzime care au capacitatea cle a introduce crestó-
turi monocatenare tranziente în duplexul ADN eeea ce perrnite rotatia liberà în
jurul celeilalte catene. Aceste enzime s-au nurnit inifial swivelazà (pivota za,l ,
enzirnà de crestare-închiclere, enzimó de relaxare a ADN sau unwind,azd, dar
acum poartà numele de topoizomerazd, ADN, însemnînd enzimà ce deterninìl
schimbàri în conformalia macromoleculei ADN. Topoizoyneya,za, are d.ouà subuni-
tàti ce constituie un tetramer. Una din aeeste subunitófi funclioneazi ca topoizi-
rnerazà- propriu-zisó adicà ca enzímà de relaxare, fiind sensibilà la acid nalidixic-
un foarte eficient inhibitor al replicàrii ADN, pe cînd cea d.e a d.oua subunitate
a topoizonerazei acfioneazà ca ADN girazd, sau proteinà, omega, introd.ucînd tururi
superhelicale în ADN nou sintetizat.
Hel'icaza ADN realizeazà separarea catenelor prin ruperea punfilor d.e hidro-
gen folosind energia provenitó prin defosforilarea ATP dependentó d.e ADN.

44
unuia qi aceluiaqi cr:orn,o z,o,m. Crom'ozomul eucariot este deci o
structurà multirepliconicà, prezentînd la nivelul sàu mai multe
puncte C,e ini{iere ,a replicàrii.
tlu,bermann qi Riggs (1968), extragnnd ADN din celulele
,,Hela(i marcat pulsatoriu, au màsurat lungimile varia'te ale
seqmentelor marca'te pulsatoriu reuEind sà calculeze cà viteza
de repii,care este de L pm/minut (la E. eoli aseasta este de 30
1rm/minut). IJn cromoz,om 'uman de lungime medîe ane circa
30 000 um ADN iar cromozomul eucari,ot are a singurà mole-
culà de ADN. Dacà neplicarea ar fi iniliatà la un capat al er,o-
mozomului qi s-,Br desfàEura secventral spre celàlalt capàt ar
fi necesare 500 ,ore pentru replicar,ea ADN al unui crorn,ozom.
Dar se gtie cà replicarea are loc în 6-8 ore. Aceasta a adus
încà c clovadà cà la eucari,ote cromozomul ,are un numàr mars
de unitàli de replicare de lungimi diferite cu un aornporta-
ment retrativ independent în replicar,e (Fig. 25).
Distribufia produEilor cle replica,r,e (cr,ornozomii fii) se reali-
zeazà, La eucariote prin intervenlia unui complex mecanism
mit,otic care este strict controlat ereditar. Replicarea ADN este
supusà unui control riguros, la nivel molecular, dar €a cade
<-
Helicaza de E. coli se numegte protcina re/, qi ea se deplaseazó pe monocatena
ADN în direcfia 3'* -5' îndepàrtînd catena complementaró, pé cînd helíca.zc III
se deplaseaz[ în direcfia 5'+-3' avînd. aeeeagi acflune. Acfiunea lor complementerll
este facilitató de prezenfa proteiuelor neenzimatice unafindoze FIDP) sau protei-
ne topire a duplexului ,.tDN. Aceste proteine asigutó stabilizatea monocaterer
d.e
lor spre a putea servi ca matrife.
Sinteza fragmentelor Okazaki este iniliatà prin sinteza unui ARN prirner
catalizatà de enzima ADN primaza (ARN polimeraza) prod,us al genei dna G
care acfioneazà sinergie cu produsul proteinic al genei dna B. Proteina dna B
este o AîP- azd depend,entó de ADN care se deplaseazà pe matrife folosind energia
eliberató priu defosfotilarea ATP. Ea marche az6, la anumite distanfe pozifiile
pentru sinteza primerului de càtre ADN primazà,, din care caazà, s-a numit ,,proîno-
tor mobil".
Dupà primare se realizeazà, elongarea catenei (polimeizarea uucleotidelor)
sub catalíza ADN polimerazei lff. Elimiuarea primenrlui ARN se face sub acfiu-
nea RNceai I{ sau a activitàfií exonucleazice 5' a ADN polimerazni f.Golul rAmas
dupà excizia primerului este umplut prh acfiunea polímerizatoare a ADN poli-
vnerazei f . Intervine apoi ADN ligaza care tealizeazà, închiderea covalentà a
catenei (unirea prin punti fosfodiesterice a fragmentului Okazaki recent sinteti-
zat cu cel preced.ent, realizind.u-se astfel treptat sinteza unei catene urtice
catena nou sintetizatà sau replica). Dupó teahzarea replicàrii intervine ADN
giraza sau proteina omega spre a conferi moleculei fiice d.e ADN starea supespirali-
zati, stare care este normalà, stabilà, fiiud. cerutà se pare d.e funcfiorarea sa
în replicare, transcriere gi recombinare (Dupà WACKERNAGEL, 'W'. 1980
Replication (in :) Progress in Botany, Springer-Verlag, Berlin, Heidelberg,
NewYork, 154- 170).

45
F

. puncf -

-" " r
ount
[lernrnàll terninal gún cl
ca nui., t ^rninal

I untlatea dP t unilaf ea de ,
FreplicarelT'-- repticare Z
-1
calena nou stnlelizatà
t

l#.r ;îffilF

,-ÉSffit*'

Fig. 25. Modelul lui Huberman gi Riggs (1968) d,e replicare a, ADN eucaîiot.
Sînt reprezentate douA unitAfi de replicare adiacente care apar ad.esea $í în imagi
nile autoradiografice ale fibrei de cromatfutà. Cele douà unitàfi de replicare desem-
nate I gi 2 au fieeare cîte un pnnct de inifiere a sintezei ADN 11, respectiv
fr, la nivelul càroîa se corctituie în timpul replicàrii buclele de replicare {ochi de
replicare) corespunzAtoare. Fiecare unitate de replicare are un punct terminus
indicat prin baie transversale. a) Inainte de reptcare. b) Replicarea a început
în unitatea 1 dar nu încà. în uuitatea 2. c) Replicarea este completà ùr unítatea
1 ti a început în unitate a. 2. d) Replicarea este completó în ambele unitàfi. e)
Dublu-helixurile fiice separate în punctul terminal comun dar sînt încé unite
cu segmentele ad.iacente. În d.reapta se îeprezintà, schematic , ,grainuritre" obser-
vate în autoradiografie.

Si sub incidenfa un,or semnale venite din citoplasmà. În urrna


ulÌ,or fuziuni cel,ulare dintr,e celule a'flate în S Si GL are loc o
sintezà prernaturà de ADN în nucleul aflat în GL urmatà de
oondensar,ea prematurà a cr,omozomilor. Condensarea crornati-
nei crom,ozomale poate duce la aooperirea $i deci la reducer€a
numàrului unor punct,e de inifiere a replicàrii. Cr'omatina con-
d,ensa,tà numità heter'ocr,omatinà prrezintà o replicare tardivà în
faza S comparativ cu cromatina difuzà eucnomatina.

46
:

I
i
I
i
I
F

t
t

L
ADN are capacitatea de a exercita un anumit autocsrrtrol
ai replicàrii sale, prin care este prevenità reactivarea secven-
lelor de inifiere imediat dupà ce acestea au funclionat în r-.epli-
care. În acest proces de autoc.ontrol un rol esenfial se pare cà
îl au diferitele fracliuni de ADN saúelit (secrien!,e simple de
ADN, dar înalt repetate localiza'te de regulà la nivelul regiuni-
lor centromerice) dar mai ales ADN cu secvenfe mijlociu re-
pelate, incluzînd secvenf,ele repetate cu simetrie rotatorie in-
versà numite palindroarne de tip ABC XY C'B'A', precum gi
secrrente poli (AT) de vreme ce ADN satelit nu se afla Ia
toate speciile. -Un rol esenfial în replicarea ADN îl joacà sin-
teza ARN sub cata"liza ARN polirnerazei, acest ARN condifio-
nind inifierea repl.icàrii ADN, fiind se pare vorba de un ARNm
de ini{iere la ,eucariote. Replicarea ADN este însofità gi de sin-
teza d,e proteine histonice.
Cei mai important este însà reglajul genetic al replicàrii.
La eucariote existà un control i"ntracromazornnl aI rephcarii.
Tofi repliconii dintr-un cromozom eucariot, avînd dimensiuni
diferite, trebuie sà funcfioneze în cadrul aceleiagi perioade S
din inberfazà, repliconii de la nivelul heterocromatinei (bogatà
în AT) funclionînd spre sfîrgitul acestei perioade S, ,pe cind
cei d,e la nivelul eucromatinei (bogata în GC) funcfioneaza la
începutul acesteia. Cromozomul Y de drosofilà, care este în
cea rrrai mare parte heterocromatic, se replicà mai tîrziu fa!à
de ceilalfi cromozomi gi acest lucru este valabil Ei atunci cind
are loc trarrslocarea unor pàrfi ale sale în cromozomi ,eucrotna-
tici. Acreasta înseamnà cà pàrlile cromoz,omului Y confin in-
formafia care regleazà timpul replicàrii 1or.
La eucariote replicarea ADN nuclear Ei extranuclear este
reglatà gi Ia nitselul celular. Pentru replicarea ADN este nece-
sarà enzima tirnidinkinnzd. care este sintetizatà înainte de mi-
tozà qi este hidrolizatà sau inactivatà dupà realizarea repiicàrii.
Sinteza ADN inceteazà cînd s-a atins nivelul 4 C, ceea c€ pre-
supu,ne un mecanism fin de control celular al replicarii ADN.
În dezvoltarea timpurie a ovulelor are loc replicarea nu-
clearà fàrà a avea loc replicarea celularà. Toate cazurile de
endoreduplicare, poliploidie Ei polinemie aratà absenfa unei
coordonàri replicare ADN diviziune nuclearà sau celulara.
Faptul cà replicarea ADN - este dependenta de factori cito-
plasnatici este demonstrat de constatarea cà nucleii dfun neu-
ronii adulli nu sintetizsazà ADN ln mod nor,mal. Daca însà
17
acesti'nuclei sînt transplantafi în ovule activate partenogene-
tic ale.aceleiaqi specii, in aceEti nuclei are loc replicarea ADN
la numai o orà de la transplantare. De asemenea, cînd nuclei
din blastula medie care sintetiz,eazà ADN sint transplant'ali
în ovocite in creqtere care nu mai sintetizeazà ADN, nucleii
transplantali înceteazà sinteza ADN.
Cînd 1à celulele ,,HeLa" se asociazà experimental nuelei qi
citoplasmà din stadii diferite ale ciclului celular sinteza ADN
este iniliatà numai dacà nucleii din G1 sînt piasali în cito-
piasma aflatà în faza S.
S-a tras conluzia cà citoplasma S trebuie sà oonlinà
unul sau mai mu1!i factori care promoveazà sinteza ADN nu-
clear. Este posibil ca aceqti factori citoplasmatici sà aibà ori-
gine nuclearà.
Replicarea ADN este reglatà de asemenea la niuelul ,tesutu-
rilor gi organelor. Sînt date. dupà care evenimentele desfà$u-
rate la nivelul rnembranei nucleare pot influenla sinteza ADN
nuelear. Desfàqurarea mitozei, frecvenla diviziunii, orientarea
fusului mitotic, incapacitatea anumitor cromozomi sau pàrti din
cnomozomi de a se distribui în timpul miùozei, frecvenla re-
oqmbinàrii mitotice ca qi distribufia cromozomilor în meiozà
în urma sinapsei cromozomale sînt controlate genetic.
Antplif icarea genícd. sau extrareplicarea anumitor segmente
din ,$rrori, in special a genelor riibozomale, se desfàgoarà atît
în celulele diploide cît qi în celulele endopoliploide ducînd la
sinteza unui ADNr amplificat, labii metabolic, fiind degradat
dupà ce Ei-a îndeplinit funcfia de transcriere (sinteza AIINr).
Reoent, Mihàescu Ei Gavrità (1980) au evidenfiat fenomenul de
amplifioare a genelor ribozomale în celulele de rnamifer în
culturà infectate cu adenovirus, tratate în prealahil cu tioace-
tamidà. Uneori ADN amplificat nu este transcris aga cum este
cazul cu ADN de la nivelul pufelor insectelor Scinride sau dacà
este transcris, ARN sintetizat nu este transportat în citoplasmà,
aoest ADN arnplificat, r,epetitiv, l.,ocalizat de regulà la nivelul
regiunilor heterocromatice ale genomului putînd juca în prin-
cipal rol reglator.
Hormonii animali gi fitohormonii pot juca un rol important
în determinarea unei replicàri diferenliate a ADN. Cromome-
rele cromozomului eucariot al càror ADN suferà o replicare
amplifioa€ de ADN s-au numit arnpliconi. Amplificarea ,si sub-

48
replicarea nu sî:rt fenomene alternative, ci coexistente. Astfel,
în celulele suspensorului embrionar de la Phoseolzs se aflà
cromozomii politeni, la nivelul càrora apar,e un fenomen de
amplificare genicà a ADN satelit. În acelaEi timp apare un
fenomen de subreplicare a segmentelor ADN car,e cuprind ge-
nele ribozomale. Conlinutul total de ADN nuclear apare însà
ca un multiplu al valorii diploide.

{ - Desclfrlnd taiuele ereditàlii, vol. I


F

Capitolul II
STBUCTURA ARN $I TBANSCBIEREA GENSIICA

1. GENENALTTATI

ADN are douà funclii pri,mare: funclia autocatalitica, reali-


zatà în proeesul replicàrii saùe gi fu,nclia heterocataliticà realizatà
în procesul de sinteza de molecule specifioe, în spetà proteine.
Dacà ADN reprezintà substanfa macromolecularà cu fiurc-
lie primarà ereditarà, ARN este implicat în realizarea decodi-
ficàrii informafiei ereditare care are loc în procesul de biosin-
tezà proteinicà, cînd secvenla de nucleotide din ADN este mai
întîi transcrisà în ARN mesager gi apoi tradusà în secvenla de
aminoacizi a catenelor polipeptidice. Incà din anul 1952, A.
Dounce a aràtat pentru prima da,tà cà ADN îqi îndeplineqte
funcfia heterocataliticà în douà etape: transcrierea qi tradu-
cerea mesajului genetic.
Ca qi ADN, ARN este o substan!à rnacromolecularà, poli-
mer al unor ribonucleotide, avînd de regulà structurA mono-
catenarà. Axui principal ai monoca'tenei este reprezentat de o
ooloanà glucidofosforicà ia care sînt ataEate hazele azotate (Fig.
26). Ca pentozà, în ARN intrà D-ribozo care spre deosebire de
2-deoxi-D-riboza din structura ADN, are patru grupàri hidro-
xil. Bazele azotate din ARN sînt douà Tsurinice Adeninn qí Gua-
nirn qi d.ouà pirimidinice Citozina qi Uronil. Deci locul timinei
este luat ín ARN de uracil (U) care prezintà complementarita,te
pentru adeninà. Legaturiie fosfodiesterice creeazà o anumità
polaritate a monocatenei ARN care va prezenta un capàt 3' Ei
altul 5'.
ln structura ARN, în afa,ra rbazelor tipice ma'i pot intra Ei
alte baze, unele modificate dintre car€ oomun este nucleotidul
pseudouridina qi dihidrouracilul mai frecvente în u,nele tipuri
de ARN. În cazuri foar,te rane, în structura ARN indrà Ei ti-
mina.

50
ccdtut s' *.\,--*-ill Adeninè
ót 'N-Jt-l.l)^
O-P-O-Cl+
J' t'..1
I

\-i4 NHr

I I Hc-coN
? ot ,è.'N--A- citozinó
oGP-o-cH, ì
d' ir...l
I\-,4 ?
II rN',/\Nu
Gucni;rè.

(l!
''r-lrJt'A*oé-*"
ó,

À Àr tf"-ì* Urocil
o'É- o - Ct*j*-N'c-'o

O
ri
00H
I
-p- O-CHe
ót j*,ó,u'r'
Fig. 26. Formula chimicà a uaui poliribonucleotid,

Spre deosebire de ADN, ARN prezintà o mare heterogeni-


tate structural-f uncf ionalà.
Degi în general structura ARN este m,onocatenarà, acesta
poate prezenta prin pliere în urma potrivirii de secvenfe com-
plementar,e, regiuni bicatenare l,a nivelul càrora apar perechi
de baze azstate unite prin punli de hidrogen.
Unele riibovirusuri prezin,tà în mod normal ca miez de acid
nucleic ARN bicatenar cum este cazul reovirusului. De aseme-
nea diferitetle tipuri de ARN celular înspecial celribozonwl qi

51
F l.

de transfer pot prezenta regiuni bicatenare, separate de regiuni


monocatenare.
Datà fiind structura principial monocatenarà a A.RN pro-
porfia de baze complementare A-U Ei G-C nu realizeazà de
regulà raportul unitar. Monocatenele ARN au formà liniarà,
nefiind încà decelate molecule circulare de ARN. Numàrul de
nucleotide ce intrà în structura diferitelor tipuri de ARN va-
riazà între 75 qi 10.000.
Se pot distinge douà categorii esenlial diferite de ARN:
AIIN uiroZ materialul ereditar al ribovirusurilor Si ARN
celukr -
molecule care intervin in decodificarea informa{iei
ereditare- qi traducerea sa in secvenle aminoacidice în proce-
sul de biosintezà proteinicà celularà.
ARN uiral. Este ARN care ca Si A"DN este inzestrat cu func-
lie geneticà primarà qi anume funcfie de depozitare a informa-
tiei ereditare Ei transmiterea sa în generafiiile virale succesive
prin replicare. Se întîlneEte la unele virusuri vegetale, (\IMT),
la unii bacteriofagi (Qf3, R 17, MS,;), unele virusuri animale
(polio, virusuri poliedrale citoplasmatice de la insecte etc.).
Cantitatea de ARN viral reprezintà I0/o din greutatea particu-
lei virale cum este cazul virusului influenza sau 6olo î,n ca-
zul VMT.
De regulà ARN viral este monocatenar (VMT, virusul gri-
pal, polio, fagi Qp, R17 ; F2) sau bicatenar cu catene corr*pì.emen-
tare (reovirus).
ARN celular. Acest tip de ARN nu codificà informalie gene-
ticà qi este sintetizat pe matri!à ADN, adicà transcrie infor-
matia geneticà. Niciodatà î,nsà ARN celular nu îndeplinegte
funcfie de matri!à pentru pr"opria sa sin'tezà, deosebinclu-se
principal de ADN sau de ARN viral. El îndeplineqte însà func-
{ia de primnr în replicarea ADN.

2. TIìANSCRIEBEA GENETICA

Transcrierea geneticà reprezintà un prooes complex desfà-


qurat în mai multe etape, în care pe matri!à de ADN se sinte-
tizeazà. mon,oca'tene ARN, asigurindu-se transferul informa-
liei genetice de la ADN la ARN. În cadrul procesului enzima
numità AP"N polimerczd, dependentà de ADN recunoaqte
secvenle specifice de pe- matrila ADN gi catalizeazà- polime-
rizarea unor ribonucleotide trifosfat libere, aliniate pe matrila

52
ADN in virtutea complementaritàlii de baze azotate de tip
A-U, T-A, G-C, C-G, primul partener a1 perechilor fiind
lrerze azotate di,n ADN, al doilea fiind baz,e 'azotate ce .sînt in-
cluse in catena polirilbonucleotidicà. Matrifa Ei catena poliri-
bonucleotidicà nou sintetizatà formeazà un hibrid molecular
ADN-ARN temporar, prin intermediul pun!ilor de hidrogen
din'tre bazele compl.ementare. Ca substrat pentru ARN polime-
razi servesc cei patru ri,bonucleotidtrifosfati ATP, GTP, CTP
Ei UTP. ARN polimeraza, spre deosebire de ADN-polimerazA
are capacitatea de a inilia sinteza ,,de novos a unei catene po-
linucleotidice fàrà a neoesita prhTter. Cel mai bine studia,tà este
ARN polimeroza bacterianà.
ARN polimeraza bacterianà este o enzimà compl'exà alcà-
tui,tii din 2 su'bunitàti a, o su,bunitate B, o subunitate $' Ei fac-
torui alosteric o. Ba are o greutate molecularà de 495.000 dal-
toni. Holoenzima se poate separa în miezul enzimatic gi facto-
rul o. Factorul o este factor de inifier,e, ,el fiind acela care re-
cunoaEte ,o secvenfa specificà din ADN (promot'ord), condi{ion'înd
form,area comptrexul,ui ADN-ARN polimwazà,. Dupà inilierea
sintezei ARN factorul o se desprinde de pe holoenzimà Ei se
poate asocia cu un alt miez'enzimatic càruia îi oonferà specifi-
tate pentru matrita ADN.
Procesul de transcriere cuprinde ca qi în cazul replicàrii.
ADN o fazà de ini{iere a catenei ARN, o fazà, de elongane Ei o
fazà de terminare a transcrierii. Fiecare fazà se desfàqoarà prin
inlervenlia anumitor factori de inifiere, de elongare qi de ter-
minare. ARN polimeraza esùe dependenta de ADN, ceea ce
înseamnà cà ea func{ioneazà numai în prezenla matritei ADN.
Caiena din duplexul ADN care funclioneazà ca matrifà în sin-
feza ARN, care 'este deci transcrisà, se numeEte catend sena.
Procesul de inifiere a ,transcrierii pnesupwre mai întîi pre-
inifierea în care are loc formar,ea unui complex molecular ADN-
.ARN polimerazà, enzima recunoscînd prin facúorul 6 o sec-
.ientà specificà din matrifa ADN cu care se asociazà intim.
Urmeazà apoi formarea complexului de iniliere propriu-zisà a
transcrierii Ei în care este iniliatà polimerizarea secvenlialà a
ribonr-rcleotidelor cu desfàSurar€a alungirii catenei polirlbonu-
cleotidice (ARN), prin formarea de punli fosfodiesterice suc-
cesive. Transcrierea poate fi prezentatà astfel:
ATP -i- GTP + CTP + UTP :
matri!à ÀON
ARN polimerazà
- ARN + PPt (pirofosfat)

53
Creqterea catenei ARN are loc prin formarea punfilor fosfo-
dieterice succesive în direc{ia 5'-> 3', adicà prin* adilia unui
ribonucleotid-5'-fosfat la capàtul 3'-OH al ri,bonucleotidului
precedent.
Formanea punfilor fosfodiesteriae (alungirea catenei ARN)
este catalízatà de miezul enzimatic al ARN polimerazei.
Ribonucleotidul inifiat 5' al unei catene ARN este de obicei
un ribonucleotid trifosfat purinic (ATP sau GTP) care îgi pàs-
tr€szà toate grupele fosfat. Aceasta înseamnà cà în rnatri!à, l,a
situl de iniliere a transcrierii diferitelor catme ARN se aflà
fie dezoxitimidinmonofosfatul, fie dezoxicitidinmonofosfatul,
ceea ce înseamnà cà o glupare de pirimidine în ma,trita ADN
a,r putea c,onstitui situl de ini{iere a transcrierii ARN, recu-
noscut de càtre transcriptazà prin facùorul o.
Situl dín ADN la care se atageazà ARN polimeraza qi a cà-
rui secventà este recunoscutà în rnod specific de factorul o s-a
numit pro,motor. El reprezintà o regiune micà dfur matrita ADN
de pîlrà la 50 nucleotide lungime, localizatà imediat înaintca
genei sau grupului de gene a càrei informa{ie geneticà hrelbuie
transcrisà în ARN. De refinut cà secvenfa promotorului nu
este transerisà în ARN. Studiimd inifierea transcrierii ARNm
specific pentru enzirna p-galactmid,azd., Gilbrt qi Maxarn au
staibil,it în 1973 secvenfa de baze din punctul de inifiere a sin*
tnz,ei ARNnz care este urmàtoarea:
I
5',..... TGGAATTGTGAGCCGATAACAATTTCA 3'
3',

Inifierea sinúezei ARNnz pentru F-golnftozidnzd este indi-


catà prin sàgeatà. Se poate cons'taú.a cà s;ec'venfa de baz"e, cores-
punzàtoar,e sitului de iniliene a transcrierii este bogaúà în pe-
rechi A-T. Inilierea transcrierii poate fi ur-hirbatà în mod spe-
cific de anti,bioticul rifampicinà la procariote sau a-amanitinà
Ia euoariote.
$i alti factori sînt impl,icafi în controlul inifierii transcri'erii,
cel mai important pentru bacterii fiind factorul proteinic CRP
(proteina rreceptoa,ne a cata,bolitului) numità încà factor CAP
care reprezintà proteína receptoare a AIVIP ciclic, acest nucLeo-
tid monofosfat ciclic avînd rol important qi multiplu în, reacfiile
biochimice lega,te de deoodificarea informaliei genetice. Aibsenfa
CRP sau chiar a AMP ciclic duce Ia descreEterea vitezei de
initiere a transcrierii qi ca urmare a sintezei ARN.

54
Desfàqurarea ,transcrierii (elongarea catenei ARN) se reali-
zeazi cu o vitezà, de 60 ntrcleotide pe secundà, dar viteza de
transcriere poate fi influentatà de lnsàqi secvenfa car,e tnebuie
transcrisà, acesta fiind chilar un rnecanism de reglare a franscri-
erii. ElongaÍea catenei ARN este inhibatà specific de catre anti-
bioticul streptolidigina, care ar'e afinitate pentru ARN polime-
razÀ, inactivînd-o. Aaelaqi efect are acliuniea acúinomiciÍtzi D.
Terminarea si;ntezei ARN esúe dírectà, condilionaÉ de întîlni-
rea de càtre compl,exul tripartit de ,transcriere ADN miezul
enzimatic al ARN polim,erazei - sit de
ARN nàscînd, a unui
tgrminare din cadrul secvenlei -ADN ce este transcrisa cu eli-
berarea catenei ARN adicà a transcriptului qi dezorganizarea
complexului de transcriere. Transcriptul ARN începe la capà-
tul sàu 5' cu o aga-numità sectsenló ghid sau cozducdtmre (lea-
der) care poate avea pînà la 150 de ibaze $i include qi comple-
mentul operatorului (vezi reglajul genetic) sau al unei pàrli a
aeestuia.
T,erminanea transcrierii însà poate avea l,oc prin intervenfia
unui factor proteinic care a fost desem,nat factorul de termi-
nar€ q (rho) care este alcàtuit dín 6 subunitàli identice aranjate
în cerc gi care are capacitatea de a se lega Ia ARN pli.marozó.
spne a înceta transcrierea la nivelul unor bariere naturale al.e
transcrierii care apar în ADN reprezentate de secvenfe speci-
fice de nucleotide localizate fie în cadrul secvenfei unei gene,
fie intre gene adiacente. Sinteza ARN se desfàqoarà polarizat.
Transcrierea începe la capàtul 3'-OH al matrifei ADN qi sin-
teza ARN se d,esfàEoarà în direcfra, 5' 3'. Rezultà deci, cà
atrila gi transcriptul sînt antiparalele.-+În vederea transcrierii
are loc ,o desfacere localà a dublului helix ADN î:r zona ce ur-
meazà a fi transcrisà qi apare astfel a$a-numítul ochi, de fiqrn-
sqie:re. Pe màsurà ce transcrierea se desfàgoarà, în urma se re-
face structura dublu-catenarà a ADN Ia parametri sài inifiali.
Desfaoerea localà în transcriere poate fi folosità Si în rreplica-
rea ADN.
In uiuo transcrierea este ,asimetricà adicà doar una din cele
douà caúene ale dublului helix ADN serveqúe ca matri!à pentru
sinteza ARN. Dar acest lucru nu însea,mnà cà în toate cazurile
una gi aceeaqi catenà ,a ADN este activà î,n transcriere ian cea-
laltà este inactivà. Pentru o genà datà sau un grup de gene
(vezi operonul) o catenà ADN este activà în transcriere iar ca-
terra complementarà inlactivà, pe cînd, pentru altà genà sau alt
gnup de gene aceeaqi ca0enà ADN poate fi inactivà iar catena
complementarà poate fi activà în transcrier,e. Dar dacà un

55
sqgrnent al unei catene ADN este activ în,transcriere segmen-
firl corepunzàtor de pe catena oomplementarà este în mod ,de-
terminat inactiv î:r transcriere. Altfel s-ar sintetiza douà ,trans-
cripte care prezentînd oompl'ementaritate ar duce la formare de
structuri bicatenare ARN, de regutà inaetive în dirijarea sinte-
zei pro0einice. Faetorul o joacà rol esenlial în selocfia catenei
active; càci în absenfa sa miezul enzimatic al ARN polimerazei
nu prezintà specificitate de secventa Ei catenà, putîndu-se l,ega
la orice secven!à a oricàreia dintre cele douà catene ale ADN.
În prezenla factorului o însà, ARN polimeraza capàtà capaci-
tatea de a recunoagte secvenfa specifieà de p mtena selÉ ce
trehuie transcrisà.
În naitocondrii s-a stabilit existenfa r,rnei transcrieri gen,etice
sirnetrice, am'bele ca,tene ale ADN mitocondrial fiind ac"tive în
transcrie're, dar int'ervine Ei aici un mecanism specific car',e de-
grad.ea,zà rapid unul din cele douà transcripte.
I"a procariote produsul imediat al' transcrierii s-.ecvenfelor
din ADN ce specificà sinteza diferitelor proteine este un ARN
rnesaEer policistronic, adicà care conline transcrisa informafia
g_enetiqS pentru mai multe proteine, sistemele dc transcrierg $i
de traduc€re fiind intirn cuplate (FiS. 27), f.apt care Du se. evi-

E 8-,..

6f;"':r::r

Fig. 27. Transcrierea gi traduceîea mesajului genetic la procatiote sînt freev'efiLt


rt'l ,'. .,:'

56
ientiazà la eucariote unde transcrierea are loc în nucleu iar
t:aducerea mesajului genetic are loc în ciúoplasmà, la nive-
-u. ribozomil.or. La eucariote pr,oduEii imediali ai transcrierii
sint mult mai mari decît produEii maturi astfel cà ei sînt su-
pugi unor prelucràri posttranscripli,onale prin care sînt pe de
..' prrte modificate unele baze azotate (metiiare, acetilare etc.)
-'r sint ,excizate anumite secvenle de baze azotate iar uneori
a:iugaie unele secvenle specifice de ,baze (adenilare). În urma
ai-€s[oi prelucràri posttranscrip{ionale, ARN rrlesagter frrea.ffsor
e:::ariotic clevine un ARN masager mnnocistronic ma,tur care
jeline informalia ce specificà o singurà catenà polipeptidicà.
!: :'eglarea transcrierii intervin factori inductori Ei repnesori
:ine evidenfia{i mai ales la procariote. La eucariote transcrierea
-lDli din cromozomi este dependentà de starea decond'ensatà
i:::erfazicà a cromatinei, starea condensatà a cromozomilor mi-
:c:i,-'i sau a heterocromatinei nepermi!înd transcrierea ADN. În
',-elelea transcrierii la nivelul cromozomilor condensali ar,e loe
r.l:r proces d'e deslînare localà, cu aparilia de ptle sau inele
fuJbiani în cazul cromozomilor politeni de diptere. Sinteza
-lRN ale loc pe parcursul întregii interfaze qi continuà gi în
piofazà cind inceteazà, reîncepînd în telofazà. Din 'aceastà cau-
zà s-.ì tras concluzia cà ea este condilionatà de integritatea
mem'branei nucleare Si a nucleolului. Aceasta poaùe fi justifi-
cai pentru sinteza ARN riboz'ornal, nu Si pentru alúe categorii
de ARN. Mai sigur este cà sinteza ARN este condili,onatà de
s:area difuzà, deconderr.satà a cr,omatinei.
Prcpor{ia din ADN la bacterii care este transcrisà 'este de
o:'C:.nul a B0-1000/o pe cînd la eucariote aceasta este mult mai
mi-'à \2-2007r) Ei este dependenta de tipul celular qi de orga-
nismul considerat. Transcrierea la eucariote nu este cuplatà
ri--i :emporar qi nici spalial cu traducerea mesajulúi genetic.
Transcrierea a fost vizualizatà electr,onomicroscopic atît la
p:ccariote cît qi la eucariote (FiS. 28 A, B, C) d,e càtre Miller
1; coia'b. (1970).
Difelitele categ,orii de ARN celular intervin în etape speci-
!:ce aie decodificàrii informaliei ereclitare.
S: pot distinge mai multe tipuri de ARN celular: ARN rne-
scger', ARN ribozomal, ARN de transfer, ARN heterqen qi
-{iìN cromozontal. Primele trei tipuri de ARN celular intervin
diret-c în procesul decodificàrii.
3. ARN mesager (ARl{m) a mai fost numit ARN d,e infor-
n:.aiie. If.oleculele cle ARNm sînl componente centrale în ex-
presir genelor structurale. ARNrn reprezintà 20/s din ARN ce-

37
(,
co

/ / ARN
tolrmcrozo
,/
/ g$)q"*--:-
/'\ AON
aDN .'/ strrl .Jc rnrtrere
f '. Gl tr3f,scrlpt'cr

fj ,' aìn -

$
o geno

I ARN m ( Nu sirrt vrz rbrte


polrpeptrdele sr ARI'it)

Fig, 28. l. Transcrierea geneticà. la pro- Fig. 28. B. (a) - ulr fragruerrt de ADN de ,8. col,i avînd atagate mole-
cariote. Interptetate dúpó electronografie. cuÍe ale enziurci ARN-polinrerazei qi ribozonri; (b--c) - diagranazo-
uei de initiere a trartscrierii cu red.area deplasórii secventiale a ARN-
polimerazei spre stînga determinînd sinteza de ARNzra pe mattifa
enx. La aceste molecule de ARNm. se atageazà tibozomii, la cape-
tele lor 5', traducînd secvenla sa polinucleotidicà într-o secventà de
aminoacizi a polipepticlelor pe màsurà ce aceasta se tleplaseazà spre
capàtul ,,în ciegtèró" 3' al mesagcrului; (d) Degradatea ARNm începe
cu- capàtul 5' gi astfel ru ruai *:rl"r?."r"qarea de ribozomi care se disa'
. lo)

srl tèrnlnot nroleculo deARN


ot l
(br
s'l de tnitlere-ARN '

,d )
;1 î.

Fig. 25. C. Trauscrierea la eucariote. (a). Electronogtafia unei secvenf€ ADN


în-procesul de trauscriere în ovocita de Triturus airidescens. Moleculele de A'RN
transcrise pofnesc radiar din axa ADN. La intersecfia unei catene ARN 9i axei
ADN se ailó un grauul proteinic dens care cel mai probabil teprezintó molecule
d.e ARN polimeri,zó b-f. Secvenfa de evenimente redatà diagramatic care duc
la transcierea unui segment ADN. (b).O moleculó de ARN polímerazà ($l)
se ataqeazà [a un sit de iniliere pe o secven!à d.e ADN ce trebuie transcrisà
la un moment dat. (c). Molecula de eRN polimerazà se deplaseazà,pe catena ADN
ttanscriind-o întt-o secvenfà ARN. Dupà ce polimeraza + I s-a d.eplasat pe un
anumit interval, se atageazà polimeraza * 2 la situl de inifiere gi lucepe_ 9i ea
transcrierea, g.a.m.d.. asifel ca pe cînd molecula de ARN asociatà cu ARN poJi-
rneraza, nr. I reptezintó o secvénfó complementaú" la aproape întreaga lungime
a unei catene ADN, celelalte asociate cu ARN polimerazele 2, 3, 4 etc. sìnt pro-
gresiv mai mici. La termina*i$'ffT'i'ii este eliberató împre'
irlilJ;J:-eraza

luL,ar, avînd duratà scurtà de via!à. El tra,nscrie informafia ge-


neticà de pe un segment al unei catene a dublului helix ADN
aonespunzàtnr unei gene care trebuie sà funcfioneze la un mo-
ment 'dat Ei funcfioneazà. ca m,atri!à pentru sinteza sa- &gmen-
tul din ADN care serveEte ca matri!à pentru sinteze ARNnt
poate cor,espunde la o genà sau la mai multe gene care delin
informa,fia geneticà pentru sinteza unor proteille sau enzime

59
înrudite ce controleazà un acelaEi caracter sau rnrervln în
aceeaEi cale metatboiicà.
Dimensiune'a diferiteior: molecule de ARNrn este în functie
de màrirnea mesajului pe care ît poartà, adicà corespuncle
secvenlei de baze a diferitelor gene pe care le transcrie, gene
care au la rîndul lor dimensiuni foarte diferite Ei care speci-
ficà în consecin!à catene polipeptidice de lungime varia'biià.
As'tfe1, cons'ta,nta de sedimentare a diferitelor moleculre cle
ARNrn cle ia acelaEi organism variazà între B S qi 45 S.
ARNrn pentru ovalbumi'nà cuprinde cca 1890 nucle,oticle.
llnul dintre cele mai mari tipuri de ARNnz est,e cel pentru
fibroina firului' de màtase din glanda posterioarà de Bambyr
mori. Acest ARNnz are constanta cle sedimentare de 32 S (Tay-
lor, 1979).
Durata de r,ta!à a ARNrn la procariote este de 2_.1 rninute"
De îndatà ce au f,ost traduse, moleculele de ARNnr sînt distrtr-
se, evitîndu-se astfei aÌteràriie posibile clin structura sa ceìre
ar cluce Ia modificarea mesajului genetic gi la sinteza cìe pro-
teine modificate, sau la traducel'ea unui ARNnr care nì-r este
în eonformitate cu cerinfele de mecliu celnlar care se -.chlrnbà
rapid de la o perioadà de ti'rnp la alta.
Cele rnai multe tipuri de ARNm prezintà la capàtul 3' al mo-
noca,tenei o secven!à poi[ (A) care este adàugatà posttranscr'lp-
fional gi este implicatà în conturarea duratei de via!à a AF!.N'r.
. Complexul enzima'tic care clegradeazà ARNm procariot, are
capacitatea de a distinge diferitele tipuri de ARNnx pe cir,re ie
degradeazà în mod specific, degradarea fiincl cupiatà cu tr"a'clu*
cerea mesagerului.
La eucariote, la care ciurata de via!à a celulei este mai mare
+i durata de via!à a ARNnz este mai mare, de cca 1-4 ,ore.
Atît la procariote cît Ei la eucariote existà situalii ín care
ARNrn are o duratà de via'!à mai mare. Este cazul celul,eior" cle
Bacillus cereus irnduse sà devinà spori în care ARNnr clureazà
cca 6 ore Ei reticuiocitelor mamiferelor în care 900/o diri sin-
teza proteinicà este reprezentatà de sinteza hemoglobinel i:rr
cînd .se maturiz'eazà, pierd spontan nucleul, nemaifiind der.:i \ireo
matri!à pentru sinteza ARI{nz pentru hemoglo;binà. Cu toate
aceslea, sinteza hemoglobinei este continuatà pe seama ARNrz
sintetizat' încà din s,tadiul nucleat Ei care persistà Ei funclion ettzà
rnulf timp (cîteva zile) dupà ace,ea.
În cazul dormanlei adoptatà de mul.te ouà 1a anirnale qi
seminlele de plante, ARNrn este menlinut într-o for:mà sta-
bilà pentru luni qi chiar a,ni.

60
Moleculeie de ARNrn cu durata lungà de via!.à, cum sînt
Ei cele din ovulele de ,broascà care sînt pàstrate multe Ìuni
înainte de a fi traduse, sînt protejate fa!à de atacul enzimelor
depolimerizatoare ribonucleaze prin asociere cu categorii spe-
ciale de proteine. Asemenea asocieri ARNrn proteine la
eucariote care apar înainte de trece,rea ARNrn din rnucleu în
citopiasmà unde se asociazà cu ribozomii sedii a,le sintezei
proteinice au fost numlte informozomi-sau informnfere.
- genele aflate în raport de contiguitate gi înru-
La bacterii,
clite rnelabolic (legate de aceeagi cale metabolicà) formeazà o
unita'te reglatoare care s-a numit operon. Ele sînt transcrise
într-un ARNm policistronic ce poartà mesajul genetic pentru
mai multe proteine. La scurt timp de la inilierea sintezei
ARNrn bacterian, ribozomii se ataqeazà la aceasta Ei se depta-
seazà de-a iungul sàu în urma ARN polinterazei, spre a asi-
- gura traducerea mesajului genetic.
De regulà, la eucariote ARNm este monocistronic Ei trans-
crie gene care dirijeazà sinteza de polipeptide. Aceste gene sînt
de regulà reprezentate de secvenfe unice, nerepetate din ADN.
ARNnz eucariotic se sintetizeazà sutb forma unui precursor he-
terogen numit qi ARN nuclear he,terogeru care are o ,greutate
moiecularà- de 5 X 105 107 daltoni. S-a mai numit pre-ARNnz.
Precursorui ARNm este - supus prelucràriior posttranscripfional'e
în cadrul càrora vor fi eliminate nueleotide, de la capàtul 5'aI
moleculei Ei totodatà vor fi adàugate la capàtul 3', 50-200
resturi adenilat formînd un segment de acid poliadenilic care
cond.i{ioneazà durata de via!à a ARNm
La procariote ARNm reprezintà copia exactà a secvenlei ge-
nice,, fàrà a-i lipsi anumite segmente. La eucariote în cazul
unor gene apar por{iuni (secven{e interpuse sar-r spa{iatoare în
cadrul secvenfei genice codificatoare) care sînt ,transcrise în
ARNrz dar nu sîtnt traduse. O situalie sirmilarà apare în cazul
unor virusuri anirnale.
Asertenea secvenle spaliatoare apar în genele pentru catena
f3 a hemoglobinei, h genele pentru imunoglobulinà, ovalbumi-
nà qi în genele ARNú Ei ARNr. Secvenlele spaliatoare sînt im-
plicate se pare în reglarea activitàfii genice. Ele pot fi transcri-
sp în ARNrn, dar ulterior sînt excizate. Este admisà Ei posibili-
ta,tea ca la eucariote ARNrn sà fi,e sintetizat segmentar, segmen-
tele fiind ulterior unite într-o monocatenà unicà de ARNnz în
care nu sînt incluse qi secven{ele spafiatoare.
4. ARN ribozomnl (ARNr). ARNr r'eprezintà cca 800/o din
ARN celular total qi intrà în structura ri'bozomilor care ;sînt

61
particule ribonucleoproteinic,e implicate în biosin teza proteinicà.
Ribozomii confin 40-600/o ARNr qi proteine tbazice ribozomale.
Ri:bozomii apar în citoplasma tuturor celulelor procariote gi
eucariote avînd un diametru variabil. de 140-230 À. Proteinele
ribozomale în numàr total de 53 la procariote Ei 70-80 la euca-
riote se leagà de ARNr prin legàturi necovalente, migurînd
stabilitatea structunalà a ribozomului permi!înd totodatà ataqa-
rea altor tipuri de ARN la riibozom. Prin ataqa,r'ea de ribozomi
pe monocatena ARNrn se pàstreazà, conformafia monocatenarà
a acestuia propice decodificarii traducerii mesajul.ui ,gene-
- formînd poliribeotrri sau
tic. Ri'bozomii se ataqeazà la, ARNrn
polizarni, între ei fiind o distanfà de 50-150 À.
Ribozomii procariotelor au constanfa de sedimentare 70 S
(subunitali 30 S gi 50 S) pe cînd cei eucariotici citoplasuratici
au constanta de sedimentare B0 S (subuniffifi 40 S Ei 60 S) fàrà
ca ri'bozomii eucariotici sà constituie un grup uniform ,,80 S6c
càci greutatea lor moleculara variazà de la 3,9 X 106 daltoni la
plante la 4,55 X 100 la mamifere, sohimrbarea masei rirbzomale
bazîndu-se în special pe variafia dimensiunii subunitafii mari
ribozomale (60 S) de Ia 2,4 la 3,05 X 100 daltoni, variafle ca,re
este cleterminatà de varialia cantitativà atît, a ARNr cît qi a
proteinelor ri,bozomal,e asociate. Subunitatea rirbozomalà micà
(40 S) a ri'bozomul.ui eucariot nu s-a schimbat aprecia,bil în
cursul evolufiei eucariotelor. Ri'bozornii organitelor celulei eu-
cariote, cloroplastici qi mitocondrial,i sînt de tip procariot avînd
oonstanta de sedimentare 60-70 S. Prin scàderea ooncwttrafiei
ionilor Mg2+ sub 0,35 ffiM, riibozomii bacterieni disociazà în
subunitàtil,e 50 S qi 30 S.
Greutatea molecularà a prroteinelor bazice structurale ribo-
zomale este de 25.000-26.000 dattoni. Proteinele ribozomale
sînt heterogene fiind descrise douà categorii, urla S, corespun-
zàtoare su,bunitàlii ribozomale mici qi alta L c\orespunzàtoare
subunitàlii ribozomale mari. Fiecare categorie de proteine ri;bo-
zomale are rnai multe fracfiuni Sr-Szr gi L1-L32. Ia, euca-
r:iote fracfiunile celor douà categorii de proteine ribozomale
sî,nt mai numeroase. Ele sînt esentiale în funcfionarea rirbozo-
milor. Proteinele riibozomale Lt Qi Lp au proprietali contractile
qi se pare cà sînt implicate în translocarea aminoacizilor în
timpul sintezei proteinice.
Asamblarea ribozomului realizatà l,a rrivelul nucleolului este,
cel pulin ùr parte, ur proces autodire4ionat, deci nedireclio-
nat de alte structuri celulane pneexistente. Sînt date dupà care
unii ribozomi pot fi specific mesageri, cu funclie informalio-
62
@
"^6(=ù

p6fi
^D9
@>"'
Fig. 29. Ciclul ribozomului. Subunitatea 30S se asociazà cu ARNrz dupà care
are loc atagarea subunitàlii 50 S.

nalà. Se pesupune cà ARNr posedà in uiuo un mesaj tradus,


specific pentru sinúeza proteinel'or ribozomale (Rieger qi co-
lab., 1968, 1976). Interesant este cà ritbozomii ca qi cromozomii
eucariotici sînt organite celulare, lipsi'te de memibrane deiimi-
ùante, care prezintà totoda,tà spre deosebire de alte organite
-
a1e celulei _- irn ciclu caracteristic de organizare Ei desfacere
în vederea funcfionàrii. Existà astfel un ciclu ri'boz'omai (Fig.
29) (vezi Ei sinteza proteinicà) Ei un ciclu cromozomal (vezi .or-
ganizarea geneticà).* În celulele eucariote care sintetizeazà pro-
teine pentru secrefie-export, majoritatea ribozomilor sînt eta-
$ati la nembranele reticuiului endoplasmic prin intermediul
subunitàtilor mari 60 ,S: Rirb62o*ii lirberi neatagafi la membra-
nele reticulului endoplasmic sintetizeazà pruteine care ràmîn în
citoplasma celulei. Se admite cà în acest proaes de seleclie
de cà'tre ribozomii ataqafi sau neataqa'F la reticulul endoplasmic
a unui ARNrn particular spre a fi tradus, un ro1 important î1
joacà secvenla lider din ARNrn ce poate fi recunoscutà în mocl
diferenliat de càtre cele douà tipuri de ribozomi. De asemenea,
proteinele destina,te nucleului sînt sintetizate pe ribozomii cito-
plasmatici neataga{i la neticulul endoplasmic. Dupà sintezà,
acest'e proteine sînt pompate sau suctiornate în nucleu. Se admi-
te cà Ei la procariote ARNrn ce codificà proteine speciale sînt
traduEi în locuri speciale qi prorbabil de càtre ribozomi speciali.
As,tfel, la Bacillus sinteza proteazei neutrre, care este secretatà
în mediu, afie loc pe ribozomi localizali la periferia celulei.
În subumitatea ribozoma'Ià micà intrà ARNr de tip 16 S la
procariote Ei 18 S la eucariote.
+ Reunirea stùunitàfi'lor ri,bozomale spre a constitui particuie ribo-
zontatre funcfionale este aleatorie, ceea ce înseamnà cà reciclarea sub-
unitàlilor ribozoma,le într-o nouà rundà de sintezà nu presupune aso-
cierea aceloraqi subunitàfi care au constituit ribozomii func{ionali ai
rundei precedente.

63
F
În subunitatea ribozomalà mare intrà ARNr de tip 23 S la
procariote qi 28 S ta eucariote.
Atît la procarioùe cît Ei la eucariote asociat subunÌtàtii ribo-
zomale mari mai intrà qi un tip aparte de ARNr, care are con-
stanta de sedimentare 5 S. În plus, la eueariote, s-a descris gi
un alt tip de ARNr care are constanta de sedimentare 7 S qi
care intra în componenla subunitàtii mari a ribòzomului, exis-
tînd la eucariote deci 4 tipuri de molecule de ARNr (Wool,
1e7e).
Toate m,o1,ecu1e1,e de ARNr atît la procariote cît qi la euca-
riote s'e sintetizeazà sub formà de molecule precursoare de
ARNr' (pre-ARNr) care, dupà transcriere, sùrt supuse, prelucrà-
rilor posttranscriplionale. Acestea includ pe de o parte metila-
r:ea resturilor rirbozà la cca 5oA dintre nucleotide, deterrriinînd
diferenlieri calitatíve în func{ia catenelor poliribonucleotidice,
iar pe de altà parte clivar,ea unor secvenle (eliminarea) ducînd
la reducerea lungimii pre-ARNr gi delimitarea unei rnolecule
mature de ARNr. Dupà pr,elucrarea posttranscripfior,ra'là struc-
tura primarà mronocatenrarà a ARNr poart.e suferi cqrúorsionàri
spaliale cu realizarea de regiuni bicatenare gi cu aparifia unor
modele spaliale caracteristice.
Genele (ADNr) pentru cele trei caúegorii de ARNr sînt dis-
puse în'tandern (policistroni) în ADN (genom) gi sînt tnanscrise
în ordinea 16 S 23 S la procariote. Aceste gene apar de ase-
- Ia eucariote fiind dispuse în'ordinea 18 S
menea strîns lincate,
28 S qi transcrise ca un pre-ARNr unic care are o:constantà
- sedimentare
de 45 S. Acesta va fi separat prin prelucràrile post-
transcriptionale ulterioare în cele trei tipuri de ARNr matur.
La eucariote, genele pentru sinteza ARN 18 S. qi 28 S s'e
afià în regiunea orgwuizator nucleolard (NO) Iocalizata la nive-
lul constricliilor secundar,e implicate în formarea nucleolului.
Rezu1tà cà aceste gene ri'bozomale sint gene nucleolare. EIe sînt
r,egiuni vital,e ale genomului de vreme ce mutantele de Xeno-
pzs desemnate D-nr.r fur stare homozigotà tripsite de nu'crleol
nu sînt capabile sà sintetizeze ARNr gi mor. Genele pentru
ARN 5 ,S, prezente qi ele în copii multiple la eucariote sînt
neLincate cu celela,lte gene ri'bozomale, fiind distrirbui.te pe di-
verEi cromozomi, în spetà în regiunea teiornericà a lor. Deqi
nelincate cu genele ri'bozomale LB S qi 28 S, genele ri'bozomale
5 S sînt transcrise coordonat cu genele pentru ARNr 18 S Ei 28 S.
S-a constatat cà prezenla ARN 5 S în subunitatea mare a ribo-
zomului este esentialà în funclior.ar€a normalà a rÍhozomului
în sinteza proteinicà.

64
ARNr din cloroplaste gi mi,tocondrii prrezintà greutàfi mo-
lecuiare mai mici decît molecrrlele c€respunzatoa,re din cito-
plasrnà.
Nu se cunoaqte deocamdatà cane este firncfia particul,anà a
ARNr. Se admite cà bazele neîmperechearte din ARNr ar par-
ticipa, intr-un fel sau altul (posiibil tot pe principiul comple-
mentaritàtii qi for'rnàrii de punfi labile de hidrogen) la inter-
acliunea cu oelelalúe oategorii de ARN celular spr€ a deoodifica
mesajul genetic purtat de ARNnz. Are loc o al,iniere corectà a
diferitelor tipuri de ARN c'elular cerutà de o fidelà traduoere
a informaliei genetice într-o secvenfà corectà de amînoacizi
pentru sinteza unui polipeptid norma'l. Un rol prfurcipal în rea-
lizarea acestei alinieri revine ionilor de magneziu (Mg2+1 care
joacà de asemenea un rol important în asamblarea unitàfilor
ribozomale.
Existà diferenle semnifica,tive în structura ribozomilor la
procarioúe Ei eucariote, diferenle care formeazà ceea ce WooI
(1979) a denumit dilema centrald, a rùbozomalui. Astfel, ribozo-
mii eucariotici sînt apreciabil mai mari decît cei procariotici,
conlinînd un numàr mai mare de proteine ribozomale (cca 80,
fa!à de 53 l,a procariote) qi au o mol'eculà în plus de ARN.
Totodatà moleculel,e de proteine rilbozomal,e Ei de ARNr sînt
mai mari la eucariote fa!à de procariote. Diferenla în dimen-
siune este un paradox deoarece ribozomii eucariotici îndepli-
nesc aceeagi funclie generalà cantonarea sinrtezei pr,oteinice
oa +i ri'bozomii procaniotici. Se- admite ca peurtru a ju.stifica
aceste diferente dimensionale la ri,bozomii eucariotici trebuie
desooperite funclii noi. Unele proteine ribozoma,le suplimen-
tare pot fi specializate pentru inúeracfiunea cu reeeptorii din
reticulul end'oplasmic numili ribophorine I Ei II, altele pot fi
implicate în reglar,ea mai complexà a traducerii ARNm. Nece-
sitatea suplimentarà pentru anumi'te proteine ribozomale, ne-
implicate în biosinteza proteinicà poate fi determinatà de panti-
cularitàlile biogenezei organitului: proteinele ribozomale sînt
sintetizate în citopiasmà qi tra,nsportate în urucleol uurde sînt
asamiblate în subunità!ile ri'bozomale prin atagarea lor la pre-
cursorii ARNr pe cind acegtia sînt încà tr,anscriEi de pe ADN
ribozom,al. Pre-ARNr va trebrui prelucrat qi ARNr 5 S'transcris
din alte situri în nucleu trebuie sà fie î:rcorporat în subr:nitatea
mane ribozomalà. Cele douà subunitàfi rirbozomale tnebuie trans-
portate din nuctreu în citopl,asmà. În acrest prooes extrem de
complicat de transport bidirecfional nucleu citoplasmà ar
putea fi implicate proteinetre ribozomale suplimerrtar,e ale rirbo-

S - Descifrind tainele ereditófii, vol. I 65


zomului eucariot. Ele de ase,menea pot participa la asamblarea
subunitàlilor ri,bozomale ca qi în 'transportul lor spre cito-
plasmà.
Proteinele ribozomale ale organitelor celulei eucariote mito-
condriale Ei cl,oroplastice sînt codificate în ADN nuclear qi sin-
tetizate pe ribozomi citoplasmatici. Din aceastà cauzà la euca-
riote cu mitooondrií qi cloroplaste sînt sintetizate în citoplas-
mà circa 200 de proteine riibozomale care trebuie distribuite în
nucleol, mltooondrii qi cloroplaste. Cum se reaùizeazà aceasrtà
distritbufie nu se cunoaqte. S-ar puùea ca toate aceste proúeine
só fie fil,trate prin cele trei organite, fiecare relinînd grupul
corect de proteine ribozomale. S-ar putea ca proteinele supli-
mentare ale ri,bozomilor eucariotici sà condilioneze ele însele
aoeastà distriibuire. În sfîrqit, nu poate fi exclusà nici posibili-
tatea ca proteinele ri,bozomale suplimentare de la rihozomii
eucariotici sà nu a,ibà ,o funcfie specialà sau sà nu îndeplineascà
nici ofuncfie. Existà mutanfi de Bocillus suúilis qi B. megate-
úum rezistente la ttriostrepton qi ca,re sînt lipsi{i de proùeina
ribozomalà L 1L Mutantul de Ia prima specie spre deoserbire de
acelra de la a doua specie de BacilZzs nu prezintà nici un fel
de deficientà. Concluzia care se desprinde este cà proteina L L1
la B. wbtilis. mu îndeplineEte \n€o funcfi,e ribozomalà sau în
sinteza proteinicà, dan nu poaùe fi orclusà posi,bilitatea ca rolul
sàu sà fie preluat de al,te pr,oteine ri'bozomale prezente la acest
mutant.
5. ARN de transfer (ARNí). A mai fost numit qi ARN so-
lubil (ARNs), ARN accegttor de aminoacizi sau AIÌN adn@r.
Sînt molecule adaptoare sau de racordare la care se ataqeazà
diferiti aminoacizi carìe sînú transferafi la ribozomi în timpul
biosintezei proteinice. Ac'este moiecule de racordare se atageaza
la rîndul lor în mod specific la grupàrile cetonice qi aminice li-
bere de pe monocatena ARNrz pe principiul împerecherii com-
plementare de hlazr azotatn cu formarea unor punfi temporare
de hidrogen. ARNú foacà rol cheie în ,biosinteza pr'oteinicà.
Perntru fiecare aminoacid existà ce1 pufin cîte o moleculà
specificà, diferità de ARNú. Greutaúea mol.ecularà a ARNf este
de circa 25.000 daltoni avînd o oonstantà de sedimentare de
4 S. Lungimea molecutrei ARNú este de 73-90 nucleotide. Re-
prezintà 7A-150/o din cantitatea totalà de ARN celular. Ca gi
ARNr, ARNú nefiind purtà'tor de mesaj genetic are, spre de-
osebire de ARNnz o duratà de via{a mare, prrezentînd o stabili-
tate metabolicà mare, diferitele molecule ARNú putînd fi re-
ciclate de nenumàra'te ori. Capàtul iiber 3' al monocatenei se

66
úerminà la toate tipurile de ARNú cu secvenfa CCA pe cînd
la oapàtul, li'b,er 5' se aflà secvenla terminatà în G. Moleculele
ARNf prezintà o mare stabilitaùe rneta,bolicà cane derivà toc-
mai din prezenfa guaninei (pG) Ia capàtul 5' al monocate'nei
sale. Aceasta faoe oa ARNú sà nu fie supus aga cum este supus
ARNrn digestiei enzimartioe, ,gua,nfura stabilind punti de hidrogen
cu ,Lraza opusà din ttrlpina dublu-catenarà a structurii trifoliare
a ARNf. ARNú conline qi unele nucleotide areo iqnuiúe pnecum
acidul inosinic (I) care poartà purfura hipoxamtilra gi care nu
formeazà aceleaqi per,echi de baze azotate ca oele formate de
A Si G. Alte nucleotide neobiqnuite aflate în ARNú sùrt acidul
l-metiliinosisric (I-) acidul l-metilguanú,lic (G-) gi acidul NlN-di-
metilguami,lic (G-) la care, prezenta gmpàrilor mgtil determinà
formanea de perechi cu oricarre aùte tb,aze azotate. Tot ca bazà,
neobiEnuità intrà în ARNú gi aeidul pseudouridilic (ìf) la care
inelul pirimidilic uracil este ata$at lra ribozà nu prin azotul sAu
N1 ca în acidul uridilic normadt ci prin carjbonul sàu 5. Aci-
dul ,riiboti,midilic (T) esúe de asemenea o riibonucleotidà neorbiq-
nultà ce intrà în ARNú qi care este LegaÉ de convertirea ura-
cilului în timfurà în urma unei metilàri a uracilului la C 5. Mai
existà Ei o altà bazi'neorbi.qnuità în ARNú qi anume acidul d[-
hidrouridilic (Ui) sau DHU) în care uracilul poartà hidrogen
suplimentar la C 5 qi C 6. ln realitate dihidrouracilul nu este
o pirimidinà deoanece legàtura dintre C 5 gi C 6 nu este o
punte durblà ci, uina simplà. Nucleotidele neobiqniuite nu pot fi
introduse în pnecursorul ARNú în timpul transcrierii, prin nici
un mecanism de împer,echere de baz.e complementare. Ele apar
în urma modificàri,lor posttaranscriplionale a nucleoúidelor nor-
m,ale, deja prezente în pre-ARNú.
Prin plierea monocatenei rezultà rqgiuni dublu-catenare în
zonele ùr car,e ,bazele azatat'e se împenecheazà compl,ementar cu
formar,ea d,e punfi de hidrog'en. Din ara,nfamentul spatia,l al re-
giunilor bicatenare qi a1 r,egiunilor monocatenare rezultà o
structurà secundarà care este cunoscutà ca m,odelul frunzei
d'e trifoi (FiS. 30). Structura secundarà ,bidimensionalà po.ate
fi la rîndul ei supusà plierii sprc a da o str-ucturà terliarà tri-
dimerr.sion,alà caracteristicà de forma li'terei T (Fig. 30c).
În structura unor tipuri de ARNú inúrà gi inosina (I) mai
ales în secvenla antioodonului pen'tru codomii serinei (UCU),
leucinei (CUU), pr,olinei (CCC), argtrinei (CGC), izoleucinei
(AUA) ,etc., în care inozina (I) intrà în pozifia 3 antiparalelà
(deci pozilia L în citire dir,ectà). Neputfndu-se împereehea, ba-
zele metilate deiimiteazà regiuni'le bioatenare ale monocatenei.

67
I
.ogót'/ 3oH (b,
lr' ,6 daq:l9roa hollt al f ia&:rt
o ordmcrddu u c6o
èlu-brllul @e-
G\
g\ l9 ig'a
G É r, i, u i,rq,.!r
9c
ù bÈlo l,r'nr' irlCl
lg'
ln
Ir'
U i?!ota mitrf:.ftú!) hrt
"l'
'iG ru
{s
oHq.
G2o
ù
hU

.€m A
UA
6mA
àl
lc)

Fíg. 30. Structura ARNI. (a). Secvenfa celor 76 nucleotide din macromolecula
de ARNI pentru alauinà de la drojdie prezentatà în modelul birlirnensional al
fnrnzei de trifoi. Se indicà cele patîu bucle majore incluzînd gi bucla anticodonului
ca.re are secve[ta A-A-A gi care se pottivette prin complementaritate cod,onu-
lui din ARNz fenilalaninà U-U-U. Bazele încercuite cu linii continui ocupà
în toate moleculele de ARN care au fost analizate pînà in prezent.
aceleagi prclzílii
Bazele încercuite cu linii înherupte sînt .ìiferite la alte tipuri de ARNf. Numero-
tarea bazelor începe de la capótu1 5'. Nucleotidele aeobignuite gàsite la ARNú
sÎnt: lU: DihU: dihid.rouridina, Y:pseudouridina, mx : nucleotide metilate
ti î - timina (un uracil metilat în pozifia 5 în inelul pirimidinic). (b). Diagra-
ma schematicà care indicó maniera în care ARNtFtea poate fi ràsucit spre a pro-
duce unele dintte relafiile fizice observate între diferitele pàrfi ale moleculei. Li-
niile subîiri indicà punfile de hid.rogen ce apar între baze în cadrul structurii
tertiare pliate. (c). O reprezentare trid.imensionalà a ARNú redatà dupó studii
de difracfie în raze X.

Descifrarea secvenlei de baze din structura primarà monoca-


tenarà a ARNú pen,tru alaninà la drojdie precum qi a structurii
I
sale secundare c€nfiguraîia spatialà cu negiuni monoca,tenare
qi bicatenare - au permis lui HolLey $i colaboratorilor sài sà
-
68
elab,oreze modelul frunzei de trifoi pentru aceastà configuralie
spafialà eare s-a dovedi,t a fi valalbil pentru úoate tipurile de
ARNú. Pentru aceastà realizare Holley a fost distins cu pre-
miul Nobel. Folosind datele de secvenfiere a ARNú pentuu ala..
ninà extras de La drojdie, Khorana qi colaib. au nealizat pe cale
chimicà, prima sintezà a unei ,gene, gena care dirijeaza sinteza
ARNú pentru alaninà.
ARNf se sintetizeazà pe maúri!à de ADN prin intervenlia
ARN-polimqoaei qi apare mai îrntîi ca moleculà pr,ecursoare
care, dupà transcriere, este supusà prnlucràrilor posttranscrip-
fionale. Moleculele precursoare la ARNú ca Ei la ARNnz pre-
zintà la capàtul 5' o secven!à suplimentarà numità secvenla
conducàtoare sau din cap (leader) iar la capàtul 3' altà sec-
verr!à suplimentarà numità secven{a din coadà (troiler). De
as€rnenea, precunsorul ARNú pnezintà secvenfe interpuse in
cadnul secvenlei care va constitui seeventa ARNú matu'r func-
fional. Printre prelucrarile posttranscripfionale unele deùerminà
excizia unor nucleotide din pre-ARNú sub acfiunea' enzimei
RN-aeò P (P de la precursoare) pe cînd ,altele determinà adi{ia
la capàtul 3' al monocatenei a-secvenlei 5' NìCf A 3', impli-
catà în aminoacilarea ARNú. Implicarca secven!,ei CCA în ami-
noacilarea ARNú (atagarrea aminoacidului activat vezi sin-
-
teza proteinieà) a fost dovedità în experienle de îndepàrtare a
acesteia folosind fosfodiestntaza, din venin de qarpe care aclio-
neazà numai asupra acestui capàt monocatenar ,al moleculei
ARNú. ARNú lipsit de secvenla CCA de Ia capàtul 3' pierde
capacitatea de a accepta aminoacizi. Capacitatea acceptoare
pierdu,tà a unui ARNú tratat cu fosfodiesterazà poate fi redo-
bîndità dacà acest ARNf deficient este pus lntr-un amestec de
reacfie care confine o enzimó specialà (terminaltransferaza) ce
are capacitatea de a ,adàuga nucl,eotide terminaie fàrà a ne-
curge la împerecherea complementarà de baze cu o matri!à
polinucleotidicà qi substraturile sale CTP qi ATP. Alte pre-
lucràri posttranscriplionale sînt cele care realizeazà modifi-
carea chimicà a unora dintre nucleotidele ràmase. Printre mo-
dificàrile ehimice mai importante sînt metilarea gi formarea
pseudouridinei.
Modificàrile chimice ale nucleotidelor obiEnuite (incluse în
ca,ùena pre-ARNú în timpul transcrierii sale de pe matrila ADN)
care due la convertirea lor în nucleotide neobiEnuite sînt cata-
liza,te de enzime speciale existente atît Ia procariote cît gi 1a
eucariote. O astfel de enzimà convertegte grupul NHz de pe
carbonul 2 al acidului adenilic din pre-ARNú în grupul OH

69
F
creind astfel un rest inozinà la un.ele situri ale catenei pre-
ARNú. Atrt€ enzime transferà grupul nretil (enzimele se numesc
în cqnsecinfa metilaz,e) la hipoxantinà, guaninà sau uracil din
pre-ARNú spne a da I*, G', G- sau T. În sfîrqit, alte enzime
rearanjeazà legàturile dintre inelutr pirimldinic qi ri,bozà spne a
converti uracilul în pseudouracil sau spre a hidrogena inelul,
convertind uracilul în dihidrouridinà. Asemenea prelucràri
posttranscripfionale au putut fi sfirdiate Î,n cazul microinfec-
liei nucleului de drojdie de ,bere în ovocita de broascà.
Prelucràrile posttranscriplionale implicà în cazul precurso-
rului ARNú (pre-ARNú) pentru tirozinà de la drojdie, elimi-
n:rrea secvemfelor inrùerpuse din pre-ARNf (descrisà prirna datà
de càtr.e Goodmatr Ei colarboratorii în 1977), excizia secvenlelor
suplimentarè 5' Leader $i 3' trailer, adàugarea secventei CCA
la capàtul 3'. Toate aceste prelucràri au loc în nucleu. Tot în
nucleu mai sînt modificate, în cazul ARNú pentru tirozinà de la
droidi,e sintetizat în ovocite de broascà microinjectate cu nu-
cleu .de drojdie, cel pulin Sapte ribonucleotide înain,te ca ARNú
sà fie transportat din nucleu în citoplasmà (Melton Ei colab.,
1980). Aoeste modificàri ce duc la formarea în pre-ARNú a 5
metil-citozinei (m5C), 1, metil-adenozina (-lA), pseudouridi-
na (rÍ) 9i dihidrouridina (DHU) apar în nucleu. O singurà mo-
dificare apare în ciúoplasmà qi anume a guaninei. S-a constatat
cà modificàril'e apar într-o ordin'e pnecisà, strictà, cane 3e core-
leazà cu schimbàrile din dimensiunea precurff)rului ARNú de-
terrninate de eliminarea secvenlelor leoder qi trailer. Astfel, de
înd,atà ce secvenf"a leader este eliminatà Ei este adàugat 3'CCA,
U din regiunea antioodonului este modificat în pseudouri-
dinà (tY).
Determinarea secvenfei ADN corespunzînd Ia 4 din cele B
gene ARNú pentru tirozinà (ú ADNúyr) de la SacchmwnVces
cereuisiae a condus l,a consta,tarea cà aceste gene ARNú pentru
tirozinà conlin o secven!à interpusà de 14 baz'e adiacente anti-
codonului car'e nu este prezentà în ARNú rnatur qi deci ea este
eiiminatà în cadrul prelucràrilor p'osttranscripfionale.
Maturarea precursorilor ARNú diviza'tà în mod oonvenlional
în douà proc€se separate reduoerea dimensiunii Ei modifi-
carea de ibaze reprezintà u,n- proces unic, càci cele douà aspeote
sînt inúim legate, desfàqur,flndu-se conoentr,an't. Succresilrnea
ordonatà a etapelor de prelucrare posttranscripfionalà a ARN
în general qi a ARNf în'special, sugereazà cà enzimele de ma-
^uurafie care condilioneazà transformanea pre-ARN îrr ARN ma-
tur au capacitatea, unele de a recunoaqte precursori cu sec-
70
venF 5' leadq, iar aitele de a recunoaqte gi accepta ca suíb-
strat pre.ARN fàrà aceastà secventà 5' leader. Este posib,ii ca
în aoeas'tà capaciúaùe de recunoaqtere sà joaoe un €utumit rol
qi secvenfele interpuse. Ar trelbui sà fie un numàr de cel pulin
61 tipuri de A-RNÚ care sà traducà mesajul genetic (vezi eodul
genetic) qi care ar corespunde celor 61 aodoni sens din ARNrn.
Ta E. coli sînt 30-40 tipuri diferite de ARNú specificagi de
gene limitat redundante. La eucariote, genele pentru ARNf
sînt înralú redundante.
Teoretic ,ar trebui sà fi,e un numàr de 64 tipuri diferite de
ARNf care sà traducà m,esajul genetic (vezi codul genetic). Au
fost izolate în stare purà aproape toate tipurile de ARNú, iar
la pesùe 20 dintre ele a fost stabilità secvenla de nucleotide a
monocatenei (structura primarà). Genele pentru ARNf ca gi
c,ele ribozomale sînt prezente atît Ia procariote cît gi ia euca-
rioúe în copii multiple (40-80 la procariote, 32A-14A0 la eu-
cariote), în unele cazuri fiind distribuite grupat în genom for-
mînd aqa-numitii clasteri. Fieca,re aminoacid are cel pulin un
ARNú specific care intervine în activarea sa în cadrul biosin-
tnrei protcinice. Uneori, acelagi aminoacid poate fi activat de
douà tipuri, diferite de ARNú care s-au numit ARNf isooccep-
úori. Specificarea unui aceluiaqi ,amfuroacid de douà tipuri de
ARNú ar fi o màsurà elaboratà în cursul evoluliei de a asigura
realizarea biosintnzei proteinice în condifiile în care ]a nivelul
unuia dintre ARNú isoaccepùori s-a manifestat felomenul mu-
tagen.
Fiecare moleeulà de ARNú prezintà rogiuni specifice de in-
teracfiune cu alte molecule, negiuni, în care nu apar împe-
recheri de ,baze prezentîndu-se ca bucle Ia nivelul càrora ba-
zele sînt expuse avînd posibili,ùatea interacliunii cu alte ele-
mente. Astfel, secvenfa CCA de la capàtul 3' al moleculei
ARNú este implicatà în ataEarea aminoacidului corespun zàtor
la molecula ARNf, h vederea transportului sàu. Fiind aceeaqi
la toate moleculele ARNú, secvenfa CCA nu este implicatà în
specificitatea a,taEàrii aminoacidului la ARNú.
Molecula ARNú prezintà însà o regiune care conferà speci-
ficitate ARNú prin care acresta r,ecunoatte în mod specific un
aminoacid dat. Aceastà regiune es.te variabilà la diferitele
tipuri de ARNú. De asemenea, molecul'a ARNf mai prezintà o
regiune de recunoaqtere a ri'bozomului reprezentatà de prima
buclà din modelul frunzei de trifoi, alcàtuità din 7 baze ne-
împerecheaúe, numità bucla TìI'C, precum qi o rcgiune de re-
cunoaqtere a codonului din ARNm, regiune care s-a numit

7l
F

anticodon sau nodoc (opusul lui codon) qi car,e este formatà,


ca gi eodonul din ,trei bazp, ,azotate (tripleta). Ea se aflà în
'bucla antioodonului. Regiunea anticodonului este specificà fie-
càrui tip de ARNú gi ea courdifioneazà recunoagterea cprectà a
codonului din ARNrz cotrespunzàtor aminoacidului purtat de
ARNf gi- care este specificat (codificat) de càtre oodonul din
ARNm. Între prima buclà qi bucla anticodonului se aflà o
buclà micà numità ,,ciot6'.
Recunoas.terea codonului de càtre antioodon se bazeazà pe
principiul complementaritàlii bazelor azotate de tip (A U A
L23 -
codon U A U anticodon; C G A codon G C U antico-
- 321 12 3 - 321 -
don etc.) care se asociazà tempor,ar prin formarea unor punfi
d,e- hidrogen. Codonul qi anticodonul sînt ,orientate antipar,alel
(5'-t3' codonul, 3'+5' anticodonul).
Împer,echerea corectà codom-anticodon condilioneazà plasa-
r.saîn catena polipeptidicà oe se sintetizeazà. ,a unui aminoacid
dat Ia l,ocul corespunzàtor, sintetizîndu-se astfel o proteinà nor-
malà structural qi funcfional.
Dar, potrívit ipotezei oscilàrii (u:obble) elarboratà de Crick
în 1960, une'ori un flntlpit tip de ARNf are capacitateoa de a
recunoaqte prin ,anticodonul sàu mai mul{i codoni (triplete)
care însà se deos,ebesc doar prin cea de-a treia 'bazà,. însearnnà
cà in cad'rul internelafiei codòn-anticodon, esenfialà în d,escifra-
r,ea, decodificarea (traducerea) mesajului genetic transcris în
ARNrn, primele douà perechi de baze prezintà o mai mare spe-
cificitate a împerecherii pe cînd c,ea de a treia capàtà caracter
oscilant. Astfel U aflat în conformitate cu antiparalelismui
imperecheril,or cle ,baze pe primul loc în secvenfa anticodonu-
iui (altfel, ea ocupà tot locul trei în acesta dacà consideràm
orientarea generalà de la stînga l,a dreapta) poate sà se împe-
recheze cu A dar Ei cu G afiate în codonul ARNrn ca cea de
a treia'bazà.
Tot astfel G din antioodon poate recunoaqte, în aceleaqi
condifii tipologice atît C cît qi u, iar hipoxantina poate recu-
noaEte u, c si A aflate în pozilia a tr,eia în codon. Nu acelagi
lucru este pentru C qi A a,flaúe în pozifia ulrtimà (considerînd
sensul gen,eral stînga+dreapta) în an,ticodon. Acesùea nu pot
recunoa$te qi nu se împereoheazà decît cu bazele oomplemen-
tare conespunzàtoare a,flate în a treia pzí\ie în codon qi anum,e
GqiU.
72
Cea de a patra buclà din modelul frunzei de trifoi conline
6-12 tbaze neîmperecheate. Ea s-a numit bucla dihidrouraci-
lului, fiind implicatà în legarea ARNú la o,minmrilsintetozd,
enzimà activatoare specificà pentru fiecar,e amimoacid.
Inifierea tuturor catenelor polipepti'dice (tradueerii mesa-
jului genetic) se realiznazí, prin intervenfia aq€Fnumitului
ARNú i,nifiator. Aoesta este ARNú ce transferà N-formilm'etio-
nina (ARN/M"') l,a ,bacterii, virusuri, mitocondrii qi cloroplasùe
qi ARNú ce transferà metionina (ARNtue\ la eucariote.
Func{ia ARNú este în esen!à legatà de decodificarea mesa-
jutui genetic. Dar ARNú mai poate juca rol qi în alte procese
celulare, mai ales la baeterii cum ar fi negl,area activitàlii ge-
nelor (operoni) care dirijeazà sinteza unor aminoacizi, transpor-
tul unor aminoagizi necesari formàrii punlilor interpeptidice
din perelii celulari ai bacteriilor, sin'teza am.inoacilfosfatidilgli-
cerolului, adilia terminalà a resturiior aminoacizi la protei-
ne etc.
În cazul în care Eenel,e pentru ARNú suferà mutatie se sin-
tetiz.eazà ARNú la care este alteratà specificitatea de recu-
noaqùere de càtre ,antioodon a codonului corespunzàtor datorità
modificàrilor ce apar în bucla antic,odonului sau adiacent eÍ.. IJn
asemenea ARNú va putea sà recunoascà codoni rLonsens sau
missens, care condilione'azà fie terminarea la'nfului polipepti-
dic în primul caz, fie încluderea în lanful polipeptidic a unui
aminoacid necor,espunzàtor datorità modificàrii prin substitufie
a secvenlei de bazà în cel de-al doilea caz.
ARN nuclear heúerogen gi ARN crornozomnl.
La eucariote se mai descriu qi alte d,ouà tipuri de ARN
celular. Esúe vorba de ARN nuclear heterog'sn Ei ARN cro-
mozsmnl.
6. ARN nuclear heterogen (ARNhn) reprezintà o clasà de
molecule ARN cu greutate molecularà variarbilà într,e 105 qi
2 X tÙz daltoni cu dur,ata de via!à scurtà (5-10 minute) fiind
instabil. metabolic. ARNhn repî'ezintà cca 3olo din totalul ARN
oelul'ar. Fiiurd sintetizat pe matrila ADN are o compozifie de
ibaze eomplernentarà ADN. Are un con{inut G + C de cca
4A-450/o cu mult mai mic decît cel aI ARNr care este de cca
700/0. Est€ localizat î:r afara nucleolului.
Din ARNhn derivà, în urma prelucràrilor posttranscripfio-
nal,e ARNzn, din care cauzà, ARNhz s-a mai numit ARN pre-
rnesager sau pre-ARNrn. Partea din ARNhn care nu nepnezintà
ARNnz este transcrisà de pe ADN care prezfurtà secvenle re-
pertate de nucleotide qi care se pare cà sînt implicate în me-

73
7
canisme de reglare. Aceastà parte a ARNhn poate prezenúa o
conformafi,e caracùeristicà sub formà de ac de pàr numità struc-
turà lwirpin qi care se formeazà prin împerecheri intracatenane
de baze complemerrtare.
7. ARN crarLozatnol (ARNc). Este un tip de ARN comple-
mentar unor secvenfe specifice din ADN cromozomal al euca-
riotelor. O parte din acest ARNc reprezintà molecule precur-
soare ale ARNzn, ARNr, gi ARNú. ARN crorìoZohd, pe de altà
parte se cr,ede cà reprezintà o categorie de ARN celular legatà
de interacliunea ADN-proteine càreia îi conferà specificitate
de secven!à, acest tip d'e ARN legîndu-se covalent I'a proteinele
cfomozomale histone.
Greutatea molecularà a ARNc ,este mai micà decît c€a a
ARNú càci cuprinde doar 30 pînà La 50 rrucleotide. Confine pînà
la 270/o dihidrour,acil. Nu se $tie încà dacà ARNc este într-ade-
vàr un tip aparte de ARN celular sau repr,ezintà un produs de
degr,adare a ARNhn. Sînt date dupà care ARNc intervine
în,tr-un mod specific în reglarea activitàtii genice la eucariote,
avînd efect derepresor asupra geurelor represate prin comple-
xar,ea ADN cu hisúonele.
B. ARN airol. La unii fagi oa Ei la unele virusuri vegetale Ei
animaie miezul de acid nucleic este reprezentat de ARN, PUt-
tàtor în aoest oaz de informafie geneticà primarà din cane cauzi
se mai numeqte Ei ARN geneti,c. ARN uiral poate fi mon,oca-
tenar (bacteriof,agii Fz $i R17, virusul moz,eicului tutunului, vi-
rusul gripal qi polio). Reovirusurile au ARN 'bicatenar. Mole-
culele ARN sînt liniare, niciodatà circulare.
ARN airal îndeplineqte atît rol de matrifà pentru replicarea
sa în veder,ea multiplicàrii panticulelor viraie cît qi rol de ARN
rnesryer pentru sinrteza de proteine virale specifice. Genomul
viral ARN îndeplineEte deci o funclie dublà, gen'omul qi tran-
scriptul fiind într-un anume sens unul qi acelagi lucru gi
aceeaqi enzimà numità replimzd, sau tronscriptazd,, de fapt o
ARN polimerazà servind atît funcfia de replioare cît Ei func-
lia de transcriere.
Cel mai bine studiat este ARN al fagilor QP $i R17 la care
s-a realizat secvenflenea nucleotidelor în cea rnai mane pa,rte.
Astfel cromozomul fa,gului R17 alcà,tuit dintr-o monocatemà ARN
conline cca 3510 mucleotide, purdînd informafia pentru sinrteza
a 3 proteine Ei ràmînînd încà 580 nucleotide, primele 100 uru-
cleotide de la oapàtttl 5' nefiind niciodatà traduse în pr"oteinà
ca dealtfel nici cele 50 nucleotide oare pneced capàtul 3'. Ca-
pàtul 3' al catenei confine secvenrta 5' . . . CCA CCCA-3' qi se

74
PPP G PPP G:C G PPP

A A:U A,

U U:A U

c =G L
nrptirazi
^
"
REPL'T A2 A
pr,"r",;;;;i 6=C .+[,
(a tena -naîrtlà)
U t+t U:A (-) u

A A A

A, A--U A

c c =G C

AoH
,OHV. A ::U:. 5
A
^l
J
\----w.-J
' ARN progen
RF

Fig. 31. Replicarea ARN viral. RF - forma, replicativA


dublu-catenaró.

admiùe cà aceastà secven!à este recunoscutà specific de càtre


enzima replicazà. Pe parcursul secventei ARN apar posi'bilitàîi
de împerecheri complementare intnacatenare cu formare de
structuri buclate de tip hairgnn, structuri impliaate în confe-
rirea de stabilitate monocateil]ei ARN în timpul infecfiei, în
împacheúarea sa într-o formà mai c€mpactà în capsida fagicà.
În vederea sintezei proteinelor virale moleculele de ARN
viral,, acfi'onînd ca ARNnz se ataqeazà, la rirbozomii celulei gazdà
formînd poliri'bozomi.
Im,ediaú dupà injectarea ABN viral în celula gazdà Ei lega-
rea sa de riib,ozomii celulei gazdà este sintehzatà ,e!ìzima ARN
sinfu,tazd (ARN-re plicozd) care catalizeazi formarea unei c:a-
tene complem,entare nealizînd astfel replicarea ARN viral
(Fig. 31). Dacà se considerà oatena inifial'à, care pàtrunde în
celula gazdei drept ca;tena ,,*tt ea se,rye$te ca matri!à pentru
sinteza caùenei complernentare ,-u pe principiutr împerecherii
de baze complementare cu formarea de punfi cle hidrogen, rea-
lizîndu-se pemtru un anumit timp o structurà bicatenarà ARN
numità tormd replicatiud, (Rtr'). Au loc a,poi multe runde de
replicare ale formei replicative bioaúenare. Unele din catenele
+ nou sinúetizate acfioneazà ca ARNnr dictînd sinteza de
replicazà qi pr'oúeine ale capsidei. Alte oatene f , dar nu este
exclus ca Ei unele din acelea cìare au participat la sinteza pro-

75
Fig. 32. Dogma centralA revizuità
a biologiei moleculare. Diagrama
redà relaliile de transfer de infor-
mafie dintre mecromoleculele in-
formafionale: liniile gtoase - re-
latii dovetlite pînA ln prezent;
linia subfire continuà - lagganis-
mul special de transfet de infor-
maJie de la ARN la ADN (re-
verstranscriete) care are loc in
celulele infectate cu oncovirusuri ;
liniile întrerupte - transfer de
informafie nedovedit pînà îu pre-
zent.

teinicà, devin împachetaúe în capsida proteinicà a noilor par-


ticule fagice, corrrstituind cromozomul viral.
Iatà deci cà avem aici de-a faoe cu o dualitate în care
aoeeaqi rnoleculà de ARN viral poate funcliona atît ca mate-
ri,al genetic cît qi ca ARNm.
9. Reuerstmnscrierea. Pînà acum ,aîn analizat tnansferul
informaliei genetice de la ADN la ADN in procesul replicàrii
ADN de l,a ADN la ARN în procesul transcrierii gi de Ia ARN
la ARN în replicarea ARN viral.
Pînà în anul 7970 a dàinuit ideea, cristalizatà în a{a-numita
dogmrt 'a biologiei mpleculare (Fi'S. 32), potrivit càreia transmi-
terea informafi,ei ereditare se f,ace unidirecfional în sensul
ADN--*ARN-+proteine. În anul 7970 Temin gi Mizutani pe de
o parte gi Baltimore pe de alta au descris o ADN polim,erozd
dependentà de ARN izolatà din uirionii virusurilor onoogene
ARN (ri,bovirusuri oncpgìene din farnilia Retrouirifue) Si din
celule infectate cu asem€n€,ar virusuri ca gi din celule transfor-
matre malirgn. Aceastà enzimà ar€ capacitatea de a transcrie
ARN natural sau sintetic qi de a sintetiza astfel, folosind ca
matri!à ARN, o c€pie oomple'mentarà ADNc. Este deci o
violare a dogmei centra,le a biologiei moleculare càci în acest
caz ernzima ADN-polimerazd,, dependentà de ARN, condifio-
neazà transferul informaliei genetice de Ia ARN l,a ADN. Din
aceastà oauzà a fost numità inuertazd, reuertazd sau reuers-
transcriptazd i,ar procesul sintezei unei oopii ADN pe ma'trità
ARN s-a numit inverstranscriene sau rwqstranscriere.
Reverstranscriptaza folosegte ca substrat dezoxiribonucleo-
tid-trifosfafi, este depende,ntà de o matrifà ARN Si pentru
reacfia de polimenzarc ureoesità un ARN gnim,er cu rol de a
inifia sinteza catsnei ADN la oare se leagà printr-o legàturà

76
covalentà fosfodiesúericà. De as€imenea enzima necesiúà pentru
r'e'acfia neverstranscrierii ioni bivatlenfi de Mg qi Mn. Drpà
adàr,rgarea primului dezoxiribonucl'eotÍd la gfupul 3'JH al
primerului ARN, reacfi,a de reverstr,anseriere se desfàgoarà prin
adàugarea succesivà de dezoxiriboqlucleortide, oane se împe-
r'echeaaà cu 'bazele comple'rnentare din matrila ARN, între
dezoxiribonucl'eotide statbilindu-se legàhrri oovalente fosfodi-
esterice. Monocatena ADN astfel sinúetizatà, copie a matrilei
AFIN, formerazà cu aceasta,, prin interm,ediul punlilor de hidro-
gen dintre bazele oomplemenùare o structurà tbicaúenarà hi,bridà
ARN-ADN, Intervime se parre o ribonucleozd. H care hidroli-
zeazà. ARN dirrr hilbrid astfel, ca mourocatena ADN poate servi
ca matri{à pentru sinùeza unei catene complem'entare. Rezultà
un ADN bicaúenar purtàtor de informalie geneticà viralà qi
carìe se poate inf,egna în oromozomrul. oerlrulei gazdà sub fonn,a
a oeea ce a fost numit prwirus. Fàrà a duce la \in oelulei
infectaúe, pB oalea reverstranscrierii, celula gazdà este însà
transformatà malign. La un momeurt dat, sub influenfa dife-
ritilor faotori mutageni, fizici, chimici sau rbio,logici (infectia cu
{rn alt virus) provirusul ADN se desprinde din cromozomul
gazdé qi poate transcrie molecule de ARN viral, asi'gurind ast-
fel multiplícarea virusului oncogen.
ADN proviral se integreazi în cromozomul gazdà în regiuni,
om,oloage, inùegrarea fiind oondifionatà de o enzimà numità
integrazd. pe cînd în excizia sa pe lîngà inúegr,azà intervine qi
o erciào,nazd. In'tegrarea gi excizia ADN pr,oviral sînt în esmrfà
fenomene reoombinatorii de tip rupere-reunire (vezi recombi-
narea geneticà).
Virusurile oncogene prezihtà un genom repreuen'tat de ARN
rnonocatenar avînd o constantà de sedimentare de 78 S, care
cuprinde patru gene simbolizatn g@g, onc, i.rw qi poZ.
Gena gog specificà proteineLe virale interure avînd ca pro-
dus primar o proteinà cu masa molecularà de 76 000 dalúoni.
Gena otzc specificà o proùeinà implicatà în inducerea tramsfor-
màrii maligne a celulelor în creqtere. Gena inu esbe legatà de
sinteza glicoproúein'ei de la suprafala înveliqului virio.nului, iar
gena pol specificà sinteza inve'rstnanscriptaa,ei (reverstranscrip-
taz'ei).
În 1969, Huebner gi Todaro au elaborat ipoteza oncogenei,
potrivit càreia toate celulele contin în ADN o uirogend, adicà
,o genà oare oonfime informafia geureticà a urnui virus incluzînd
qi ,aceea pentru transformarea malignà a celulei gazdà, adicà

77
oncog€na. Virogena este replicaità qi transmisà odatà cu ADN
gazdà dsa lun€ul generafiilor celulare. În mod normal oelula
a elaborat mecarrisme de represi,e a virogenei. Cînd mecanismul
de represie este alterat virogena se exprimà qi duce prin acti-
vitate'a onoogenei la transformarea malignà a celulei. Altera-
nea meoanismului de represie apare în urma ac{iunii diferililor
agenti fizici, chirrici sau biologici.
Desi'gur virusurile onoogene pot fi ribovirusuri (ARN) sau
dezoxiriibovirusuri (virusuri ADN). Reverstranscrierea este î'nsà
specificà ribovir'usurilor oncogsne.
Capitolul III
ORGANIZAREA MATEEIALT]LI]I MH}ITAR

Sisùemel,e biologice cuprind douà tipuri fundamentale de


organizare Ei e,nume orgonizorea ui,w'ld qi orgm,iznrea celulord,.
La rîndul sàu orgamizarea celularà cuprinde douà tipr:ri diver-
genùe de ,organizare: organizarea procariotà Ei organiza,rrea eu-
cariotà, precum qi un tip intermediar, organizarea ntezwriotd
(Gavrilà, 1978).

1. ORGANIZAREA VIBALA

Asupra concepttrlui de virus a fost etraborat neoent un ex-


celent studiu critic (7nrnea, Ei Herlea, 1974).
Statutul particular af sisternului viral poate fi desprins
de expresia aforisticà a lui Lwoff care în 1957 afirmà cà
,,virusurile pot fi oonsiderate ca virusuri, din cauzà cà viru-
surile sînt virusurir(. Virusurile se caracùeriznavÀ prin existenta
în structur'a lor a unui singur tip de acid nucleic (fie ADN,
fie ARN, niciodatà ambele tipuri d,e acid nucleic). Virusurile
nu cresc, DU se divid qi nu posedà aparat enzimatic pentru
produoere de energie. Prin aceasta virusurile se deosebese esen-
fial de toate celelalte sisteme bioLogice existente actual-
mente în natura. Dar virusurile pot fi oonsider,aúe toúuqi sis-
teme biologice prin faptul cà ele pr'ezintà caracterlstici struc-
tunale qi dimensiunri cpnstanùe, pot suferi rnutafii qi recomibi-
nane geneticà qi pr'eziurtà o ontogenezà, precisà în care pe seama
materialului biologic ail celulei gadà, materialul lor genetie
dirijeazà formarea noilor particule vira,le, asigurînd astfel per-
petuarea lor.
Viruzurile au orgranizare acelularà. Particul,a viralà com-

79
pletà numità oirion sau virusul infeclios matur reprezintà o
unÍta,te de structurà qi funcfie atcàtuit dintr-un îmveliE protei-
nic capsida $i un miez de acid nucl,eic. Miezul de acid nu-
cleic- este reprezentelt de ADN la d.ezoúriboairusuri qi de ARN
I'a ribatirusuri. Acizii nucleici virali nu sînt asociafl cu pr,oteine
cu exceptia unor cazuri îur care se descrie exisùenfa în interio-
rul capsidei a unei proùeine implieatà în împachetarea (supra-
spiralizarea) acidului nucleic viral obligat sà fie cantonat
într-un spa{iu foarte restrîns. Alte tipuri de proteine virale
,,interne( au rol enzimatic (replieaza sau reaerstrans*i.pfuza
de exemplu).
Miezul de ,acid nucleic viraù. se mai numegte crarnozo'm ui-
rol. Virusurile sînt par,azilt obligali de nivel gearetic, deoarece
virusurile, nu se reproduc de sine stàtàtor, ci ele se reproduc
pe searna componentelor oelulei ,gazdà dupà planurile anhitec-
turale furscrise în informa{ia ereditarà viralà depozitatà în
miezul de acid nueleic ADN sau ARN.
Datoriúà acestui fapt marea majoritate a virusurilor rnani-
festà o înaltà qi striotà specificitate de gazdà: un virus oe in-
fecteazà Eseherichia coli bunàoarà, în mod normal nu va pu-
tea infecùa o al.úà specie de bacterie, ba mai mul.t prezintà pre-
ferfur,!à pmrtru o ,anumità tulpinà de E. eoli. O singurà exoepfie
se impune a fi amintità. Este vonba de virusul PIV? care in-
fecteazà peste 40 de specii, diferiúe de planrte Ei chiar o insectà.
În afarà de virion, virusul se mai poate afla sub formà de
vinus vegeú,artiv crorespunzînd eromozomului viral aflat liber în
citoplasma celulei gazdà în ,timpul mul'tiplicàrii sale sau sub
formà de provirus cînd este integr,at în eromozomul gazdà. în
cazul dezoxiri,bovirusurilor, ADN poate fi dublu-catenar (li-
niar sau circulan), sau monocatenar, circular. Acesta din urmà
devine dublu-catenar în timput nepticàrii.
La ri'bovirusuri precum ,ba,c,teriofagii 8p, Rn pi fz, VMT,
unele vimsuri 'animal,e (influ'enza gi alt poliomelit€i) ARN este
monocatenar qi devine dublu-c,atenar în timpul replicàrii. Reo-
virusul are un ARN duiblu-oatenar chiar atr:nci cînd es,te în
stare de virion. virusurile planúelor au în gener,al un ARN
duiblu-c'atenar. La reovirus qi alte virusuri animale genomul
viral este segmeùltat adicà ARN esúe rreprez*ntafi prin mai multe
piese de z4,R.fú bicaúenar. Genomul ARN al virusului gripal ,este
disc,onúiuruu. El este monocaùenar si format din g fr,agmente
avînd o greutaúe molecularà cuprinsà ùrtre 105 gi 106 dalúoni
realizînd o m,asà molecularà de 5,5 X 106 dalùoni.

80
Virusurile gripale, paragripale qi rabdovirusurile se numesc
virusuri cu catenà negativà deoarece ARN-ul lor nu are funclie
mesagerà, $i pàtrunzînd în oelula gazdà,, nu poate induce sin-
teza proteinelor virale specifice, din asemenea virusuri nepu-
tîndu-se extnage ARN viral infectant. În particulele virale ale
acestor virusuri existà enzima transcri,ptazd care asigurà tran-
scrierea unei catene ,,*tt pe catena inilialà ,,-sc. Transcrierea
qi replicarea ar putea fi reaLizatà de aceeagi enzimà ARN
trarrscriptazà,, sau enzima de transcriere este modifica,tà prin
adilia unei proteine din celula gazdà astfel cà ea d,evine o
replicazà.
Dimensiunea genomului viral variazà între 3000 nucieotide
qi peste 10 000 nucleotide, codificînd între 3 Ei 10 proteine cu o
secvenfà de cca 140-160 arnin,oacizi. Bacteriof,agii ARN repre-
zinti unele dintre cele mai mici virusuri avînd cca 3300 nu-
cleotide care cor,espund la 3 gene priurcipale, douà specificînd
proteine structurale al'e virusului iar a tr,eia specificînd ARN-
sintetaza.
Adenovirusurile mai mici prezintà o macromol,eculà d,e ADN
sub formà circularà atît la nivelul virionului cît gi în forma
sa replicativà, pe cînd în cele mari, la nivelul virionului, ADN
se prezintà ca o moleculà filamentoasà lungà de 6 pm Ia fagul
qzg ee infecteazà bacteri,a Bacillus su,btilis gi de 47-52 pm la
fagii de tip Tz $i Ta ai bacteriei E. coli. Virusul variolei aviare
are o moleculà de ADN lu,ngà de 93 pm.
*FÀglI
l. al bacteriei E. coli ,ar,€ o moleculà de ADN lungà
de 16 pm qi care prezintà la oapete prelungiri monocatenare
din care cauzà aceste ca,pete sînt ,,lipicioase6r sau ,,adezivea,
adicà au secvenfe oomplementare pe seama càrora molecula
bioaúenrarà linianà de ADN se circuLanzeazi in aitro ca qi în
timpul cînd se aflà în celula b,acterianà.
$i fag'ii Tz, Ta, Te $i T7 pr,ezintà secvenle terminale repe-
tate în moleculele limiare dublu-caten'are de ADN dar ele se
aflà la n,ivelul unor regiuni dublu-catenare, neputîndu-se rea-
liza circularizarea.
Forma circularà protejeazà macromol,ecula ADN de atacul
exonucleazelor.
De regula însà la nivelul ADN viraù nu se aflà secvente
repetate de baze.
Se cronstatà cà virusurile car,e au acid nucleic reprezentat
de o moleculà monocatenarà în virioar aceasta devine dublu-
catenarà în timpul replicàrii. Monocatena reprezintà rnesagerul
Ia fagi pnecum QF qi f2 oar€, patrunzînd în celula gazdà poate fi

$ - Descifrtnd tainele ereditàfii, vol. I 81


7

direet tradusà de maqinària de sinte'zà proúeinicà a celulei


gazdà. În aL,te cazuri, caúena caÌre pàtrunde reprezintà comple-
mentul mesajului, aqa cum este cazul lui p X 174. În aoest @2,
neplicarea rnonocaùenei este primul eveniment qi numai dupà
aceasta aparatul genetic este disponibil pentru tra,nssriere.
În ,eoncluzie se po,ate spune cà informafia geneticà a viru-
surilor se aflà codificaúà în cnomozornul viral care este nepre-
zentat fie de ,q,,DN, fie de ARN gi care se aflà sub formà de
m'olecule liniare sau circul,ane rbicatenare saru monocatenare.
Moleculele monocatenare d,e ADN sau de A.R,N ,capàtà în tim-
pul replicàrii formà bicatenarà, reprezentînd inúermediari r,e-
plicativi sau forme replicative.

2. OBGANIZAREA CELULABA

Toate sistemele biologice cu excepfia virusurilor pnezin'ta


organizarre celularà. Organizarea celularà a nepnezentat o etapà
esenfialà în organizarea qi evolufia ma'teriei vii care a oferit
enorme posibilitàti qi perspective evolutive. Deosebirea princi-
palà dintre virusuri Ei celule courstà în faptul cà niciod,atà o
particulà viralà nu va pute,a da naqtere direct la alte douà
particule virale prin diviziune. În cazul celulelor, oricît de
simple ar fi ele, chiar arflate la limita superioarà dimensio-
,nailà a particutreilor virale, cum sînt gi ricketiile,
multiplicarea presupune diviziunea'micr,oplasmele
unei celule preexistente
prin care nezultà douà celule fiice identice. La berza, multipli-
càrii celulare stà o finà coordona,re între replica'rea ADN qi
distribu{ia produqilor de replicare în celulele fiice prin inter-
verrfia unor mecanisme specializafre qi extrem de diversificate.
Toaúe celulele au de asemenea ambel,e tipuri de acizi nu-
cleici qi un sistem propriu de sintezà proteinicà.
În cadrul organizàrii celul,are se deose,besc douà tipuri oar-
dinale de onganiz,ar'e geneticà procariot gi eucariot qi un úip
intermediar mezocariot. -
-
2.1. ORGANIZAEEA PROCABIOTA

Aoest tip de orga,nizare car,acteriz,e,azà. bacteriile, actinomi-


cetele qi al'gele albastre-verzi ururnite incà cianobacterii, prezen-
tînd toàte atributele sisùemului biologic oelular, inclusiv auto-

82
r,eproduoerea si morfogeneza autonomà. Materialul ior ereditar
este reprezentat de o moleculà circularà dublu-catenarà de
ADN care se mai numeqte crom ozom bacterian. Cor,espondentul
m,orfologic a'l crorîozcmului circular bacterian este Àucleoidul
bacterian care prezintà la nivel ultrastructural ca Ei geuoforul
algelor alibastre-verzi fibrile fine de ADN care au un diam,etru
de 25 A lGavrilà qi Tàciurà, 1978).
Nucleoidul bacterian nu este separat fa!à de citoplasmà,
de càtr,e o structurà mem,branarà, astfel cà aoeste organisme
nu au un nucleu ,adevàrat. Materialul genetic nu esté închis
în,tr-un spafiu genertic definit, astfeL cà r,àporturile sale cu cito-
pl,asma sînt directe. La procariote relafia- ADN-cromozom este
de toúalà omologie. cromozomul bacterian cuprinde, urr set
complet de determinanli genetici (gene) ai tuturor caracterelor
unei celule bacteriene, pentru me,taibolism energetic, biosinteze
c'elulane, creqtere qi diviziune ca gi penúru regl'area activitàlilor
intracelulare. ADN bacúerian nu se asociazà de regulà cu
proteine tbazice histonice. Date recente indicà prezenla, la bac-
teria E. coli Ei ],a cianobacteriile Annbaena qi Aplwno&psa, aso-
ciate la ADN, a unor proteine 'bazice d'e tip hisùonà cu greu-
tate moleoularà micà de 10.000 dalto,ni. Structura supercpira-
liza;tà a ADN bacterian este menlinutà de càtre ARN.
Cnomozomul circular bacterian reprezintà suportul fizic al
unicului grup de înlàn{uire a genelor, toate genele bacteriene
fifurd úransmise în bloc la descemden{i. El reprezinrti cea mai
rDBr€ mol,eculà descrisà pînà în prezent în'tr-un sístem ibiologie
cuprinzînd un numàr de coa 2000-3000 de ,gene. Are un peri-
metru de 1400 pm. Circularitatea cromozomului bacterian îl
pnotejeazà fafà de acfiunea depolimerizatoare a unor enzime
precum dezoxiribonucleaza. Date asupra circularitàtii cromozo-
mului ibacteria,n au fost obfinute, prin urmàrirea proc€sului de
conjugare bacterianà. S-a constatat astfel cà în cadrul acestui "

pnoc€s transfenrl, de gene de Ia celula donor l,a celula receptor


se face cu o secvenfialitate precisà qi determinatà în rtimp
(Jaeob qi Wollman, 1961). Ulùerior Cainns (1963) aduce dovezi
ooncludente electronomicrpsoopice qi autoradiografice care pro-
beaeà, circularitatea, cnomozomului baetrerian. Toate ibacterlile,
cu o posibilà excepfie a bacteri ' Psqud,omonos, prezin,tà cro-
mozom circular. Se cunoagte încà putin despre organizarea unor
asemenea inele de peste 1000 pm lungime, aflate în celul,e a
càror lungime nu depàEeqte l-2 pm. Crom,ozornul ,bacterian
pnezin'tà un punct de ataqare pe membrana celularà, iar ata-
garea aceasta reclamà sintezà proteinúcà. Sînt date dupà cane

83
situl de ,ataryare la membrana celularà corespr:nde unei negiuni
dim cromozomul bacterian bogatà în secvenle A-T. De regulà
fiecare celulà tbacterianà are un singur cromozom dar fur cazu-
rile cînd replicarea cromozomului nu este urmatà de diviziu-
nea celul,ei pot apare 2-4 cromozomi. Dar aoeqti cromozomi
multipli nu aduc o informalie geneticà suplimenúarà, ei repre-
zentînd copii identice ale crromozomului original. Condifia nor-
malà a celulei bacteriene este haploidia, càci ea prezin,tà un
singur set de determinali ereditani (gene).
în ,afara cromozomului circular suportul grupului prin-
cipal de gene în citoplasma celulei -bacteriene se pot efla una
sau mai mulùe structuri eneditare adifionale, extracromozo-
m,al€ (separ:ate fizic de cromozomul principal) confilrînd fiecare
coa 0,5-2010 din ADN total al oelul,ei, cane au fost numite
plasmide. Ele se replicà indepemden,t de cromozomul principal
bacterian qi sint moqtenite sta,bil. Ele sînt r,epliconi tipici. Plas-
mida (termen introdus de Lederberg, fur 1952) reprezi,n'tà o mo-
leculà circularà de ADN ',bicatena'r, mult mai micà 1lo/o) co,m-
panativ cu c\ea a cromozomului ibacterian. Plasmida poartà
6-10 geille fiind de f,apt un cromozom bacterian miniatural.
'Ca exemple de plasmide pot fi considerafte factorul de ser (F),
Jactorul de rezistm.fd la ontibiotice (R), factorul colícinogeni,c
(col), fagti temperafi cum ar fi fagul î,, care în stare de profag,
se integre'azà in cnomozomul gazdà tot astfel precum se poate
integra qi factorul F. În stare integratà asemenea structuri
,poartà numel,e de episomi.
Unele plasmide au fost numiúe conjugoni, datorità proprie-
tàfilor de a se comporta ca factori determinafi ai conjugàrii,
fiind tr,ansmisi'bile de la o c'elulà la a'l'ta în procesul oonju-
garii.
Datorità tra,nsferului de plasmide de la o celulà la ,alta
,ca gi a pierderii spontane a unora dinrtre ele, celula bacterianà
se aflà într-o stare permanentà de variabilitate genotipicà asi-
gurîndu-se astfel o mai bunà qi uruanlatà adaptare a acestora
la mediul lor de via!à. Datà fiind implicarea plasmidelor în fe-
nomenele de rezisten!à la antibioticre, studiul 1,or a càpàtat un
mare impuls în ultimul timp cînd au apàrut tulpini ,bacterie'ne
multipiu r,ezisten,te. Dar în prezenú studiul plasmidelor bacte-
riene este intensificat qi prin ace'ea cà aceste structuri mole-
culare s-au dovedit a fi excelen{i càràugi ai unor fragmenúe de
ADN euoariot, reprezentînd un fe} de ,,cal trnoiams prin care

84
est'e introdus intr-o celulà bacterianà un fnqgmenú d'e ADN
purtàùor al unei gene eucarioùe. Esúe vor"ba de realiTÀrea aqa-
zizului ADN recombinant.

2.2. ORGANIZABEA EUCARIOTA

Cu exceptia bacteriil,or, aetinomioetelor gi cianobacteriitlor,


toate sistemele hiologioe celulare au materia,lul ereditar în-
chis intr-un spafiu genetic nrucleul delimitat de pr'oc€-
-
sele fuurdameartale ale citoplasmei -
prin intermediul unei mem-
brane duhlà electronooptic qi prevàzutà cu pori (anuli) prin
car,e se realizeazà schimbul reciproc material-informa{ional
nucleu-citoplasmà.
La nivelul nucleului m,aterialul ereditar este organiz,at
într-o substan!à numità cromntind.. Aceasta r,eprezintà forma
interfazicà a un,or stnrcturi oaracteristice care la eucariotele
superioare apar doar îur timpult diviziunii nucleare qi care s-au
numit cromnzqrni. Cromatina prezintà douà stàri funclionale
alternative qi reversiibile: euqomntinn qi hetqocromnti,na. Eu-
cromatina prezintà proprietàli de oolorare normale cu color,anfii
.b,aziciqi un ciclu de c'ondensane súandard (condeursare în divi-
ziune; deoondensare în inrùerfazà). I;a nivelul r€ucrromartinrei de
regulà se aflà secvenle unice d,e ADN. La nivelul eucromatinei
ADN se replicà timpuriu, la începutul fazei S. Eucromatina
reprezintà partea activà genetic (în rtranseriere) a cnomatin'ei
inùerfazice, la nivelul, sàu aflîndu-se c,ea mai mare parte din
protefurele nonhistone cane oondifion'eazi func{ionarea materia-
lului ereditar in replicare sau transcriere.
Hetenocromatina prezintà un ciclu atipic de condensare
(alociclic) reprezentînd cromatina care esúe condensatà qi în
interfazà, apàrînd sub formà de cnomooentri. La nivelul sàu
replicarea ADN este întîrziatà,. Esúe inactivà în transcrier,e qi
suferà sulbreplicare. Heúerocromatina constitutivà, localizatà în
regiuni specifioe al,e cromozomilor cuprinde ADN, care prezin-
tà secvenfe repetate de nu,cleo,tide. Prin heterocromatinizarea
diferenfiatà a eucromatinei rezultà heùerocrornatina faculta-
tivà.
Heterpcromatina se c€lor€:azà, în tot timpul cicluluÍ celular
din care cauzà se spune cà ea mamifestà heteropimud, pozi-
tivà. Între eucromatinà si heterocromatfurà apar diferenlieri qi
la nivelul structurii fizice. Astfel, pe cînd eucromatina are ea

85
elemente ulrtnastructunale pnedominante fibrel,e nucleohistonice
de cirea 100 A dia,rretru, la nivelut heterocromotinei ,se af]à
fibre nucleohistonice de 250 A, deoareoe aoesúea apar mai coill-
densate, mai oonrtractante, de unde qi r'eacfia lor Fzulgen-pozi-
tivà mai in'tensà.
Dacà euctomatina cuprinde genetre majore, heterocromatina
prezintà mai ales funcfii reglatoare oontrolînd activitatea gene-
lor din eucrpmatinà qi raùa muta{iei, moditicînd specific acliu-
nea unor gene, penetran{a, expresivitatea gi specificitatea 1or.
Rolul structural a,l heterocromatinei este legat de stabilizarea
structurii centr'omericre qi a capetel'or cromozomului (telomer,e),
de împerecherea cr,ornoZomilor în naeiozà, contrplul schimbu-
lui reciproc de gene între cr,omozomi omologi (crossing-over).
Rolul funclional al heúerocromatinei este legat Si de controlul
transportului substaurlelor prin membrana nuclearà ca gi de
contnolul diferentierii celul,are. Cel. mai evident rol al hetero-
cromatinei este legat de inactivarea (represia) activitàlii ge-
nice în mecanismul compensa{iei de dozà.
Se disting trei categorii principale de heterocromatinà:
heterocromntínd constitutiud, prezemtà tot timpul qi în
toti- nucleii celulelor unui organism fiind looalizatà în regiuni
specifice ale cromoz,omilor iar în nucleul interfazic se poaùe
aglomera într-o masà cromaticà evidentà numità crorno-
centru;
heúerocromatind facultutiad, legatà de oompensarea dozei
- la oele douà sexe
de gene ale mamiferelor prin care unul, dintre
cromozomii de sex X este inactivat genetic prin heterocroma-
tinizar,e, realizîndu-se un echilitbru între genele sexlincate la
cele douà s'exe la mamif,ere;
heterouomntinn condtensatd, distribuità diferenfiat de la
- la lesut, apàrînd în cursul maturàrii celulare printr-un
tesut
proces care hlocheazà,o anUrrrità informa ie geneticà în anumite
oelule.
Diferiúele úipuri de heterocroma'tinà constitutivà pot fi
evidenfi,ate prin metode m,oderne de colorare a cromozomilor
metaf,azici in care se produe experimen'tal regiuni d,iferenfiat
oolorate sau fluorescenúe care apar sub forma unui model de
bandare specific fiecàr''ei specii qi identic pentru cr,omozomii
omologi.
Sînt douà aategorii majone de m,odele de bearzi:
bandnre C eviden{iatà prin eolorare cu Giemsa dupà r:n
-
pretratament specific cu alcalii qi acest m,odel de bandar.e evi-

86
denfi,azà heterocromatfura oonsúitutivà aflatà de o parte gi de
alta a oentromerului;
bondure G reprezentind zonele heterocnomatice in'ter-
- dispuse deci de-a lungul bralului crornozornului qi care
calare
se evidenliazà în urma unui pretratament cu tripsinà (hidro-
Li'zà sau denatunare enzima'ticà) qi apoi colorare cu Gi'emsa
(bamdare G propriu-zisà) cu quinacrinà fluorescentà (benzi Q).
Deocamdatà nu existà o explicat,ie cuprinzàtoare a naturii chi-
mic'e a bandàrii cromozomale.
Compozifi,a chimicà a cnomatinei, respectiv cnomozomilor
eucariotici este reprezentatà în special din ADN qi histone
aflate în pr,oporlii apnoximativ egale. Îm plus se mai arflà can-
titàti variaúe de proteine nonhistone Ei o micà cantitate de
ARN, ca gi lipide, polizaharide Ei ion'i metalici precum Ca+*
qi Mg*f , ultimele compo,nente putînd fi eventual cont,ami-
nanfi oelul,ari.
ADN cromozomal formeazà componenta esenfialà structu-
ralà qi funcfionalà a cromozomului eucariot. Date reoente de-
mons,treazà echivalenfa o moleculà de ADN un cnomozom
-
euoariot, stabilindu-se astfel universaùitatea rel,a{iei atît la vi-
rusuri gi procariote cît $i la eucari,oúe.
La eucariote ADN pnezintà trei tipuri distincte de secven!à:
secvenle unicre sau nerepetate, secv'enfe mitlociu repetate qi
secvenle înalt repet'ate.
Secvent€le mijlociu nepetate sînt secvenfe simple cu lun-
gimea de 100-500 perechi de ibaze care sînt nepeúaúe de 102
pînà la 104 ori ce se furterpun între secvenle unice, nerepe-
tate.
Sewenfele înalt repetate sînt secvenfe simple, repetate
de 106 ori. În urma denaturàrii, ADN cu asemenea secvenle
prezinta o vitmà mare de reasociere a monocra,tenelor spne a
forma structuri bica'tenare (renaturare) ceea ce nu apare în
cazul ADN eu secvenfe unice sau ADN viral qi procariot. ADN
re,petitiv se aflà de regulà în regiu,nile heterocr'omatioe dispuse
la oapetele cromozomului eucariot (tel,omere) sau în regiunea
centromerului. ADN repetitlv este de regulà inactiv transcrip-
fiona,l.
ADN cu secvenfe mijlociu (intermediar) re'petate cuprinde
ln par,te genele ribozom,ale qi pentru ARNú qi oonstituie sub-
súratnl fizie al arnplificàrii (reitndrii) genice.
ADN cu sesvenfe unice, nerepetitiv, cuprinde informafia ge-
neticà pentnt slnteza di,feritelor proteine celulare.

8T
Cantitatea de ADN repetitiv variazà de la 20 la 800/o dfu.r
totalul ADN. La unele specii secvenfele înalt repetate sînt
reprezentaùe de 6-13 perechi de baze gi în acest caz prin
ultracentrifugare în gradient de CsCl sau sucrozà asemenea
fracfiune de ADN îna,lit repetitiv se separà ca o bandà aparte
de frac{iunea principalà de ADN, formînd oeea ce se numegte
ADN satelit.
Genomul eucariot apare ca un genrorr d,e tip intuspers în
care secvenfele unice alterneazà, cu secvenle înalt sau mijl'ociu
repetate.
ADN mirjlociu nepetitiv codificà informalia pentru sinteza
ARNr, ARNú, ARN 5S qi histonelor, dar funcfia ADN înalt
repetitiv nu este pe deplin erxplicatà. Se admite cà acesta ar
reprezenta o încàrcàturà excesivà a genomului, 'un rbalast evo-
lutiv, dar mai ales ar interveni în reglarea diferitelor funclii
genetice, în conservarea formei cnomozomilor, ar servi în spa-
fierea genelor, ca dealtfel $i în crearea de noi gene.
ADN repetitiv diferà de restul ADN prin conlinutul sàu
mai mare în G -p C sau mai mare în A + T.
Organismele eucariote superioare, ptrante gi animale conlin
în genomii lor o cantitate de ADN suficientà spre a codifica
mai mult de 1 000 000 de proteine diferiúe. Dar sînt date co{rr-
vergente spr€ concluzia cà mumai o parte din între,gul genom
nuclear poa'te codifica proteine.
La Drosofila, pe baza unor ana:lize genetioe qi biochimice
exacte s-a estimat un numàr minim de 5-10 000 de gene struc-
turale. La animale toate lesuturile pr,ezintà un set comun de
gene funclional.e de ,,întnefinere( d,e citeva mii de tipuri dife-
rite pe lîngà a,lte cîteva mii sau multe rnii de gene ,active ce
f un clion eazà, dif erenfiat.
La plante numàrul de gene active este estimat de la 3-4000
la drojdie la 13-14 000 Ia pàtrunjel 9i orz, pînà la 27 000 la
tutun. Asemerrea date au o valoar,e pur orientativà.

2.2 I. ORGAN IZAREA GEN ELO R EU CARIOT E

Dezvoltarea tehnologiei ADN reconxbÍnanú care a permis clo-


narea de gene eucariote în oeluil.a 'bac,ùerianà a drrs la aprofuar-
darea cunoEtinlelor privind organizarea genel,or euoario'te. Pe
aceastà cale s-a stabilit cà genele eucanio'te au o structurà mo-
zatcatà, în care secvenfele lor oodificato,are respectiv regiunile

8B
care vor fi în final tr,aduse î:r secvente de arninoacizi nu sînt
continui ci sînú intrerupte de secvente de inserfie sau de in-
tercalare netraduse, numite cu un termen general ADN silen-
fios. Cel mai bine studiat caz de organizare a unei gene euca-
rioùe care se încadreazà, îur aces,t tip este gena pentru ovalhu-
minà, o proteinà din albuEul de ou. În acest caz, s€cventa ge-
nicà codificatoare a secvenlei de aminoacizi din ovalhuminà este
sepanatà de 7 regiuni neaodifica'toane de lungimi vaniabile inter-
puse în oadrul secvenlei oodifieaú,oare gi separînd-o pe aceasta
în mai mulùe segmemte. Secvenga codificatoare de baze car,e
va fi exprimatà, deci tradusà în secvenfa de aminoacizi este
deei divizatà in regimni care au fost numite de càtre Gilbert
(1978) ertroni, sau eÍùni pe cîn'd regiunile interpuse, neoodifi-
catoane, transcrise în ARNm dar netraduse în proteinà s-au
numit introni. Asemenea organizare genicà a fost eviden$atà
Ei la alte geme precum: gene pentru ARNú de Ia drojdie, gene
pentru histone, gene pentru ARNr de la drosofilà, gena gnobi-
nei de iepure Ei Eoareee, genele imunoglobulinei Ei genele mi-
tocondriale de la drojdie. Se pare cà asemenea organizare este
cvasiubicvitarà Ia' eucariote.
Gena F-globinei de la goarece prezintà douà inserfii, una
de 116 Ei alta de 642 perechi de baze. Gena B-globinei de iepure
pnezintà 'o ,organiz,ate asemànàúoare cu ac€ea de Ia gena F-Slo-
binei de goarece cu excepfia secvenlelor d'e inserfie care pre-
zintà'o puternicà divergen!à evolutivà.
În cazul genelor pentru hemoglobinà qi ovalbuminà intronii
cuprfnd secvenle unice sau de pufine ori r,epetate, genele struc-
tunale fiind repr,ezentate ca regulà de secvenle unice, n,erepe-
tate de ADN.
În cazuL geurelor hemogl'obinei s-a demonstrat 'transcrierea
intnom.ilor în ARNnz precursor (pre-ARNm) sau ARN hetero-
gen (hnAP.N) care va fi supus pnelucràrilor posttranscriplionale
spre a d,a naEùere ARNrzl mntur cel care va fi:ncfiona ca mesa-
ger în sinteza proteinei.
În cadrul ARNrn matur qi fun,cfional în traducere nu mai
apar secvenfele intronice, ceea oe îmseamnà cà ele sînt excizate
ùr oadrul prelucràrii pre-ARNnz. Preluerarea posttranscripfi'o-
nalà a We-AP"Nne se re'alizeazà surb acfiunea unor enzime spe-
cifi,o€, de tipul RN-azei P. ,care taie, excizeaza intronii qi apoi,
atrùe enzirne, 'posúbil de tipul ligazei ARN numite de alùoire, li-
pesc extronii spre a genera ARNnz mahr (Herdeld gi Kiper,
1.979). În cadruL prelucràrilor posttranscripfionale al,e pre-
ARNrn intrà Ei poliadeniL,anea sa la capàtul 3' gi mod'ificarea

B9
(ì Geno ovolbum in ei
€ronr L t2 3/.5
AON
jntroni
c0E
5.-- 3,

FFe ARNm.
I
3'
g6o,enp rièrl

?m Gppp

oosttron*notio- -VrX
thatri

.31
o Pra.lnlm Y/7Dn
t)oúodcritoreo to Y!
nEtilorco aoniloq
'bl.tlotco.crcizb intronibt
C sudoreo exonilor) ciftelc
;
t(t

hdrcó trrnimeo eronilor 11-7;


+i o irrroóto? (A 6) h nunib
alc n$Fotide
lw
t
W
t-
rzz? r8z
UAA

Tc|minorcg
tîo(hrctr

tíg. 33. OtgqnlTassa genel ovalbuminei.

chimicà posttrarnscripfio,nalà a nucleotidelor prin metilare suib


actiunea unor enzime specifice metilaze. Aoeastà metilare se
ad'mite cà are ,loc la nivelul exonitor care astfel dervin rezis'tenti
la acfi,unea enzimelor exonucleazioe. Eorzimele de clivare ,actio-
neazà asupra secvenfelor intronice cu,re nu au suferit metil.area
qi asffe1 au ràmas sensibile Ia enzimele de clivare. Se nerali-
z,eazà, apoi trnirea segme'ntelor exo{rice sub actiunea unor enzime
specifice de 'legare sau altoire (splicing). Modelul acesta (Fig.
33) admite cà regiunile codificatoare din pne-ARN care vor de*
rleni adiacente în cadr,ul ARNnz vor fi aduse în nemijlocità
cronti,guitate prin ibuclarea secvenf elor intronice. Regiunile exo -
nice eontigui vor fi u,nite ,covalent, printr-o reacfie de ligare

90
l,ntracateararà. Bruclarea reglunilor intronioe, excizia lor qi liga-
r'ea ul.terioarà a regiunilor extronice apar oa rezultat al inter-
acfiunilor compl,exe acid nucleic proteine.
Fl,eoent, Lerner gi colab. -
(1980) au implicat în excizia intro-
nilor Ei unirea exonilor din pnecursonrl ARNm (pne-anNm) o
oa'tegorie de molecule mici, discrete, stajbile de ARN mic nu-
cl"eor (snRNA) a càror lungime variazà între 90 qi 220 nucleo-
tide. Acest ARN nuclear mic este asociat cu proteine formînd
partibule mucleare mici ribonucleopnoùeinlioe (snRNP). Pe bciza
observafiil'or cà secvenfa de nucleotide de Ia capatul 5' al unei
ss€ilreo€e categorii de sn RNA prezintà complementaritate cu
joncliunile introni-exoni de la diferite tipuri de ARNnz pentru
insulinà de qo,bolan (5' Exon CAGGUAUGU + Intron
CUACUUCCAGG Exon 3') catena ò2 a imunoglobulinei, catena
B de gl,obinà de Soarec€, ovalbumina de gàinà gi firbroina firului
d,e màùase de la Bmnbyr, aoeqti oeroetàbor,i ,au impl,icat snRNA
în excizia intnonilor qi unirea exonilor spre a forma ARNnr
mntu,r, În ultimut timp se conferà intronilor anumite roluri
funcfionalre în prelucràrile pne-ARNnz. S-a stabilit cà gena mi-
úooonflrialà pentru citocrpmul b de Ia drojdie are Ei ea o struc-
turà rnozaicatà cu exoni qi introni. Mutafia poate afecta a'tît
regitrnea exonicà cît Ei cea intronicà, ,evidenfiindu-se peste 200
muta'nte care au afectatà gena ci,tocromului b. Mutafia atît la
nivelul intronilor cît Si la nivelul exonilor duce la alterarea
structurii gi fun$iei citocromului b. Dacà nntr-o experien{à de
compl'ementa$ie geneticà participà la încruci,$are o tulpinà A
cu mutalia la nivelul exonului qi o tulpinà B cu ,rnutafia la
nivelul intr,onului (ambele tulpini incapabile de a simtetiza ci-
tocnom b qi de a fermenta gluooza) la nivelul zigotului apare
oomplementalia Ei se realizeazà, sinteza citocromului b func-
{ional.
Slonimski a demonstrat cà exonii n,ormali furnizali de ce-
lula de tip B cu mutalie intronicà servesc la si,nteza citrocro-
mului b în zigot iar intronii normali furniza{i de c,elula tip A,
cu mutalie exonicà, furnizmzà informafia geneticà neoesarà ali-
pirii exonilor în ARNrn matur. S-a stabilit astfel, fàrà echivoc
funcfia intronilor în lipirea exonilor.
Echipa lui Slonimski considerà cà intronii servesc ca un
,,model de asamblare( spre a permirte enzimei (enzimelor) de
clivare qi unire sà realizeze excizia intromilor Ei legarea exoni-
1or. O porfiune din intr,on oferà o secvenfà-ghid care formeazà
cu alte elemente oomptrementare din pre-ARNrn o structurà
tranzitorie capabilà de a menfine adiacente extremitàfile exo-

91
urilor alàturafi. Ori, mutafia la nivelul intnonilor îm,piedicà for-
marea de asemenea structuri rtranzittorii. Este positbiil oa smvenfa
ghid sà fie oferità de acele molecule mici de sn, RNA despre
care s-a vorbirt mai înafurte. Existà Ei ipoteza cà intronii codi-
ficà ,,proteimele mesagere(, diferite de cele codificate de exoni.
Aceste proteine au fost tbotezaúe ,,ARN-motltrazeK. Se admite
cà primul intron furmizeaz.à o proteinà de alipire, ARN-matu-
taza, pe cînd ceilalli furnizeazà ,,secven{ele-ghid66 ale ARN.
Proteinele mesagere sau proteinele-m ar avea o secvenfà de
amino'acizi care la un capàt numit globul eronic este hidnofilà,
iar la celàlalt capàú, coresprmzînd la intron, este hidroftrbà,
prinzîndu-se de anvelopa nuclearà, Iàsînd capàtul hidrofil (g1o-
bu1 exonic) liber.
În procesul de traducere a mesajului, rihozomul se ,asocia,zà
cu exonul nr. 1 din ARNrn qi îmcepe sà se formeze o catemà po-
lipeptidicà identicà la un, capàt cu globul'ul exonic al protei-
nei-rn. Aceasta porfiune a proteinei-nz ar servi în inúlierea
ea,tenelor identice polipeptidice sintetizate pe ribozom prin tra-
ducerea aceleiaqi molecule de ARNnz.
Se mai admite cà anvelopa nucleara confime enzimele ne-
cesare prelucràrii pre-ARNrn, ma,i ales cele necesare exciziei
intronilor Ei alipirii exonil,or în ARNnn martur care va fi trecut
în ciùoplasma. Aceste ipoteze nu se exclud gi mai degrabà se
completeazà. Este de relilrut cà aceastà structurà mozaicatà a
genelor eucariote este specificà lor qi este legatà de separarea
celor douà proc€se esenfiale ale decodificàrii informaliei €re-
ditare, transcrierea Ei traducerea în spalii diferite, primul în
nucleul, al doilea 1n ci'toplasmà. Trec,erea mesagerului prin
mernbrana nuclearà este obligaúorie qi aceastà trecere se dove-
deEte a fi un proces foarte complex.
R,eoent s-a constatat cà gena insulinei umane conline douà
secvenf,e de interealare, una în cadrul regiunii transcrise În-
tr-un segment netradus 5' al ARNzn qi alta care întrerupe re-
giunea codi'ficatoare C-peptidicà (Bell Ei colab. 1980). Compa-
rarea genelor insulinei urnane Si de $oarece araúà existenla de
regiuni potenfial reglatoare în cadrul segmentului de ADN ce
precede gena sugerîrrd cà forma ancestralà a genei insulinei a
avut douà secven{e de intercalare. Dealtfel, la mamifere s-au
descris douà tipuri de organizare a genei pentru insulinà: g,ena
pentru insulinà la om qi qobolan II prezintà douà secvenle in-
terpuse pe cînd gena de qobolaqr I are o singurà secven!à in-
terpusà. Semnifica{ia acestei organízàn a genelor eucariote este
deosebità. Se admite cà prezen$a secvenfelor interpuse (introni)

92
a putut accelera evolutia càci a perrnrs construlrea de noi pro-
teine din segmente ale genelor deja existente (Eaton, 1980).
Potrivit acesùei ipoùeze, secautlele codificatoare (eroni) co-
r,espumd pàrlilor func{ionale ale proúeinei.
Trebuie precizat cà la procariote ADN necodificatnr (silen-
fio's) nu apare în interiorul genei ca la eucariote, ci între gene.
ADN al cromozomilor eucariotici este replicat semiconser-
vativ qi bidirecliona\ fiecare cromozom avînd numeroase uni-
tàfi de replicane (cca 2-10 X 104 pe eelulà), care sînt aranjate în
tandem eare funclioneazà asincrpn gi a càror lungime vaúarà
între 20 Ei 70 pm. Replicarea ADN cromozomal se desfàEoarà
mult mai îarcet decît a ADN bacterian avînd o vitezà de 0,5-
2,0 pm/minut, fa!à de 30 pm/minut cît este la bacterii.
FteplÍcarea ADN eucariotic neeesità sintezà proteinicà si-
multanà.
ADN ce se replicà timpuriu este relativ boga,t în G + C pe
cînd cel care se replicà tîrziu, de ,obicei fiind localiza,t în hetero-
cromatina constitutivà centromericà, este bogat în A +î.
Membrana nuclearà joacà un rol important în inifierea Ei des-
fàgurarea replicàrii.
Asociat cu ADN cromozomal qi interacfionînd cu grupele
fosfat ale acestuia prin forfe ionice qi electrosta'tice se aflà pro-
teinele cromozomale histonice care au caracter bazic prin care
sînt neutra,lizate grupele acide fosfat.
La eucariote existà o cerin!à strictà ca ADN nou sinteti-
za,t sà se asocieze cu histonele astfel încît sà formeze complexe
urucleohistonice. Acest fapt este demonstrat de intima asociere
a sintezei ADN qi a histonelor în aceeaEi fazà S a cicluiui ce-
lular.
Histonele nou sintetizate se ooncentreazà în vederea aso-
cierii cu ADN nou sintetizat în imediata veciinàtate a bifurca-
liei de replicare
Histonele joacà pe de o parte rol structural în menlinerea
Ei controlul conformafiei cromozomului eucariot în ciclul ce-
lular, în spiralizarea qi condensaxea cromatinei, iar pe de a,lta
în reglanea,genicà grosierà care duce Ia diferenlierea de modele
de represie genicà cu specificitate de,lesut în timpul dezvoltà-
rii.
Histonele aclioneazà astfel ca r€pr€s,orii generalizafi ai acti-
vità{ii ge'nice càci, condilionînd condensarea cromatinei Ei su-
perspiralizarea ADN, determinà inhibifia stericà a transcrierii
în aceastà stare cond,ensatà ADN neputînd funcfiona ca maúri!à

93
I

în transcriere, numai cr,omatina difuzé prezentînd ,o intensà


activitate de matrifa.
Au fost descrise 5 tipuri de histonà simbolizate Hr Hza,
Hzb, H3 Ei Htt. Dupà oompozifia în aminoacizi se deosebesc
histone rbogate în argininà (HB fi H4), hisùone bogate în lizinà
(Hr gi Hzb) gi histone cu confinut aproxima'tiv egal de argininà
Ei lizinà (Hza). În structura cromatinel aceste fracliuni histo-
nice, cu exceptia H1 intrà în cantitàli echimolar,e. Studiile de
secvenliere fl aoestor fracliuni histonice au evidenfiat lipsa
unei specificitàti de lesut a I'or dar mai ales înaltul conserva-
tism aI secvenlei lor cu exceplia francfiunii HL car€ prezintà
o mai mare variabilitate.
S-a realír*r't o im,agfure simplistà în ceea ce priveEte conser-
vatismul sewenfei hisúonelor miezului nucleozomic H*, Hzb,
Hs gi H4. Astàzi s-a neurunfat la ideea cà aceste francfiuni histo-
nice sînt înalt conservate (Isen'berg, 1979). În cadrul fiecareia
dintre cele ciurci clase de histone Ht, Hza, Hzb, Hs 9i Ha secven-
fa de aminoacizi poate prezenta anumite varia{ii. Exlstà deci
subtipuri ale aoestor clase hist'onice, fie în embriogenezà, fie
în timpul maturàrii unor oelule specializ,ate. Variabilitatea his-
tonei H1 se datoreqte modificàrilor pos,ttraducàùoane. Variabili-
ta'tea celorl'alte clase de histone se baz,eazà. pe divergente evo-
lutive semnificative. În cadrul unei clase particulare de histonà
existà suibtipuri care au struc'turi primare diferite.
Histona Hzb reprezintà un hibrid ,evolutiv càci la ,aoeasta
cca prima treime a moleculei este varialbilà, restul fiind foarte
puternic conservatà. Hisùona Hs de la vitel Ei plante prezintà
divergenle de secven!à fa!à de H3 de la Tetrahymenn gi droj-
die. Ha de la vifel diverge fa{à de Ha de L'a Tetrah'gmena. Aoes-
te divergenle sînt insà mul't mai mici oomparativ cu cele ale
altor proteine, astf,el cà histonele H3 Qi Ht, trebuie încà sà fie
oonsiderate ca proteine înalt conservate. Histonele H3 qi Ha au
pantea,bazicà amino qi partea globularà carboxil. Pr,esiunea se-
lectivà a conservat regiunea globularà, în parte din necesitatea
inúeracliunii hisúomà-histonà, aceste imteracfiuni avînd I'oc între
regiuni globulare. Nu se cunoaqt'e de ce ,8u fost conservate
qi pàrfile bazice. Este posibit ca aceste pàr{i baziee sà fi fost
oonservate în vederea staloilirii interacliunii cu ADN car€ aPBr€
ca substan!à acidà.
La Sacchnrom,gces ce/rwisiae se aflà patru clase de histone
dar nu se gtie dacà este qi histona H1. Mai mult, histonele H2o
H2b qi H3 de la aceastà drojdie se deoseb,esc de clasele cor,es-
pondente de histone de la plante Ei animale. H3 de drojdie de

94
exemplu preziartà o mai mare mobilitate pe geluri de acid-
uree Ei nu posedà nici cisteinà gi nici metioninà.
Micronucleii de Tetrahgmena au numai clasele histonice
Hya, H2b gi Ha, fiind lipsite aparent de histonele H3 gi Hr.
În cromatina ciupercilor se aflà histone care se deose,besc
fa!à de cele de la alte euoariote, eritrociúele nucleate de pàsàri
confin o singurà fracfiune histonicà desemnatà F2C i'ar în sper-
matnznizi celule foarte specializate care nu sintetizeazà. ARN
sau proteine - locul histonelor este luat de protamine (pro-
-
teine foarte ,bogate în arginiarà). Rolul histonelor în represia
genicà generalà este demonstrat chiar Ei prin acest caz al eri-
trocitelor nucleate de pàsàri, al càror nucleu este nefunclional,
ADN-uI sàu fiind represat prin interacliunea cu histona FzC
sau H5. Mamiferele au ales o altà alternativà evolutivà a aces-
tei represii enuclearea eritrocitului matur.
Histonele- sint supuse unor modificàri posttraductoare (post-
sirr,tezà) qi anume metilare, acetilare qi fosforilare. Prin acetila-
rea resturilor aminoacilice din histonà este reglatà interac{iu-
nea histonelor cu ADN, permifînd funclionarea acestuia ca ma-
úrità în transcriere. Alte modificàri sfurt implicate în realizarea
complexelor nucleohisùonice dintre ADN nou sintetizat, gi histo-
nrele nou sintetizate sau în modificarea spiralizàrii cromozo-
male, ea qi în alte feuromene (schimbàri în activitatea cromozo-
malà în tfunpul ciclului celular sau diferenfierii, menlinerea
conforrnafiei corecte a histonelor fata de ADN). Fosforilarea
H1 în special a fost implicatà în condensarea cromozomilor,
Schinrbàrile în organizarea structuralà a cromatinei sînt nece-
sare peu:tru progresarea eiclului cromozomal (eondensare-de-
condensare) Ei se crede cà sînt reglate î:r special prin modifi-
carea proteinelor cromozomaJ.e precum fosforilarea, acetilarea,
metilarea Ei poli (ADP-rihozil)-area. Fosforilarea histonei H1
este se pare cel mai important factor care regleazà condensarea
cromozomalà (Matsumoto qi colab., 1980). Forma fosforilatà a
H1 este deci implicatà în inifierea condensàriii cro'mozomale.
Activitatea H1 fosforilate este strîns corelatà cu activitatea mi-
toticà ,a celulelor iar fosfokinazo histonei H1 este imptícatà în
ini{ierea mitozei.
Rolul specific al'variatelortipuri de histone în structura qi
funclia crornatinei este încà neprecis stabilit. O modificare a
Hxo sub forma de A2a apane a fi preferenlial localizatà în re-
giuni inactive ale gmomului. S-a mai descris Ei metil'area Ei
rirbozilarea histonelor, fàrà a se cunoaEte semnificalia acestor
modificàri.

95
Genele pentru diferitele fracfiuni histonice sînt prezente în
mai mulrte cupii per genom gi rele pot fi dispuse fur úandem pe
acelaqi segment ADN. Repetivitatea genelor pentru histone este
:erutà de necesitatea unei sinteze bogate de histone într-un
interval scurt de timp ce corespunde fazei S cînd ane loc gi
sinteza ADN. Histonele sînt sintetizate în citoplasmà qi apoi
traarsferate în nucleu. Cînd este blocatà sinteza proteinicà d,ar
nu qi a ADN, histonele parentale se leagà numai la wrul dintre
duplexurile fiice. Sinúeza histonelor este intim asociata cu sin-
teza ADN. Cînd sinteza ADN este ,blocatà, sinteza histonelor
soade rapid, deoar,eoe poliribozomii mici asoeiafi cu ARNn pen-
tru histone, satre este de tip 7 S-g S, sî:rt preferenlial dezorga-
nizagi. Numai histona H5 din eritrocitele de pàsàri nu se sin-
tetizeazà coordona,t cu sinteza ADN. Ea este sintetizatà în
ti,mpul maturarii eritrocitelor, proba'bil spre a bloca majorita-
tea genelor nucl,eare, làsînd funcfionale doar cîteva, in spetà
genele hemoglobiurei aviar.e. Cea mai importantà canacteristicà
a genelor pentru histone este gruparea lor sùfnsà, lincajul strîns
dintre genele ce dirijeazà sinteza tipurilor de histonà (Kedes,
1979). Cele mai intens studiate sînt genele histonice de la dro-
sofilà, dar mai ales de la ariciul de mare. Ele au fost clonate
în celula bacterianà prin tehmica ADN recombinant. Genele
penrru histone s-au d,ovedit cà, pe lîngà lincajul l,or în tandem
în ordinea H4, Hs, H2a, Hzb, Hr, ele sînt repetitive, printre sin-
gurele gene codificat,osr,e de proteine care sînt repetitive. Re-
giunile codificatoare ale gemelor histonice sînt interdigitate cu
secvenle spa,tiartoa,ne necodificat'o,arne. Prin hlbridare ARNnz his-
tone (9 S) cu ADN de arici de mare, s-à aràtat cà genele pen-
tru histone sînt reiter,ate de cîteva su'te de ,ori în genomul de
arici de mare. S,ecvenfe).e codificatoare sînt bogate în per,echi
GC, pe cînd secvenlele spafia'toare sînt bogate în perechi AT.
Secvenlele codificatoar,e pentru hisùone r,eprezintà 0,20/o din
ADN úotal d,e arici de mare, pe cînd secvenfele spafiatoare re-
prezintà 0,50/o din gen,omul haploid.
La numeroase specii de arici de m'are s-a reugit alcàtuir.ea
hàrfilor unitàlilor de repetilie a genelor pentru histone. S-a
demonstrat pàstrarea topologiei (loca1izàrii gi iungimii) regiu-
nilor spafiaùoare. La Drosophi,la melanogw,ster, genele pentru
histoure se carteazà în regiunea 39 D-E din braful stîng al
cromozomului 2. ARNnr. pentru histon,e de arici de mare, mar-
cat radioactiv, hirbrideazà în aceeaqi regiune. La oh, genele
pentru histon,e au fost cartate pe cromozomul 7, banda nega-
tivà G1 q 34.

96
Genele pentru hlstone de la drojdie au o organizare cel'a
dif,erirtà de aceea a genelor hisrtonelor de arici de m'are gi dro-
sofi1à.
În afara histonelor, în structura cromaúinei mai intrà gi pro.,
teinele nonhistone numite tncà hqtone, inoorect numite pro-
teine acide deoarece punctul izoelectric al lor variazà din zona
acidà pînà în zoma bazicà. Ele reprezintà enzime ale metabo-
lismului cromozomal cum ar fi ADN polimeraza, AII,N polime-
ro,za, NAD sintetnza, nucleosidtrifosfateza, apoi diverse alte
proteine cu-caracter acid precum molecule proteinice implicate
în activita0ea genieà, activatori qi represori ca gi alte proteine
cromozomale. Proteinele nonhistoniee sînt sintetizate în cito-
plasmà Ei apoi transferate în mucleu. Ele sînt foarte variabile,
heterogene, atît ca structurà cît gi ca funcfiune, preze,ntînd o
vrfiezà mult mai mare de sintezà $i de degradare (turnovt) com-
parativ cu histonele. Greutatea lor molecul,arà variazà între
10.003 qi peste 150.000 de daltoni pe cînd a histonelor este cir-
cumscrisà în limitele a 10.000-20.000 dalto,ni.
Proteinele nonhistonic,e se caracùerizeazà, prin specificita,te
de lesut gi specificitate de speci'e. Aceste proteine sînt impli-
cate în reglajul fin aI activitàlii genice, din intenacfiunea lor
cu histonele rezultà derepresia unei gene date qi transcrierea
pe s,egmentul corespunzàtor din ADN. Ele pot ileteracliona nu
numai cu histonele dar gi cu ADN Ei ARN. Zonele din genom
active în transcriere sînt mul't mai ,bogate în pnoteine nonhis-
tone clecît cele inactive în tramscriere. Aoel,agi lucru este valabil
pentru celule Ei lesuturile tn care au loc sinteze active gi care
prezintà o cantitate mai mare de proúeine nonhis'tonice.
În reglarea transcrierii gemice un ro1 important ît foacà fos-
forilarea pnoteinelor nonhistonice. Prin aceastà modificare a
proteirnelor nonhistonice histonele pot fi scoase din complexele
nucleohistonice ale unui segment dat din genom, làsînd posi-
bilitatea ca gena saru genele din acea regitr,ne sà fie transcrise
Ei deci sà func{ioneze.
Definàtori ai informa{iei ereditare, cromozomii sînt în nu-
màr, màrime Ei f,ormà caracteristici fiecàrei specii. Totalitatsa
cromozomilor unei celule formeazà oomplementul sàu crpmozo-
mal numit încà genaffu Numàrul de cromozomi al oricàrei celule
somatice la indivizii ce se reproduc pe cale sexuatà este dublu
(dipl,oid) fa!à de complementul crom,ozomal' al eelulelor repro-
ducàtoare (gamefi).
La microscopul optic crom'ozomii apar ca structuri sferice
sau baghetiforme, cu dimensiune variabilà între 1 qi 30 pm.

/ - Descifrînd tainele ereditàfii, vol. I 97


La organismele c€ se r.'eproduc pe cale sexuatà în cornplernen-
tul cr.omoznmal cromozomii se a'flà sub formà de pereche, fiind
doi cîte doi omologi, la mivelul fiecàrei perechi un cromozom
fiind de origiare paternà (adus de spermatozoid în timpul fe-
cundàrii, la formarea zigotului) iar aiúul fiind de origine ma-
ternà (adus de ovul la nivelul zigotului). Din unirea garnituri-
lor haploide ale garnefil.or î:r procesul fecundàrii se reface în
zrgot o garniturà diploidà oare prin diviziunile mitotice *succ€-
sive ale acestuia va fi transmisà fiecàrei celule a organismu-
lui ce rezultà.
Cromozomii omologi au aceea.gi structurà qi funclie (poartà
acel'eagi g€{ne, aceea;i informafie 'ereditarà). Omul are de exem-
plu în gernitura diploidà a tuturor celulelor somatice cîte 46
de cromozomi, dintre care 23 de provenien!à maternà qi 23 de
provenienfà paternà. Aranjamentul cromozomilor, prin dispu-
nerea lor ordonatà în per,echi de cromozomi, considerînd numà-
rul, forma, màrimea qi orice altà caracteristicà specificà com-
plementuL cromozomal al u,nei specii sau linii celulare duce la
ob{inerea cariotipului acelei specii sau linii celulare.
Cariotipul uman a fost stabilit în anul 1956 de càtre Tjio
qi Levan, a fost standandizat prin conferinlele de la Denver,
Londna qi Chicago gi definitivat ulterior, pe baza studiului rn'o-
delelor de ,bandare (colorare diferenfiatà a cromozomilor) la
Conf,erinta de la Paris din anul t971.
Metodele de 'bandare au permis nu numai identificarea
exactà a omologilor din cadrul fiecàrei perechi de cromozomi,
care se poate face cu o anumità dozà, de relativitate datorità
subiectivismului cercetatorului qi prin metodele clasice dar, pe
baza oomparàrii modelului de benzi al omologului matern qi al
omologului de origine paternà, s-€u putut stabili rnodificàrile
exacte, structurale, ale cromozomilor, modificàri' care au stat
la ,baza evoluliei cariotipului ce a însofit evolulia speciei sau
stau la ba,za diferitelor maladii numeric Ei mai ales structural-
cromozomale. În cadrul fi'ecàrei perechi de cromozorni, modelul
de benzi trebuie sà fie identic la cei doi omologi în condilii
normale.
Cari.otipul uman este a1càtuit din 22 perechi de autuzomi
(cromozomi identici la ambele sexe) gi o pereche de cromozomi
de ser sau heterozonti, identici sau omologi la fem,eie (XX) qi
ureidentici, neomologi, nepurtînd aceleagi gene 1a ibàrbat (XY).
Cromozomii dirr per,echile 13, L4, 75,21 Ei 22 sînt crom'ozomi
organizatori nucleolo,ri (NO) din care cauzÀ, sînt afirmafii dupà
care la origiu:e, specia umanà ar fi un pemtaploid. Maimulele

98
drrtnopoide au un cariotip asernànàùor oarecum oelui uman. Cim-
panzeul, cel mai apropiat de om are 48 de crpmozomi Ei se
admite cà dintr-o specie oomunà au putuú deri;va specia umanà
qi primatele prin remanieri numerie qi structural cromozomale
de tip fu,ziune-fisiune csntricd sau qrrcuploidii.
Prezenla unui crornozom suplimentar în perechea 21 condi-
lioneazà un sindrom foarte grav a:1, tri.somiei 2t sav rrlùngolis-
ntul.
Aproape toate anomaliile numerice care af'ecteazà cromc-
zomii sînt corelate cu aparilia de grave sindroame cu defecte
fizice gi psihice.$i aber,a{iile structural eromozomale sînt extrem
de grave. Delelia parlialà a bra{ului seurt al cromozomului din
perechea a 5-a condilioneazà, sindromul cri-Cu-chat (tipàtul
pisieii) cu înapoiere mintalà a copilului Ei moarte prematurà.
În leucemie este de asemenea implicatà o translocalie între
cromozomii I Ei 22. Studiul cari,otipului este deci de interes
major atît la plante cît Ei la animale incluzînd omul. La porumb
existà o garniturà dipl,oidà de 20 cromozomi care alcàtuiesc 10
pereehi. Deci îri fiecare celuià se aflà douà seturi identice de
crornozomi. Crcinozomii de la nivelul unui set sînt însà ne-
omologi, sînt diferili ca m,orfologie qi dim,ensiune, puntînd Ei
gene diferite. La'organismele diploide informalia ereditarà apa-
re astftì tedundantd.
Crganizarea multicr,omozomalà a genomuluir eucariot este
rerutà gi de particularitàlile realizàrii reeomhinàrii genetice la
eucariote cu implicafii în oonferirea unei mai mari flexibi,litàti
evolutive.
Cromozomul eucariot prezintà douà unitàfi structural,e lon-
gitudinale care au fost numite cnomntide, libere pe toatà lungi-
mea crornozomului cu excepfia unei. regiuní care s-& numit
cons'tric,tie primnrd I,a nivelul càreia este loc,alizat centro,m'qul,
o zonà. specializatà a cromozormului pentm atagarea sa la fi-
brele fusului de diviziune. Reginrnea centromericà constà din
nurneroas'e fibne cromatice, aqezate laturà pe laturà, ce pot
treoe de la un bra! la ,altul croma'tidei (fibre intercromatidice).
Morfol'ogia cromozomului eucariot este determfuratà de pla-
sar,ea constricliei primare de-a lungul acestuia. Astfel, cromo-
zomul este m.etacent-ric, pnezentind douà brafe egale cî,nd oen-
tnomerul este localizat în pozifie medianà. Cînd centromerul
este plasat în afara regiunii mediane apar douà 'brafe cromo-
zom,ale in,egale Ei cromozomul se numeqte suAmatrcentric. Cînd
centromerul se aflà deplasat spre un crapàt al cnomozomului
apar douà ,brate inegale dintre care unul foarte lung gi altul

99
foarte scurt, izodiarnetric gi cromozomuL se numeqte subtelo-
centric. În sfîrgit, aùunci ,cînd centromerul se af1à pe capàtul
crom,ozomului, deci terminal, existà un singulbra! cromozorqlal
Ei cromozomul se numeEte telocentric.
La nivelul cromatidei au fosi descrise filamente spirale,
reciproc încolàcite care s-au numit cronl,o'trem,e qi care prezirrtà
din I'oc în 1'oc îngrogàri care s-au numit cromomere. Cromo-
mer,ele conf'erà cromonemei un aspect moniiiforrn foarte evi-
dent în tirnpul profazei din mitozà, dar mai ales din meiozà,
ar,anjamentul qi numàrul cromomerelor fiind o caracteristicà
de specie.
Structura bicromatidicà a cromozomului eucariot metafazic
este caracteristicà perioadei cuprinse între aparilia cromozomi-
lor la debutul, diviziunii nucleare gi sfîrEitul metafazei.
La nivelul fiecàrei cromatide-surori din cromozomuL m,et,a-
f.azic se aflà cîte un du'blu-helix ADN. Monomemia sau unine-
min cromozomului eucari'ot a fost dovedità pentru prima datà
autoradiogra,fic în 1957 de càtre Taylor gi colaib. (1957) Ei apoi
prin cercetàri rbiochimice pe ADN din cromozomii de drosofilà
de càtre Kavenoff qi colrab. (1973). AceeaEi uninemie apare în
cromozomul anafazic echivalent de fapt cu o cromatidà a cro-
mozomului metaf.azíc. Ipo'teza unin'erniei cromozomu'lui eucariot
este susflnutà de dovezi ,biochimice, ultrastructurale si genetice.
Recent, Okada Ei Comings (1979) au evidenliat la nivelul cro-
mozomilor metaf azícl de hamster chinezesc tratali cu acetat de
arnoniu 4M qL întinqi pe s,uprafa{a apei distilate, existenfa unei
organizàri de un ordin mai în,alt a ADN, care în urma unui
asenrenea tratameurt este eliberat sub forma unor serii regulate
de rozete conectate de porliuni liniane de ADN numite inter-
rozete. Lungimea medie a regiunii în care moiecula ADN ca-
pàtà oonfiguralia de r,ozetà este de 14 pm care este apropi,atà de
lungimea medie de 10 Fm a ADN cromomeric din cromozomii
politenici de drosofilà. Segmentul interrozetà are o iungime
medie de 4,2 pm. Proteinele matrixului nuclear nehistonice care
includ qi cantitàli semnifica'tive de octind qi tubulind sînt iem-
plicate în formarea rozetelor.
C'ea mai lungà piesà de ADN descrisà în nucieii eelulelor
umane are 22.0A0 1rm. Tayl'or Ei Hozier (1976) au stabiiit cà
unitatea de replicare la celulel'e ovariene de hamster chine-
zesc este de 4 [m lungime, ceea ce implicà cca 550.000 situri de
iniliere în nucleul diploid (2.200 000 um : 4 Fm). Complemen-
tul uman diploid con{ine 6,9 X 10-12 gm de ADN. Împàrlind
aceastà valoare cu 3,L4X10rs gm/prm de dubiu heiix ADN se

100
calculeazà 2,2 metri (2.2A0.000 pm) de ADN per nucieu ciipì,oid
uman (Bahr, 7977).
Caracteristic pentru eucariotele evoluate este existenla unui
ciclu cromozomal numit ciclul condensdrii Ei decondewórii qo-
rnozorrnllui. Cromonemele sau cr,omonemata cel.e douà fibri-
le longitudinale ale cromozomului euoariot - prezintà proprie-
- (spiralizare ero-
tatea de a se spiraliza mai mutrt sau mai pulin
mozomalà) ceea ce determinà varialii în forma cromozomilor
în timputr ciclului celular. Spiralizar,ea cromonemelor este în-
solità de condensar.ea cromozomului, procesul a,tingîncl maxi-
mum în metafazà cînd cromozomul prezintà cea mai constantà
morfologie. În timpul diviziunii cromozomul apare sub forrna sa
transportoare, formà cerutà de o repartizare echilibratà a in-
forma{iei ereditare în celulele fiice. Dupà realizarea acestei
repartizàri care are loc în anafazà gi desàvîrEità în telof,azà
cromozomul trece de la forma transprortoare la forma sa func-
fionalà în cadrul nucleului interfazic. În forma funclionalà cro-
mozomul atinge gradul maxim de spiralizare a cromonemei,or,
însoliúà de decondensarea qi desigur pierderea individualitàlii
cromozomului. Materialul cromozomilor se va organiza sub în-
fàtiqarea cromatinei interf azice. Se pare cà cloar cromonemele
îqi pàstreazà continuitatea atît la nivelul cromozomilor cît qi
la nivelul, nucleului interfazic. Se cunosc puline iucruri despre
cauzele qi, mecanismele spiralizàrii qi despiralizàrii cromozo-
mului eucari'ot. Cercetàritre din ultimul timp pun pe seama fos-
forilàrii proùein,elor cromozomale histonice, în spe!à à Hr eon-
densarea cromatinei la debutulr diviziunii.
Nucleul inùerfazic este metalbolic activ, la nivelul sàu avîncl
loc intense sinteze ale componentelor majore ale celulei gi în
primul rînd sinteza ADN gi a proteinelor cromozomale histo-
nice. Durblarea eantitàlii de ADN esùe o condilie necesarà des-
fàquràrii mitozei Ei impune diviziunea. Cînd replicarea cromo-
zomilor nu este urmatà de diviziunea nucleului qi ulteri,or a ci-
toplasmei iau naEtere diplocrorrtozomi, cromozo'mii fii nese-
parîndu-se în ciouà celule fiice, rezultînd o eelulà care este
endoploidà avînd o cantitate dublà, sau corespunzînd la un
multiplu aI cantitàlii dipl'oide de cromozomi, depinzînd de nu-
màrul de cicluri de replicare desfàqurate fàrà interpunerea mi-
tozei. Un caz interesant este oferit de celulele glandelor saÌi-
var,e de diptere în care endociclurile duc 1a formarea cromo-
zomilor politeni. Prin politenie se înfelege desfàEurarea de run-
de multiple de replicare a cromozomilor, fàrà ca cromatidele

101
fiice sà se separe în nuclei fii dif,erili. Ràrnînînd asociate ele
reaiizeazà o -structurà cr,omoz,omalà politenicà în care alúernea-
zà ,henzi clare qi benzi întunecarte dispuse transversal, perpen-
dicul;ar pe iungimea bralului cromozomal. Cromozomii politeni
reprezintà astfel forma interfazicà a cromozomiLor obiqnuifi la
nivelui càr,ora s-au desfàEurat multiple runde cle replicare. Di-
rnensiunea unor as,emenea cromozomi ,este de peste 200 ori mai
mare ca a cromozomilor obiqnuili din care derivà. Deoareae are
Ioc un pioces de împerechere somaticà 'a cr,ofiìozomilor omologi
în timpul politenizirií lor, numàrul cromozomilor politeni apa-
rent reprezintà iumàtate din acela ai cromozomilor obignuili.
Din asocierea intimà (împerecherea) la acelaEi nivel a cno-
momei'elor iclentice ale celor doi omologi rezultà un model de
bandare specific fiecàrei specii, pe baza càruia se poate alcàtui
o cariare citolog'icà a gen'el,or, admi!înd cà fiecàrei benzi îi co-
respunde o genà. În anumite regitini benziie (cromomerele)
prezintà o dispunere laxà, deslînatà a fibrilelor, rezultînd struc-
turi caracteristice care s-au numit puf e, iar cele car€ au o ex-
tindere mai mare au fost nurnite inele Balbiani. La nivelul
aces0or structuri a fost evidenliatà prin experienfe autoradio-
grafice cu 3H-uridinà, desfàqurarea unei intense transcrieri ge*
netice. În cursul dezvoltàrii ontogenetice pufele apar într-o
anumità ,ordin,e, indiciu cà ar'e loc o activare diferenliatà, eqa-
lonatà a geneior, în funclie de necesitàtile de moment ale
celulei.
Cromozomii poiiteni au fost descriEi gi la angiosperme, pro-
tozoare, în unele celule transformate maiign. La plante cromo-
zomii. politeni nu sînt împerecheafi, prezentînd o structurà gra-
nularà, fàrà a prezenta benzi distincte.
Cromozomii politeni apar în celulele înalt diferenfiate care
nu -se mai divicl gi deci care reprezintà punctul terminus al
unei iinii celulare date. Astfel, cromozomii politeni nu vor
mai r.eveni niciodatà la forma o,biqnuità, celulele în care se a,flà
(de exemplu cele clin glandel'e salivare ale larvelor de diptere)
funclionînd foalte intens într-un moment precis circumscris al
o,ntogeniei dupà care mor (glandele salivare ale ,adultului se
dezvoltà ulterior din celule care ,au crornozomi obignuifi). Poli-
te,nia ajutà tocmai în realizarea unei asemenea funclionàri la
parametri metabolúci maximi.
În timpul meiozei în nucleul ovocitei primare, mai al,es la
batracieni dar si alte verterbrate qi nevertebrate s-a descrÍs un
tip special de cromozomi care apare mai ales în stadiul de di-

ra2
ploten pr,elungit. Acest tip
de sromozomi numit larnP-
bru.sh (în perie de sticlà cle
lampà) este specífie aces-
tei faze Ei este reversibil.
càci în fazele ulterioare
ale meiozei el revine la
forma tipicà de crornozoml
spe'cificà acelei specii.
Acest tip de cromozomi
apane qi în spermatogene-
zi la Drosaphila. Dimen-
;iunea CIromozomului lamp-
bnsh poate depàEi pe a-
ceea a cromozomului poli-
ten ajungînd la 1 m,rn, dar
diametrul sàu este foarte
subfire. Din cromomerele
sale stnt pnoiectate late-
ral bucle în perechi avînd
diferite forme qi dimen-
siuni (Ftg. 34). Aceste bu- ' ..tl
cle au o axà finà repre-
zentatà d,e ADN $i din ea Fig. 3a. Cromozomi ,,iampbrush" din ovo-
eite de Tritutus uiridescens. Ei reprezintà
sînt proiecta,ùe flbre eare bivalenfi (cromozomi omologi) qi deci douA
sînt acoperite de un ma- stucturi bicatenare d,e ADN prezentînd
trix c€ este alcàtuit din regiuni strîns spiralizate-cromomerele.
ARN gi proteinà.
Aflîndu-se în mijlocul profazei primei meioze se înlelege
cà fiecare cnomozom lernpbrush neprezintà de fapt un bivalent,
adicà doi cromozomi omologi împerecheali. Bucia lateralà apare
în acest caz ca unitate de iransóriere. Fiecare buclà apare asi-
metricà în sensul cà la nivelul uneia dintre inserliile sal,e în
cromomerà este finà qi lipsità de fibre reprezentînd capàtul sàu
gol, urud, de la care se remarcà un gradient de lungime al Íii:re-
lor ce sînt proiectate din buclà, ia început scurte Ei de','enind
progresiv mai lungi pe màsurà ce se apropie de eelàlalt capàt
al buclei unde se inserà în cromomerà. Este posibil ca la
nivelul capàtului gol sinteza ARN sà fie blocatà sau asimetria
sà aparà ca un rezultat ai polarizàrii formàrii buciei. Buclele
sînt considerate a reprezenta modificàri reversibile al'e struc-
turii crornozomale la nivelul unor gene active, acest fapt fiind
103
demonstrat gi de reducerea sau anularea lor atunci cind se
ac{ioneazà, cu inhitbitori ai transcrierii genetice. La unele ur'o-
Cele (salamandrà de exemplu) din unele bucle care sînt omo-
loage pufelor cromozomilor politeni, se desprind continuu
structuri circulare care confin ADN qi care reprezintà nucleolii
extracromozomali, rezulrtafi în urma unuí proces de extrare-
plicare care se numeqte amplificore genicd. Printr-o asemenea
extrareplicare, cantitatea de ADN se màreEte considerabil,
uneori depàEind chiar ca'ntitatea de ADN a cromozomil,or în-
EiEi.
Între cromoz,omii politeni gi cromozomii larnpbrwh apar
uD,eI€ asemànàri cum ar fi amplificarea genicà, fenomenul de
pufare respectiv ,buclare, structura cromomericà, împere-
-
chere,a omologilor (în primul caz este vorba de o împeredrere
somaticà, în al, doilea de o împerechere norma'là meioticà).
Marea deosebire din'tre aceste douà tipuri particulare de
cromozomi, dar de excepfionalà importantà în înlelegerea fe-
nomenului ereditar, este cà în eazul cromozomilor politeni, spre
deosebire de cromozomii la,rrtpbrush, transformarea (rnetarnor-
fozal este ireversi,bilà. tri nu vor mai reveni la forma rrormalà,
tipicà a cromozomilor obiqnuili ci funcfioneazà într-un stadiu
critic al vielii celulei, respectiv individului (stadiul larvar III)
cînd sînt necesare sinteze de proteine, nespectiv enzime ale
glandetor salivare. Dupà îndeplinirea rostului 1or, celul,ele
glandelor salivare se autolizeazà qi odatà cu ele Ei crornozomii
uriaqi politeni.
-
Cromozomii tmnpbru,sh, dupà ee îqi îndeplinesc funcfia tor
de sintezà inteursà de ARNr revin, începînd din diochinezd. qi
mai ales în me'tof'azo I a meiozei, la forma normalà de bivalenfi
asigurînd continuitatea geneticà în linia germinalà.

RA ELECTRONOMICROSCOPrcA A CROMATINEI
2.2.2. STT|UCTU
$r A cRoMozoMuLUr EucARror

Cercetàrile de microscopie electronicà asupra cromatinei in-


terfazice € qi a cromozomului metafazic au stabilit cà unitatea
de structurà a cromatinei eucariote este nucleosomul, o struc-
turà periodicà, repetitivà de hisùone qi ADN. Fibra de croma-
tinà este flexirbilà $i pe ea se aflà particule sferice dispuse pre-
cum màrgeiele într-un girag. Nucl'eosomii se aflà deci atît în

104
cromatina interfazicà, cit Ei în cromozomul metafazic, în eucro-
rnatina qi heterocromatinà, pe aceastà bazà putîndu-se ,explica
continuitatea structuralà la nivel celular a materialului gene-
tic la eucariote.
Particula nucleosomalà are un cliametru de 70-110 A.
Nucleosomul este alcàtuit dintr-un octamer histonic în care
intrà în cantitàli egale fracliunile histonice H2a, Hzb, Hs gi Ha
dar în dublu exemplar. Octamerul histonic ar.e o greutate mo-
lecularà de 110.000 daltoni. El se asociazà cu ADN de lungime
corespunzînd la 200 perechi de ,baze. ADN stà l,a periferia octa-
merului înfàqurat ca o superhelice platà (Fig. 35). Între parti-
culele nucleosomice se aflà de asemenea ADN, lung de 1,8-
3 nm, neasociat cu histone. Nu se qtie încà cum participà frac-
fiunea hist,onicà H1 la structura cr'omatinei.
În ciuda unor deosebiri de vederi privind forrna qi di-
mensiunea nucleozomului, numàrul de perechi de baze ,asociate
acestuia Ei lungimea ADN intercromozomal este cliar cà nucleo-
zomul este o unitate de bazà a cnomatinei eucariote. Dimensiu-
nile sale sînt de 70-1,25 A, formà de disc (se mai numeqte gi
platizom\ sau sfericà, fiind înfàquna't de 2 ,orí Ei jumàtate în-
tr-o dispozilie încr.elità de o lungime de ADN care are 140-
200 de perechi de nucleotide. Dupà
Gottesfeld Ei oolaboratorii (1975) num'ai
portiunile inactive ale ADN sînt orga-
nizate în nucleozomi. Histona H1 este l'li,ciecsl-,

implicatà în superspiralizarea nucleo-


zomilor qi a ADN internucleozomal qi --l
împachetarea lor în fibra de cromatinà t

(Rahr. i977). I
I
I
I
I
I
I
l,-"^ Q
l3LsA
Fig. 35. Relafía dintre structura ADN, oligomeri
histonici gi fibtile de cromatinà de diferite dimen- I
I
siuni (grosimi). Duplexul ADN de circa 25 L i
I
diametru este suptaspbalizat în interiorul subuni- I
l
tófilor cromatinei (NUCLEOZOM.I cu un pas (îuà1- t

fime) de 504, spte a da o fibrà de 100 A. aga cum


i
!

apare la microscopul electronic. Întregul complex 50


nucleohistonic este din nou spiralizat (înfagurat)
cu uu pas de 500 A qi o razó d.e 130 A spre a da loo*-!Èl
o flbrà d.e 200 A *t. cum se vede la 'nicroscopul
electronic. Potliunile (întind.erile) de ADN liber
dintre nucleozomi în mod normal sînt mai lungi
decît este aîAtat îu aceastA schemìl.
I ':ti200 A
i

105
ln fibra de cromatinà ADN se aflà sub forma superspirali-
zatà raportul lungime ADN : lungime fibra de cromatinà fiind
de cca 30 la 1. Nucleozomii sînt mesllinufi în fiibra de croma-
tinà prin cooperarea proteinelor specifioe cum ar fi histona H1,
nonhisbonele Ei proteinele contr,actile.
Cînd celula trece prin stadiul postreplicativ G2 aI ciclului
ceiular, cele dor-rà fibre replicate în stadiul precedent de sintezà
S al interfazei se condenseazà sprc a forma jumàtatea unui
cromozom (cromatida), pliindu-se în cromatide surori. Fiecare
cromozom este pliat într-o oonfiguralie specificà în metafazà.
Structura electronornicroscopicà a cromozomului eucariot
relevà natura fibroasà a fibrei nucleohistonice care nu prezintà
capete iibere.
Cercetàri recente efectuate de càtr,e Loemmlú de la Univer-
sitatea Princeton din New Jersey aratà cà 'organizarea cro-
matinei în cromozomul metafazic are la bazà o re{ea de pro-
teine nonhistonice. Îndepàrtînd histonel'e qi majoritatea pro-
teinelor n,onhistonice din cromozomii metafazici umani a ajuns
la constatarea cà ADN cr,omozomal ràmîne într-o structurà
organizatà qi compactà care apare ca un miez central ce pre-
zintà morfologia cromozomilor metafazici intacfi, fiind încon-
jurat de un halou de ADN. Structura miezului central este
dezorganizatà, în urma tratamentului moderat cu tripsinà. Prro-
duqii de digestie au fost analizali electroforetic. S-au eviden-
liat peste 30 fracliuni de proteine nonhistonice. Aceste ceroe-
tàri aduc date noi referitoare la structutra cromozomului euca-
riot Ei ,aratà cà aceasta se bazeazà, în primul rînd pe existenta
unei matrice de proteine nonhistonice care eonferà cnomozo-
multri metafazic forma s,a caracteristicà. Aceste oercetàri ur-
meazà sà fie confirmate.

2.2.3. COMP LEXU L SINAPTIN EM AL

În meiocite apare ca structurà caracteristicà prezentà doar


la eucariote cotnplerul sinaptinemal (C. S.) descris pentru pri-
ma datà, în-1956, de càtre Moses. C. S. este,o stmcturà tripar-
tità (Fig. 36) eviden{iatà numai eleetronomicroscopic, prezenùînd
douà componente laterale Ei o regiune centralà mai putin
electrondensà numità spaliu de împereehere. Regiunea centnalà
ane o là{ime constantà de 1000 A, reprezentînd qi distan}a din-

106
Fig. 36. Complexul sunaptinemal (CS). A. în spermatocitele de Philaenus
spumariws se remarcó dimensiunile complexului sinaptinemal în absenla materia-
lului cromatic. Màrire r 78.000. B. complexe sinaptinemale n:,ultiple, în lega-
turA directà cu membrana nuclearà, r 48.000 (dupà Maillet gi Foillot, 1965).

tre cromozomii omologi în pa.chiben, indiferent de lungirnea


cromozomilor omologi qi conlinutul de ADN din aoeEtia. În re-
giunea centr,alà se aflà elementul central, care are 200 A d;a-
metru. Spaliul dintre regiunea centralà Ei eiemen'tele laterale
€ste traversat de filamente fine. La làcuste Ei asoomicete, com-
ponentele laùer,al,e apar cq o structurà ba,ndatà cu o periodici-
tate de apnoximativ 100 A. Cromatina crom.ozomiloi omologi
vine în contact cu elementele laterale ale C. S., pe întreaga lor
trungime. Ambele capete ale bivalentului sînt ataqate la mem-
br,ana nuclearà prin tel'omerele 1or. La formele la care în pa-
chiten apare o distribulie în ,buchet a bivaien{il'or, ambel'e ca-
pete ale bivalenlilor sîn,t atasate într-o regiune restrînsà a rnem-
,branei nucleare, adiacentà centriolului. Formarea CS începe cu
sinteza unei componente laterale în spaliul dintre crornatideie-
surori ale fiecàrui cromozom leptotenic (încà aflat sub formà
de univalent, neîmperecheat cu omologul sàu) gi capetele fie-
càrui cnomozom leptotenic (avînd între cromatidele sale un
element lateral), sînt ataEate la membrana muclearà. Are loc
alinierea relativà a cromozomilor om,ologi pe un spafiu de cca
3000 A, fàrà a se cunoagte mecanismut Érin care Àe realizeazà
aceastà împerechere prea}abilà a omologll,or. Elemen'tele laterale
ale c. s. ce aparlin omologilor se asociazà avînd lroc asambla-
rea C. S. care determinà o împerechere foarte exactà, cromo-
merà la cromomerà, punct la punct a crelor doi cromozomi omo-
logi cu f,ormarea 'bivalen{ilor. Pmtru asamb}anea c. S., elemen-

fi7
tele lateraLe ale fiecàrui omolog suferà o transpozilie dintre
cromatidele surori spre exterior, depì.asare determinatà de
rotirea cromatidel,or surori fa!à de componenta lateralà. Este
posibil ca componenta centralà a C. S. sà derive din elemen-
tel,e laterale omoloage prin existenfa unor fibrile dar Wester-
gaard Ei Wettsùein (L971, 1972) admit cà elementul central al
C. S. ar fi sintetizat în nucleol de unde migreazà la Locul de
unire a elementelror laterale. În diplotenul tîrziu C. S. se dez-
'organizeazà iar omologii sînt respinqi de l,a nivelul bivalentului
fàrà însà a se separa, ràmînind unili la nivelul chiasmelor
-
semnuL citologic al schimbului intercromozomal (cr,ossing-over),
C. S. mediind schimbul dintre moleculele de ADN ale omolo-
gilor.
C. S. apare ca o structurà ri,bonucleopr,oteinicà. Aceastà
aser'{iune se bazeazà, pe rezultatul digestiei enzimatice cu DN-
azd care dizolvà cromatina bivalentului fàrà a altera structura
complexului sinaptinemal.
Rezultà cà ADN nu este un component major a1 C. S., Pu-
tînd fi pnezent însà în cantitàli imfime. In schimb, ribonucle,aza
dezorganizeazà regiunea centralà gi cea mai mare parte a ele-
mentelor laterale.
Prezenfa componsntei proteinice în C. S. este dovedità de
rezuitatul digestiei cu enzime proteolitice (tripsina). Elementele
laterale dau reac{ii citochimioe care indicà prezenla în ele de
proteine bazice de tip histonà, r,egiunea centralà dînd reacfie
ciiochimicà diferità de aceea a elementel,or 1atera1e.
Existà unele afirmalii dupà care ADN ràmas nereplicat în
faza S premeioticà qi replicat în zigoten (Stern gi Hota, 1969,
Hota qi Stern, 197I) ar media împerecherea cromoz,omilor omo-
logi d'ar dupà al{i autori (Westergaard Ei Wettstein, 1972) în-
sàEi componenta lateralà a C. S. poartà informa{ia pentru
împerecherea sit 1a sit a cromatidelor cromozomilor omologi.
Complexele sinaptinemale mediazà formarea de heteroduple-
xuri ADN. Dupà uneLe ipoteze ar exista gene care codificà sin-
tnza unor proteine alosteriee de imperechere, capabile sà se
ataqeze la anumite secven{e cle nucleotide. Ar exista douà ti-
puri de asemenea proteine de împerechere, unele caracteristice
regiunilor e.ucromatice, alt,ele caracteristice regiunilor hetero-
cromatice. Dupà altà ipotezà, ar exista gene de fuziune care ar
dirija sinteza unor proteine de împerecher'e bivalente speci-
fice celor doi cromozomi omologi ai fiecàrui bivalent. Acesùe
gene ar fi derivat printr-un crossing-over inegal între cromo-
zomi omolo.gi.

T.OB
3. CARACTBRISTICILE ORGANI.ZAR,IT EUCARIOTE

1. Închiderea materialului ereditar într-un spafiu genetic


reprezentat de nucleu.
2. Asocierea permanentà a ADN gi histonelor cu formarea
fi,brelor nucLeohiston iae.
3. Prezenfa a trei clase de secven!à în ADN: secvenfe uni-
ce, secven{e moderat r,epetate Ei secvenle înalt repetate.
4. Dif,eren{ierea a douà stàri funclional'e ale cromatinei
eucromatina qi heterocromatina. -
5. Evo1u{ia unui ciclu de condensare Ei decondensare a
cromatinei.
6. Organizar,ea unui fus de diviziune eare asigurà reparti-
zarea echilibratà a produgil,or de replicare.
7. Specializarea la nivelul cromozomului a unei regiuni de
atagare la fibrele fusului de diviziune centromer (cineùo-
chor).
B. Organizarea nucleolului ca structurà intranuclearà spe-
cializatà în sinteza ARN riboz,omat. El este asociat cu regiunea
or,ganizator nucleolard, (N. O.) a unuia sau a mai multor cro-
mozomi.
9. Aparifia unui centri.ol cilindric cu formula ultrastructu-
ralà I X 3 fiiamente, implicat în organizarea fusului de divi-
ziune.

4. PROCARTOTB-EUCARIOTE, O COMPARATIE

Procariotele prezintà ADN necomplexat cu proteine bazice


hisùonice (cu unele exoeplii E. coli, Anabaena, Aphonocap-
sa). ADN procariot nu prezintà - secvenfe repetate (excepfie gene
rib,ozomale prezenbe în cîteva copii). Nici ADN viral nu pre-
zintà, secvenle repetate de baze cu exceplia fagilor din grupa
T parà (Tz, T4, T6) al càror cromozom prezintà repetilii de baz,e
la fiecare capàt. Procarioùele nu au materialutr ereditar încadrat
întru-un spaliu genetic defi,nit.
Cantitatea de ADN este mult mai mare Ia eucariote, cores-
punzînd unei cantitàfi mai mari de informalie eneditarà (ta-
belul 2).

109
Tabelul 2

Datc crntitatlve prlvlnil genomul vlral 9l eelular](ilupà J.E. Taytor)

Polioma 0,00158 1
pX t74 0,00186 I
fagul T 7 0,0122 I
fagul ), 0,0172 I
fagul T 4 0,0520t6 I
Vinrsul Fowlpox 0,0930t6 I

E. coli Lark 0,45 x l0-r 1,530


E. coli Cairns 1,400

Chlamydomonas 3 x 10-r 10,200

Drojdie 1,8 x 10-r 6.12


Neurospora 4,6 x 10-t 15,64

Raphanus sstiYun 2,5 850,00 I


22,0 7.480 6
Angio- Vicia faba 18.020 t2
53
sperme
Lílium longfflorum
Xanthorhize r8
0,45 153
Aquitegia 7
0,45 153

Drosophlla melauogaster 0,18 61,2


Neverte- Chironomus 0,20 68,0
btate pallidivittatus
Pegti (specii diferite) 0,7
-2,8 238-952
Dípnoi: Protoptenrs 50 17.000
Lepidosireu 124 42.160
4,9 1.666 l3
Amphibia
Bufo l3
Vertebrate 24,6 8.364
Salamandra
Plethodon t2
Necturus maculosus 94,5 32.130
Reptile
Ord. Squamata 2,1-2,3 7t4-782 18-23
Ord. Crocodylia 2,9-3,1 986- 1054 2t
PAsàri g,t-4,2
Matnifere-hamster 1054- 1428
3,5 I I90
Om
3,0 1.020 23

110
Eucariotele conlin de cca sute de mii de ori mai mulú ADN
decît virusurile gi de mii de ori mai mulrù decî,t bacteriile.
-tixistà însà mari varia{ii cantitative chiar în cadnrl aceluiaqi
grup de organisme eucariote. Drojdiile ibunàoara, eucariote ti-
pice, conlin o cantitate de ADN nu cu nurlt mai mare decît
bacteria E. coli, pe cî,nd în nucleii unor dinoflagelate se aflà
mai mult ADN decît la om. Nru existà deci o relafie simplà, d,i-
rectà între cantitatea de ADN qi aceea d,e informafie eredi-
tarà. (ADN nerepetitiv).

5. GBNOMUL EXTRANUCLEAR

La eucariote, în afara nucleului se aflà molecule informa-


lionale de ADN oanton'ate la nivelul unor organite specifice
precum mitocondri.ile qi clwoplastele ca Si în kinetozomii, de la
ciliate, granulii bazali ai flagelilor organismel,or flagelate qi
kinetoplastele de la Trggnnosamidre. Din ace,astà cauzà celula
eucariotà apare ca o strucùurà multigernornicà î:r care, alàturi
de un genom nuclear existà cel pufin al{i doi genomi diferifi
extranucleari genomul cloroplrastic specifie celulei vegetale
-
Ei genomul mitocondrial, comun cel.ulei vegetal.e qi animale
(Fig. 37), ADN orgamitelor, localizat în matrixul acestora, pre-
zintà. un aspect ultrastructurafl. simitlar aceluia al, nucleoidrilui
baeterian sau cionobacterian, în car'e se r€m,arcà o retea tridi-

z
o
o
o

IU
.îl slendard
t
c
fD
I
Fig. 37. Fractiunile de ADN celular delaEuglena (J

(a) Bandarea care apaîe în tubul de


gracil,is. (,
centrifugà care conline ADN de Euglena gracilis s
6 ADN
(centru gi dreapta) gi ADN de fag SP 8 folosit ca foiitocondrie
standard (stînga). (b) Analiza spectrofotometricó =) /ADN
c c loroplastic
ln ultraviolet a be[zilor. Banda cu densitatea
.g
1,743 corespund.e ADN martor SP 8. Banda -o
principalódin centru corespunde ADN nuclear. o
ADN mitocondrial bandeazà la 1,691 iar ADN 14
.o r.69r ì.0c6
cloroplastic bandeazà la 1,686 (greutate mole-
cularó 9,2 x:106 d.altoni). greu dens;latee(9 crf) uîot

111
mensionalà de fibrile fine de ADN cu orientare randomizatà,
avînd un diametru de cca 25 A. Înseamnà cà gi în acest caz
este vorba de lipsa asocierii ADN cu histonele.
De regulà. ADN extranuclear se prezintà ca molecule cir-
culare bicatenare de ADN, dar gi sub formà de moleeule li-
niare. ADN extranuclear se replicà dupà modelul semioons'er-
vativ qi relativ independent de replicarea ADN nuclear avînd
echipament enzimatic propriu de r,eplicare gi de transcriere.
Organitele celulei eucarioùe, cloropl,astele gi mitocondriile, pre-
zintà un sistem autonom de sintezà proteinicà echipament enzi-
matic propriu cu ribozomi specifici de tip procariot (70 S)
qi cu ARNú specific. Existà însà o strînsà independen!à între
funclionarea genomului nuclear Ei a celui cioroplastic sau mi-
tooondrial. ADN mitocondriatr este o structurà circulrarà dublu-
catenarà care are o greutate molecularà ce varlazà, între 1X 107
Ei 5X107 daltoni. EI are o dimensiune mai mare la ciuperci,
pr'otiste gi plante superioare. Mamiferele au un genom mito-
condrial mie de 1 X tOt daltoni.
I"a drojdie, ADN mÍtocondrial are 5 X 102 daltoni ceea ce
corespunde Ia 75 [<ilo,baze. PrÍmele gene cane au fost desem-
nate a codifica cCImponente ale maEinàriei de sintezà protei-
nicà miùoeondrialà au fost desemnate gene sg7, $i el.e includ ge-
nele pentru ARNr qi ARNú mitooondrial (Tzagoloff Ei Macino,
L977). La Soccharom,yces cereaisine s-au descris cel pu,Ln 30
tipuri diferite de ARNú mitooondrial. Numàrul toùal de specii
izoaccepùoare de ARNú este în acord cu ipoteza usobble (vezi
codul genetic). La Socclwromgces nu este necesar importul de
ARNú citoplasmatic pentru sinteza proteinicà pe ribozomi mi-
tocondri,ali. La Tetrahgmena însà numai ARNú pentru leucinà,
fenilalaninà, triptofan qi tirozinà sînt sintetizati pe matrifà de
ADN mitooondrial, restul fiind importafi din cit,oplasmà, avînd
origine nuclearà. Aminoacil sintetazele mitooondriale, factori de
inifiere a sintezei protein'elor în mitoeondrii Ei cele mai mulùe
proteine ri'bozomale sînt produgi ai genelor nucleare sinte'tizati
pe ribozomi citoplasmatici.
Mutafia ,,pokytt de la Neurospora cmsso apare ca rezultat
al absenlei unei pr,oteine specifice a subunitàfii ribozomale
mici (30 S) a ribozomilor mitooondriali. Aeeastà pnoteinà a fost
desemnatà uar I qi este codificatà de o genà mitocondrialà. A
doua cl,asà Ímportantà de gene mitocondriale a fost desemnatà
genele mit Ei crodificà pnoteine ce funcfioneazà în tnansportul
electronilor qi fosforilarea oxidativà. Mutaliil'e mit afecteazà

tL2
trei complexe ale membranei interne, eitocromoxidaza, coen-
zima QHz-citocrom c, reductaza Ei ATP-a,m oligomicin sen-
sibilà.
Din totalul a nouà prot'eine sintetizate în mitocondrii qase
s-au dovedit a fi specificate de ADN mitocondrial. S-au descris
trei grupe de complementafie mitocondrialà ori 7, ori 2 Ei ori
3 care intervin în codificarea subunitàlilor citocromoxidazelor
sfurtetizate în mitocondrii. Mutafiile din grupul de complemen-
tatie cob sînt deficiente în ciùocromul b. Un grup de mutante
mitooondriale deficiente în ATP-azd desemnate pho 2 pre-
zintà leziuni în componenta proteolipidicà a ATP-azei.
La S. cereuísioe mutantele citoplasmatice spontane ,,petite66
prezintà unitàli genomice mitocondriale în care un segment
excizat al genomului parental de tip sàlbatic (normal) a fost
amplificat în tandern. Acest segm.ent excizat devine unitatea
repetatà a genomului ,,petite66. Acest genom ,,petite( la rîndul
sàu, deqi produsul unui eveniment mutafional poate suferi cie-
I,efii care duc la genomuri ,,petite( secundare, avînd unitàli
repetate mai scurte (Gaiiland qi colab., 1980). Studiul mutante-
1or spontane ,,petite( aratà cà în mod frecvent capetele seg-
mentului excizat corespund la secvenfe scurte ale genomului de
tip sàlbatic care sînt extrem de bogate în GC. Astfel, clu,sterii.
(grupàri masive) de GC sînt localiza!í în segmente lungi ,bogate
in AT. Repetifii de secvenle s-au dovedit a fi prezente atît la
niveLutr clu,sterilor GC cît qi a spapiatorilor AT, ceea ce face
pnobabilà posibilitatea ca excizia sà se realizeze prin'tr-un me-
canism de recombin'are nelegitimà cu specificitate de sit, între
secvenfe omoloage.
Combinarea metodelor de eartare geneticà qi de cartare fi-
zicà a dus la cartarea markerilor mit- Ei de rnezisten!à la anti-
biotice din genomul mitooondrial de la S. cereaisine.
Pe oalea analizei co-retenfiei qí co-delefiei alelelor mutante
fur Ei din ADN mitooondrial al mutantel'or peti.te (qJ Ei a ana-
lizei produqilor de recomrbinare (analizà gen'eticà) din încmci-
qàri bi- qi trifactorirale, s-a sta{bilit circularitatea hàrfii genetice
mitocondri'ale, unicul grup d,e lincaj genic mitocondrial avînd
ca suport fizic molecula circularà dublu-eatenarà de ADN
mitocondrial.
G'enele ribozomale mitocondriale Ei pentru ARNú mitocon-
drial au fost cart"ate priur hitbridarea acestor produgi eu frag-
mente de ADNmt de la tipul sàiibatic $i de la tipul p- $teti.te)
gener,ate prin restrielie cu endonucleaze de restricfie.

8 - Descifrind tainele eredità|ii, vol. I 113


Harta geneticà mitooondrialà evidenfiazà o oonsiderabilà
dispersie a genelor care ooclificà funcfii înrudite. Cele trei gene
structurale car,e codificà citocromoxidaza sînt separate d,e sec-
venfe care conlin genele sgn qí mit.
Geurele ARNr, ARNú qi ATP-caei sînt de asemenea distri-
buite împràqtiat în tot genomul mitocondrial. Aoeastà distribu-
fie specificà a genelor mitocondriale eltiminà posibilitatea expre-
siei lor ooordonate contr'olatà prin simteza unui ARNrn poli-
cistronic, gsnele mittooondriale, spre deosebir,e de oele de pro-
cariote, apar a fi transcrise individual, caracteristicà specificà
qi genelor nucleare euoariote.
Clor,oplastul plantelor superioare conline un numàr mare
de molecule circulare, identice cu ADN cu o greutate mole-
culiatrà de cca 9 X tOz da,l,toni. Fiesarc nro.lpculà oonline furfor-
mafia geneticà totalà a orgarnitului (Bórner, 1980). Ca urmane,
numàru1 de copii ale fiecàrei gen,e cloroplastice per celulà poate
ajunge 1a cîteva mii, depinzînd de numànr,l de cloroplaste per
celulà Ei de cel al moleculelor de ADN per cloroplast.
Cu ajuùorutr endonucleazelor de restricfie s-a stabil.it harta
fizicà s, ,g€Doffiului clonoplastic qi au fost cartaúe genele pentru
ARNr, ABNú, subunitatea mare a frracliunii proteinice I gi pen-
tru unele polipeptide neidentificate. S-a stabilit cà genele
ARNr sînt localizaúe în cadrul unor r'egiuni cu secvente repe-
tate din ADN (in cadrul a douà repetifii inversate la spanac,
porum,b qi Chlotrydommtas gi în cadrul a trei repetifii în tan-
dem mai mici.7a Euglenn). Pe ribozomii cloropl,astici sînt sinte-
tir.ate mai mult de 90 po'lipeptide distfurcte, incluzind gi sub-
unitaúea mare a fracliunii proteinice I (ce participà în cataliza
enzimaticà a fotosintezei), trei surbunitàli ale factomlui de cu-
plare CFt doi factori de elonga{ie qi ciúocromii. Un numàr mare
de proteine clonoplastice sînt si,:rtel:zatn pe riibozomi citoplras-
matici qi includ enzime ale ciclului Calvin, enzimele sintezei
pigmentului ADN polim erazal polipeptidel,e tilncoidelor qi mem-
rbra,,nele anvelopei cloroplastului. Polipeptidele sînt evident sin-
tntizate în citoplasmà, ca precursori avînd ,o secven{à semnal.
Aceastà secven{à adifionalà permiùe transportul specific prin
anvelopa cloropiastul,ui dupà care este eliminartà. În membrana
anvelopei cloroplastului se aflà receptori specifici pentru sec-
venla semnal a moleculelor pr,ecursoare, facilitînd trecerile
prin membranà.
Recen,t, au fost izolafi crùÍLmomi cloroplnstici intacfi de la
alga Euglenn ca qi de Ia numer,oase plante superioare Ei s-a

114
constatat cà aceEtia sînt circulari, avînd o circumferifà de cca
45 [rh, ceea ce cor'espunde la cantitatea de ADN de la fagii
T2 sau Ta.
S-a oonstatat cà genele cloropLastice care codificà diferitele
enzime sau proteine ce participà în fotosintezà sau în morfo-
geneza organitului sau ,genele mitocondriale ai càrnor produgi
dirijeazà sinteza unor enzime ce intervin în lantul transporto-
rilor de electroni sau a unor protein,e structurale suferà mu-
tafie gi recombinare. Ele alcàtuiesc ca Ei la pruoariote un sin-
gur grup de înlànfuire.
Cercetàri de hibridare molecularà au demonstrat lipsa unei
omologii între ADN nuclear qi ADN extranuclear. O analogie
mai mare apare între ADN extranuclear qi ADN bacterian sau
ciano'bacterian, de unde s-a tras concluzia cà organitele celu-
lei eucariote ar fi derivat prin endosimbioza unor stràmoqi de
tip prooariot bacteriile pentru mitooondrii, cianobacteriile
- (Gawilà, 1978). Existà gi alternativa ca ce-
pentru cloroplaste
lula eucariotà sà derive prin transformar€a progresivà a ce-
lulei procariote, organitele citoplasmatice ale celulei eucariote
provenind prin transformarea mem'branelor tilacoide Ei prin
compartimentaiizarea genomului inifial în genom nuclear, mi-
tocondrial, cloroplastic etc.
Capitolul IV
CODIFICAREA BIOCHIMICA
SI EXPRESIA GENICA

1. GBNERALITATI

Gena reprezintà un segment din macromotrecula ADN a


càrui secven!à de nucleotide deline, sub formà oodificatà bio-
chimic, informalia geneticà necesarà pentru sinteza unei catene
polipeptidice. Aceastà informalie este transmisà în prooesul
de transcriere unei monocatene ARN car€ poartà astfel mesa-
jutr genetic ce dirijeazà includerea în catena polipeptidicà a
aminoacizilor cor'espun zàtorí. Secvenfa genicà codificaúoare este
precedatà de ,o secven{à necodi.ficatoare de circa 50 nucleo'tide
care s-a numit regiune promotor, r'eprezentînd situl de aùaqare
a ARN polimerozei în vederea transcrierii. De as€rt€rlea în
cadrul genei se mai aflà o rqgiune implicatà în r'eglarea tran-
scrierii genei qi care a fost numità regiune operatoare. Uneori
douà sau mai multe gene care defin informafia geneticà ce di-
rijeazà sinteza unor enzime ce intervin în aceeaqi cale meta-
bolicà pot avea acelagi promotor qi acel,aqi operator. În acest
caz asemenea gene sînt tr,anscrise sub forma unui tr,anscript
comun care poate fi apoi clivat în diferite caúene ARNrn pur-
tàtoar,e al,e mes,ajului genetic pentru fiecane catenà polipepti-
dicà.
Gene1e care delin inf,ormafia geneticà pentru sinteza poli-
peptidelor se numesc gene structurale. Tr.anscriptele 1or repre-
zentate de ARNrn sînt traduse în pol,ipeptide.
Genele car'e delin informalia geneticà pentru sinteza ARNr
se numese gene ribozqmnle. Transcriptele lor nu sînt traduse.
Conversia (traduoerea) mesajului genetic din limbaj de acid
nucleic construi,t din cele patru nucleotide într-un limbaj pro-

116
teinic, construit din cei 20 aminoacizi principali este mediatà
de un sistem de codifioare-decodificare cunoscut sub numele de
cod genetic. Aceastà conversie se realizeazà la nivelul riibozomi-
lor iocul sintezei proteinice qi are ioc prin participarea
celor- trei categorii principale de
- ARN celular: AItNm, ARNú
qi ARNr.
Ideea prof'eticà a lui E. Schródinger din anii L944-t945
despre natura relafiei dintre actzii nucleici Ei proteine formu-
latà în termeni de codificare biochimicà s-a dovedit realà Ei
cristaiizatà sub denumirea dogmei centrale a biologiei mole-
cul.are elaboratà în anul 1956 d,e càtr,e Crick. Dogma centralà a
biol'ogiei molecular,e a admis transferul unidireclional al infor-
mafiei genetice ADN + ARN -> pr,otein,e. Ulterior, descope-
rirea reverstranscrierii a adus coreclii dogmei centrale a biolo-
giei moleculare, demonstrînd posibilitatea unui transfer invers
de infor,mafie geneticà de la ARN l:a ADN.

2. CODUL GENBTIC

Codui genetic repnezintà un sistem biochimic prin care se


sta'bileEte relafia dintre acizii nucleici Ei pr,oteine.
Relafila dinrtre muúafia uurei gene Ei blocarea unor eùape spe-
cifice aie unui lan! meta,bolic 1a Neurospora a fost stabilità
înainte de 1944 de càtre Beadle gi Tatum su,b formula meta-
foricà: o gemd, o enzirnd. Colineoritatea gend, polipeptidd
a fost ulterior- d,emonstratà în numer'oase cazuri. - Astfel, în
1957 Ingram Ei Husit au aràtat cà hemoglobinele de tip A qi S
au o structurà primarà car,e diferà printr-un singur aminoacid
(fig. 3B). Hemoglobina S este ,o hemogl,obinà mutantà. S-a tras
concluzia cà mutafia a alter:at pozilia nucleotidelor la nivelul
genei iar aceastà al,terare a fost tr'adusà printr-o alternare a
poziliei unui aminoacid în catena polipeptidicà. Veridicitatea
colinearitàtii nucle'otidel,or de Ia nivelul genei cu aminoacizii
de la nivelul oatenei polipeptidice a fost demon;stratà experi-
mental de càtre Yanofsky în t964. Anaiizînd mutantii armotrofi
de E. coli induqi prin iradiere UV, deficienli în proteina A a
triptofansintetazei, proteinà care reprezintà o catenà polipepti-
dicà de 267 aminoacizi, autorul a constaùat cà în pozili,a 2t0,
mutanta A2s ,at€ arginina iar mutanta Aa6 are acidul glutamic
pe cînd tipul normal prezintà în pozilia respectivà glicin,a. Pe

Itr
HbA HbS

t,4 .
-Y\./
ti\
/.-.\
i9&\ ()
153 i-11,
/
dà}i,3
d""t %o*
I ts
Fig. 38. Comparatia cromatogramelor peptid.elor produse prin digestie cu tri-
psna a hemoglobinei normale 6ffe; gi h.e-moglobtnei din celule falóiforse (I{bs)
din care teiese modifiss3sa ln pozifia peptidei 4.

aeeastà tlelzà, s-a tr,as comcltuzia cà o schimbare în secvenfa de


nucleotide determinà înlocuinea unui aminoacid cu altul, de
unde dovada oolinearitàfii nucl,eotide anninoracizi, respectiv
o colinearitàtii genà-proteinà. -
fur an'ul 1952 Doumce $i apoi în anul 1954 Gamow, bazafi pe
desooperirea lui Astlbury gi Bell din 1938 care au constaúat prin
ceroetàri crisúalografice cà spaliul dintre urucleotide l,n ADN
este aproximativ egal cu spa{iul dintre aminoacizi în ca,tena
polipeptidicà, emit ipoteza potriviú càreia secvmfa, lùniarà de
nueleotide d,in ADN determinà secventa liniarà a arninoacizi-
lor din catenele polipeptidice ale moleculelor proteinice.
Gamow a analizat s'tatlstic relafla dintre polinucleotide, re-
prezentînd cuvinte lunagi scrise intr-un alfalbet cu patru iiùere
(cele paftru ibaze azotate) gi poli,peptidice, reprezentînd cuvinte
lungi scrise într-un alfabet cu 20 litere (reprezentate de crei 20
amin'oacizi prineipati). Dacà seevenfa de nucleotide din acidul
urucleic determinà secven{a de aminoacizi dilr polipeptidà se
pune problema relafiei dintre cele 4 herze azota'te gi cei 20 ami-
noacizi principali în termeni de determinare cantitativà: cîte
baz,e azotate determinà un aminoacid?
Dacà se' admiúe cà o singurà bazà azotatà deùerminà
(specificà sau codificà) un singur aminoacid atunci în vir-
tutea relafiei 4L:4 nu vor putea fi specifica{i decît 4 amino-
aqzi. Tot astfel eombinàri de cîte douà 'baze azotarte, potrivit
rela!Íei 42:16 sînt instrficiente spr,e a specifica toti cet 20,ami-

118
noacizi principali. Doar combinàri de cîte 3 baze azotate
(43
- 64) potprincipali
aminoacizi
sà ofere posibilitatea specificarii tuturor celor 20
qi sà mai ràmîmà încà qi alte posibilútàti
suplimentare de specificare.
Relalia nucleotide-amin,oacid a fost dovedità experimental
studiindu-se mutafiile induse de càtre acidul nitros la VMf,. a
càrui capsidà constà din 2L50 catene polipeptidice ideurtice,
fiecare confinînd cî'te 158 amimoacizi. Mutatiile indtrse de càtre
acidul nitros sint tmnzifiii de tipul A. + G sau C -+ U (vezi,
mutageneza). În urma aparifiei acestor mutalii la nivelul nu-
cieotideloldin ARN genetic al, \[VIT, care îndeplíneqte qi rul
de ARNrn, apar modificàri qi în catena polipeptidicà. Aceste
modificàri sînt de tipul unor substitufii de aminoacizi:
Prolinà -> Serinà -+ Fenilalaninà sau
Prolinà -> Leucinà - Fenilalaninà.
S-a dedus cà Prolina esúe specificatà de un codon la care ceÌ
pu{in douà nucleotide sînt fie A, fie C. Tranzifia A -+ G sau
Q + U a unei,a din ac,este nueleotide trebuie cà genereazà codo-
nul Serinei, respectiv pe acela aI Leucinei. În oodonul Fenilala-
ninei ambele mucleotide trebuie sà fie G sau U.
Pe seama unor deducfii asemànaùoare qi a analizei varian-
telor hemogtobinei umane, Nir,enlberg a descifrat în 1961 codul
genetic.
Efectuîndu-se studii genetioe €supra mutantelor induse cu
proflavinà la bacterinfagul Ta s-a dernonstrat experimental cà
unitaùea care codificà un aminoacid este tripleta de uruclEotide
care s-a numit codon.
Asemenea studii în care s-au aplicat teste de recombinare
cu tipul sàlbatic au conrdus la ooncluzia cà în urm,a acfiunii
proflavinei are loc fie adifia, fie delefia de baze din secvenfa
polinueleotidicà. Astfel, existà mutante inifiale nota,te conven-
lional cu ,,-(ú qi mutante naturale de reversie notate cu ,,f c.
O secventa initialà, normalà de nuclieotide va fi citità din
trei îrr trei baze azotatm spre a dirija de fiecar,e datà plasarea fur
lanlul polipeptidic a unui aminoacid.
Dacà se admite cà secventa de nucleotid,e reprezentind ca-
drul de citire începe sà fie citità dintr-un punct fix, delefia unei
singure perechi de urucleotide va duce la schimbarea tuturor
tripletel,or, modificînd cadrul de citire Ei atunci în oatena poli-
peptidicà r'or fi încluqi cu totul alfi aminoacizi decît în cazul
normal' Are loc citinea greEità a aodului. Astfel, dacà cadrulr

119
normal de cirtire est'e GACG. GAG. GAG. GAG, insmlia uniui
singur C Ia nivelul sàgefii va determina urmàtorul cadru de
citire: GAG. GAC. GGA. GGA. etc. Tot astfel dele,tia lui A va
produce de aseme,nea schimbarea cadrului de citire GAG. GAG.
GAG. GAG Ei atunci secvenla de triplete va fi GAG. GGG.
AGG. AGG. etc. În ambele cazuri este sehim,bat totalmente ca-
drul de citire mai ales dacà asemenea alrteràri se produc la în-
ceputul genei. Se sintetizeazà o proteinà anormalà, mutantà sau
nefunclionalà.
Dacà în urma mutafiei, dupà ce a avut loc inilial o delefie
a unei perechi de baze azotate, va avea loc adifla unei alte
perechi de baze ,azotate îur porliuni 'adiacente a,le aceùeiagi gene
se poate restabili ordinea ur'ormalà a nucleotidelor (se reface
cadrul de citire) Ei ea va fi citità normal. Astfel, considerîqrd
polinucleotida GAG, inserlia lui C urrnatà de delelia lui A va
refaee cadml normal de citire, va avea loc o citire corectà a
sa $i se va sintetiza ur-r polipeptid normal:
GAG. GAG. GGA. GGA. GGG. GAG. GAG...
chiar dacà cîteva triplete pe portiunea în care se realizeazà adi-
tra qi dele{ia vor fi modificate. Delefia sau adilia uneia, a douà
sau a patru pereehi de nucleotide nu reface ordinea normalà a
nucleotidelor respectiv a codonil,or qi are loc sinteza unei pro-
teine mutante.
' În anul 1961 Nirenbeng qi Matthey pe de o parte qi Ktro-
rana pe de alta, folosind ARNrn sintetizafi artificial ce aonfi-
neau o secven!à cunoscutà de nucleotide, au r,euEit sà sinteti-
r,ez,e i.n uitro diferite polipeptide în sisteme aceiulare care oon-
lineau ribozomi, factori proteinici necesari pentru sinteza poli-
peptidicà precum qi tot setul de ARNf. S-a analizat apoi
oompozilia polipeptidelor sintetizate. Astf,el cînd au folosit un
homopolimer poLiribonucleotidic format numai din uracil
@oli U) a fost sintetizatà in uitro polipeptidul polifenilalanina.
Astf,el, s-a demonstrat cà tripleta UUU specificà aminoacidul
fenilalanina. Cînd s-a f,olosi;t poli-C s-a sintetizat polúprolin,a.
Poli-A determinà sinteza polilizinei. Numai poli-G nu a putut
fi verificat inifial càci formeazà între nesturile guaninà puntl
de hidrogen care determinà aonformafli spaliale multicatenare
spirale la care rirbozomii nu s,e pot ataEa. Ulteri,or s-a stabilit
cà GGG codificà glicin;a. Experienlele de verÍficare a proprie-
tàtilor de oodificare al,e polimeritror au fost oontinuate luîndu-se
ùr considerane oopolimeri. Pe aceiastà bazà. s-a stabilit cà poli
A-G deùerminà încorporarea lizinei într-o catenà polipeptidicà

120
pe cînd poli C-G determinà încorporarea într-o catenà poh-
peptidicà a alaninei, argininei gi prolinei. O secvenla repetitivà
CUCUCU determinà sinteza unui polipeptid în care leucina
alberneazà cu serina. Au fost folosifi ,aPoi oopolimeri cu 2 ,baze
azota,te in proporfii diferite qi cu 3 rbaze azotate diferite reugin-
du-se sinteza de polipeptide artificiale în care erau incluqi
divergi aminoacizi. Prin asemenea experienfe s-a putut de'ter-
mina direct relalia de specificare a aminoacizilor de càtre nu-
cleotide. Dar prin ele nu se putea stabili ordinea nucleotidelor
în cadrul tripletelor. Pentru aceasta a fost sintetizat artificial
un ARNm alcàtuit din douà nucleotide diferite dar la care se
gti'a care este ordinea acestor nucleotide. De exempliu s-a oon-
struit un ARN,rn artificial de tip UGU-GUG-UGU-GUG etc. qi
s-a constatat cà el dirijeazà sin,teza unui polipeptid în care
cisieina alterneazà cu valina" Pe aceastà cale s-a putut deter-
mina experimental ordinea nucleotid,elor celor mai multe tri-
plete. Ulterior, pe ,baza unor tehnici sofisticate care au inclus
hidroliza ritbonucleazicà a ARNrn, ultracentrifugare,a fracfio-
natà Ei electroforeza I'izaùelor, cromatografia pe hîrtie cu sta-
bilirea Jingerprinú-urilor diferitelor oligonucl'eotide,'analiza
spectrofotometricà în ultraviolet Ei analiza ,,de vecinàtates prin
care se poate stabili p'ozllia radicalilor fosforici s-a putut de-
terrnina ordinea nucleotidelor în diferitele triplete.
În studiul codificàrii bi'ochimice a fost apliaatà Ei metoda
identificàrii aminoacizilor ARNú fixali pe ribozomi sub in-
fluenla unui codon cunoscut. - Aceastà metodà ca Ei cel,elalte
prin care s-a descifrat codul genetic s-au bazat pe constatarea
cà ionii Mg++ în ooncentrelie mare împiedicà disocierea ribo-
zomilor 70 S în subunitàtile sale Ei permit acestora sà inilieze
traducerea fàrà oodonul inifiator AUG. Astfel, în 1964, Niren-
berg a sintetizat trinucleotide cu secven{e de baze cunoscute,
acesfea au fost asociate cu ribozomii Ei s-a urmàrit care dintre
ARN' se leagà l,a un ras€ít€o€a complex. De exemplu, trinucleo-
tidul 5' GCC 3' legat la rirbozom a determinat ataqarea la oom-
piexuÌ. format doar a ARNf pentru alaninà dintr-un amestee de
diferill ARNf. Tot astfel, 5' GUU 3' aclionînd ca A-RNrn, de-
terminà Legarea la ribozomi doar a ARNú pentru valinà. Pe
aceastà cale s-a putut stabili direct semnificafia de codificare
a fiecàrui codon. Astfel, s-a rezolvat semnifica{ia d'e codificare
a trei izomeri UzG: UUG-leucinà; UGU-cistenà; GUU valinà.
Folosind aceastà cal,e s-a reuEit descifrarea în totalitate a co-
dului genetic. Crick a sugerat aranjarea codonilor într-r-rn ta-
be'l c,ane sà reprezinte grafic oodul genetic. Semnificatia acestui

t2l
tabel pentru Biologie este cpmparabilà cu ,8c€€è a tarbelului
periodic al elementelor pentru Chimie.
Au fost studiatc de asemenea mutafiile car€ determinà sub-
stitufia unor aminoacizi dÍn mol.ecula unor proteiure birrecu-
noscute ca sesvenfà de alninoacizÍ cum sînt hemoglobina, trip-
tofansintetaza de E. coli, qí proúeina \lAdT.
Mutafiile de su'bstitufie afecteazà de regulà o singurà nu-
cleotidà din catena polinucleotidicà. O mutafie de substitulie
care apane cu mane frecvenfà la hemoglobfura umanà duce la
înlocuirea valinei cu izoleucina. Cum valina este codifica'tà de
GUU ian izoleucina de 1 A 2U s-ra, tras eonehrzi,a eà ,ordinea
nucleotidelor îm tripleta izoleucineí este AUU, codonul va}inei
devenind prin sutbstitufia G cu A codonul izoleucinei. Printr-o
anafizà de acest fel s-au putut d,ovedi experimental raporturile
de oodifi@ne gi s-a descifrat oodul genetic (fig. 39). Cea mai
,neambigua validare a codultui ggnetic stalbilit prin experienfe

q
J
3)

J
O ,c
a

Fig. 39. Reptezentarea codului genetic ARNza. Codonii se formeazl ponrind


din centnr spte periferie. La periferia cercului sînt dispugi sminsa,gizií codlficafl
de eodonii corespunzàtorl. Ala : alanina; Ary : argininl; AsP : acid
aspartlc; lsy'-Nlfr : ssParagina; Cys : cisteina; Gkt : aciil glutanric;
GIr-NII' - glutarnlna; Gly : glicina ; Mct : metionina; Phe : fenilalanina;
Pro : prollne i Scr : serÍna; Tht : treonina; Tr! : triptofan; Tyr : ttrozi-
te; Yol : ynlilg. Codonii ocr*, amber V ofal desemnafi cu un ceîc îregru dnt
c.od.onii îlor$rerur, eare nu specificó nici un ntninoacid, teprezentînd. codoni terrnii{
natori ai catenei polipeptidice. Codonii desemnafi cu us, triuaghi sînt codon'
tniliatori ai catcnei (AÙG gi GUG). Cu un pétrat sint dese'.'nali alinoacizii codi-
ficali de codoni tltferiti care se deosebesc dupé prima bazé.

t22
Fig. 40. Un fragmsn! rlin ARNz de R17'cu co-
donii care specificó dilerifi aminoacizi d.intr-un ,"u À i\'c\tn.
fragmenl at proteinei interne & capsldei. Sec- /u'
<U Ù)
venfa d.e nucleotítle din ARNllerRlT ca gi cea de _ Al
a,minqsqizi 6in proteina capsidei au fost însé to-
tal stabi[te, lenaîcindu-se colinearitatea nucleo- Ir
cr, i A
u l.r.
tJ J
tlde-arnheagizi 9i în acelagi timp veridicitatea Ci
'.C
codonilorflstabilifi prin experiente inclirecte (dupó
Goodenough & Levine, 1974). li-,
- LT
meljU
g
A.rlo'.
A. I
[L
;sn i A
, lire
U _l
In i.J_j
|-A
tr,'ulU
!
i-:-J
iren
Lu G-l
rir [c c lara
In Ul
!U AI
serl[cC
c it'e
GJ.
Lr, Al
iU
rgiG
.A lasn
cl
iC Ul
.-, f-G C |te,"
lillo
''" cr
Lu c

in uitro a fost r,ealizatà princompararea secvenfei de ,amino-


acizi din pnoteina capsidei fagului R17 cu secventa de nucleo-
tide a ARNnz de .R17 în r,egiunea moleculei care dicteazà sin-
teza proúeinei capsidei.
Seevenfa teoreticà, stabilità prin experiente in uitro s-a
consúatat a eorespunde exact cu secventa de amirroacizi din
pr'oùeina capsidei (fig. 40.)

3. CARACTERISTICILE CODULUI GENETIC

Sînt posibili 64 de codoni sau tripleùe potrivit relaliei


43 :64. Dintnc aoestia doi sînt eodonii de inifiere gi anume
AUG $i GUG, care mareheazà începuhrl uo€ii caterte polipep-
tidice. Ei deterrninà initienea oatenei polipeptidice prin fureor-
porarea formilmetioninei la E. coli qi metionfurei la eucarioùe.
Alti trei codoni nu oodificà nici un aminoacid (sînt oodoni
t23
nonsens), ei indicînd însà sfîrgitul unei catene polipeptidice
(codorú sfop). Acegtia sînt codonii ocru- UIAJ{, arnbrd: IIAG
qi azw: UGA. Codonul UGA separà genele în cadrul unui
mesaj genetic policistronic.
Codul genetie are cinci canacùeristici esenfiale: este univer-
sal, neacoperit, fàrà virgule, degenerat gi ambiguu.
Caracterul de uniuersalitate al codului genetic ne aratà
cà r:n anumit codon codificà un acelagi amimoacid. la orice or-
ganism, indiferent de treapta evolutivà pe care se aflà, de la
virusuri pî,nà la om. Prin mutafle codul genetic il'tu se sehimbà;
este schimbatà informalia ereditarà, iar în traducerea acesteia
într-o proteinà mutantà funclioneazà acelagi cod care functjo-
neazà Ei în traducerea informaliei er'editare normale de la tipui
normal (sà,l'batic).
Universalitaùea codului geuretic a fost demonstratà experi-
mental în cazul sintezei proteinice desfàgurarte în sisteme ,ace-
lulare provenite de la ,bacterii qi mamifere sub influenla unui
aeeluiagi ARN,nz sintetizat ,artificial, cînd se oblin aceieaEi
proteine, indiferent dacà sistemul aoelular este provenit de la
bacterie sau de la mamifer. Hemoglobina de iepur,e a putut
fi sintetizatà artificial folosindu-se ribozomii qi ARNnz din
reticulociùe de iepure gi ARNú de E. coli. Experienfele de ingi-
nerie geneticà (prin care gene de la m,amifer pentru insulinà,
pentru hennoglobirlà, pemtru hormonul de cre$tere, pentru o?L-
giotensittd, II precum qi g,ene ritbozomale sau pentru histonà de
la arici de mane qi drosofilà au fost introduse în celula rbacte-
riarrà E. coli) au aràtat cà poate fi dirijatà sinteza de produqi
ge,nici specif,ici eucariotelor, folosindu-se aparatul tbarcterian de
traducere ribozomul. Este dovad,a clarà a universalitàlii co-
- Dar, pro'ba,bil cea mai evidentà dsmourstrare a
dului genetic.
universalitàîii oodului gernetic a fost realizatà de J. Gurdon,
care a puri,ficat ARNnz pentru hemoglo,binà din reticulocite de
iepure gi I-a injectat în ovocite de b,roascà unde aparatul de
sin0ezà proteirnicà, de traducere a mesajului gen,etic al broaEtei
sintetizeazà he,mogl,obinà stabilà de iepure, chiar dacà celulele
ovocitare nu simtetizeazà niciodatà hemoglobinà. Mesajul ge-
netic al oricàrui sistem biologic poate fi tradus de maginària
de traduc€re a .oricàrui alt sis'trem rbiologic. Codul genetic este
deci universal.
Neacoperirea cod,onitor. Codonii succ€sivi, vecini, în oare
se organrz,eazà,,o secventa de nuoleotide a ,unei gene ce speci-
ficà o proteinà da,tà nu se aooperà, nu-qi împrumutà nucleotide,
nu au nici o nucleotidà comunà. Ei reprezintà unitàti de codi-

t24
îrcar'e de sine stàtàtoare, nesuprapuse. De asemenea, între
sfîrEitul unui codon Ei începutul codonului urmàtor nu existà
spalii sau nucleotide. Codui genetic este agadar fàrà virguìe,
lipsind semnalele speciale care sà marcheze sfîrgitul unui codon
qi începutul codonului urmàtor. La fagul cp X 174 gene diferite,
adiacente însà îgi împrumutà nucleotide sau codoni fàrà însà
ca aceqtia sà se suprapunà.
Douà caracteristici ale codonului genetic sînt foarte impor-
tante în traducerea mesajului genetic. Este vorba de degene-
rarea qi arnbiguitatea codului genetic.
Carocterul de degenerare a codului genetic ne aratà cà in
unele cazuri un acel,aqi aminoacid este specificat de mai mulfi
codoni. Astfel, feniltala,nina este specificatà de UUU dar gi d'e
UUC. Serina este specific'atà de 6 oodoni: UCU, UCC, UCA,
UCG, AGU, AGC. Tot astfel leucina este codificatà de 6 codoni:
UUA, UUG, CUA, CUC, CUU, CUG. Dar codonii în care pre-
dominantà este guanin,a (ce determinà aparilia de structuri secun-
dare) sînt de regulà ineficienli în biosinteza proteinicà. Dife-
ri{ii codoni care au însà primele douà nucl.eotide identice pot
specifica acelagi aminoacid. $i aminoacidul argininà este codi-
ficat de 6 triplete. Numai metionina gi triptofanul sînt codificali
de cîte un singur codon (AUG respectiv UGG).
Ambiguitstea codului genctic este redusà. Ambiguitatea în-
seamnà recunoaqterea de càtre antioodonul dintr-un ARNú a
mai multor codoni din ARNm Ei deci posibilitatea ca un codon
sà specifice mai mulli aminoacizi. Astfel codonul AUG este
recunocut atît de càtr,e antictdonul' lui rtFtNúmer (cînd este în
interionrl mesajului cadrului de citire) cît Ei anticodonul lui
ARNúrme' (cînd este I.a- începutul oadrului de citire). Tot la fel,
codonul GUG poate specifica atît formilmetionina cînd este la
începutul cadrului de citire cît gi valina cînd este în interiorul
mesajului.
Amin,oacizii cu proprietàfi structurale similare au tendinfa
de a avea codoni înrudifi. AEa se face cà acidul aspartic qÍ aci-
dul glutamic prezintà codoni similari GAU gi GAC în primul
caz, respectiv GAA Ei GAG în al doilea caz. Tot astfel amino-
acizii aromatici fenilalanina, tirozina qi triptofanul sînt codifi-
cali de triplete care încep cu U. Se admite cà aceastà proprie-
tate de oodificare a fost stabilità în decursul evolufiei, ea pre-
zentînd avantaje errolutive càci înlocuirea prin mutalie a unui
aminoacid cu altul în catena polipeptidicà este cu atît mai
pufin dàunàtoare cu cît aminoacizii înlocuifi au proprietàli

725
5' Acfl

ARNrn ( codoni)

Anticcdoni drn
AFìr\{i

Fig. 41. Decodificarea informaliei ered.itare (complementa-


ritatea qi antipolaritatea tripletelor rtin ADN, codonilor din
ARNza.gi a anticodonilor din ARNú).

mai asemànàtoare, ceea ce face ca proteina mutantà sà poatà


fi încà funclionalà.
Crick a elarborat ipoteza oscildrii (utobbte) spre a explica
ambiguitatea. Astfel, U aflat în pozifia a 3-a în tripleta antico-
donului, la capàtul 5' al acestuia se poate împerechea atît cu
A cît qi cu G. Astfel, primel,e douà nucleotide sînt cele rnai
semnificative $i mai exacte în codiîrcare, pe cînd cea de-a
treia bazà a codonului este oscilantà. Flexibilitatea celei de-a
treia baze a unui codon a prezentat de asemenea avantaje se-
lective minimalizînd consecinfele erorilor.
În cadrul interacfiunii codon-an'ticodon (fig. 4l) interac-
lioneazà mai întîi nucleotid,a capàtul,ui 5' al codonului cu nu-
cleotida capétului 3' al anticodonulrui. În al doilea rînd inter-
aclioneazà nucleotidele plasate la mijlocul codo'nului qi antico-
donului. Dupà Criok, se admite cà, odatà împerecheate primele
d'ouà baze, cea de-a treia bazà, din codon Ei anticodon prezintà
o oarecare oscilalie în împerechere. Astfe1 baza purinicà ino-
szrzo (I) car€ prezintà proprietàli strueturale asemànàtoane gua-
ninei se aflà în unii anticodoni qi se poate împerechea în mod
normal cu citozfura (C) din codonul ARNrn. Cînd însà I ocupà
pozilia a treia in anticodon ea se poate împerechea cu U sau cu
A aflate în pozifia a treia în codonul ARNrn. Asemenea împe-
recheri de baze se numesc perechi de boze oscil.onte (wobbl,e).
O moieculà de ARNú ce ar€ ataEatà serina qi avînd anticodonul

L26
3'-AGf-5' va interacgiona cu codourii ARNm pentru serinà
UCC, UCU, qi UCA. Tot astfel U plasat în pozifia a treia în
anticodon se poate împerechea atît cu A cît gi cu G plasali în
pozilia a treia în eodonul ARNrz.
Regulile,,wobbler pentru împerecherea codon-anticodon
atestà existenfa a numai 54 anúicodoni care sà se împerechgze
cu 61 codoni deoarece baza A nu se aflà miciodatà în prima
pozitie a anticodonilor. Absenfa lui A din prima pozifie a tu-
tur,or an,ticodonilor cunoscufi se crede cà este rezul,tatul acfiunii
dezsrninazei anticodonale care schimbà adenina la hipoxan'tinà,
antiaodonii care încep cu inozina (I) fiind caracteristici amino-
acizilor care sînt codificafi de mai mult de doi codoni aqa cum
este valina (Jukes, 1977). Absenla unui antioodon IAA penúru
femilalaninà se explicà prin elúminarea sa din cauza letaiitàlii
càci s-ar putea ,,împerechea greqit( cu UUA (teucinà) qi cu atfi
oodoni ce specificà cu totul,a$i aminoacizi. Jukes apreciazà cà
mai curînd dezaminarea anticodonukri gi nu ,,oscilarea( explicà
de ce nu se întîlnesc 61 tipuri de ARNú.
Unii anticodoni din moleculele ARNú confin baze modificate
în pozifia I, altele decît hipoxantina. Asemenea modificàri mà-
rese oscilarea codon-anticodon fàrà insa a genera ambiguitate
în îurcorporarea amilroacizilor în timpul sin'tezei polipeptidice.
Eaolugia cod,ului. Universalitatea codul'tri genetic la organis-
mele acttrale este un indiciu pe de o parte a vechimii sale, iar
pe de alta cà e} a ràmas, neschimbat în cursul evolugiei. S-au
emis douà ipoteze cane ar explica aceste aspecte: ipoteza ste-
r*shimicà gi ipoteza accidentul,ui înghefat.
Ipoteza stereoelti.micd admite existenfa unei relafli sterice
dintre codon, respeetiv anticodon qi arninoacidul specificat.
Stebilitatea evolutivà a codului ca gi struetura sa au derivat
din stereochimia preordonatà a elementelor saùe.
Ipotem accidenhúui înghefat admite cà structura codului
genetic a evoluat prin hazard dar, din momentul în care în ce-
lula ancestralà comunà ,tuturor formelor prezente actuale au
fost stabilite relaliile exacte de codificar,e, acestea au devenit
vitale, încît o evolufi.e ulterioarà a codului a devenit imposi-
bilà. Orice mutalie în relafiile de codificare a devenit letatà
pentru individul biologic l,a care ac€asta a apànrt.
Prima ipotezà nu es'te probatà de experienlele în care ala-
nina ataqa,tà la ARNú pentru cisteinà a fost inclusà în catena
pol,ipeptidicà în locul cistein,ei. Aceasta aratà cà aminoaeidul nu
este ,,vànat( de codonul din ARNrn în etapa de asamblare a
polipeptidutui. Sînt date care araúà cà aminòacidul'nu este re-

721
cunoscut de càtre anticodon în etapa de activare a amrnoacidu-
lui. Este însà foarte prdbabil ca asemenea nelafii stereochimice
sà fi fost de mare importanfà în etapa timpurie ,a istoriei vielii
înainte chiar de apari\ía aminmcil-ARNt sinbetazelor, ca,re au
înaltà specificitate ca Ei înainte de aparifia însàgi a adaptorului
ARNú. Sinteza proteinicà 1a început, dupà Crick qi Woese a fost
un pnoces imprecis, desfàgurat cu un grad scà2t de speeifici-
tate funclionalà, în proteinele protoorganismelor putînd intra
oricare dintre amin,oacizii unui gnrp care sirr-t similari struc-
tural. De exemplu, unul qi aoelaEi codon ar fi putut specifica
alanina qi glicina, ,al'tul treonina qi serina. În oodonii tripleli
ambigui primitivi numai primele douà nucleotide participa în
realitate în procesui, de recunoaqtere. Ulterior, cea de a tneia
urueleotidà a fost inclusà în procesul de recunoajqtere deqi la un
nivel mai scàzut de specificitate decît cea admisà prin ipoteza
oscilàrii.
Ipoteza accidentului înghefat este pe de o parte dificil de
respins Ei pe de altà parte gr,eu de sprijinit cu date actuale.

4. BTOSINTEZA PROTEINICA.

Proteinele joacà un rol cheie în meta,bolismul ceiular. În-


sàqi func{ia materialul,ui ereditar este condifionatà de funcfio-
narea proteinelor cu rol enzim'atic sau structural. Enrzimele
participà la replicarqea ADN gi ARN, la transcrierea genetica
etc. Proteinele structurale intrà în structura cromatinei, în
componenla membranelor, a altor componente oelulare qi par-
ticipà la asamblarea însàgi a ribozomilor. Toate r,eacliile chi-
mice din celulà sînú cartalizate de regulà cle ,enzime. Enzimele
proteine tipice participà în însàqi sinteza proteinicà. Ast-
-fel, cîteva sute de- molecule de diferite proteine sînt necesare
pentru sinteza unui sin,gur lan! polipeptidic. Este o reînnoità
povarà pentru celulà sà sintetizeze o catenà polipeptidicà, dar
ea este cerutà de o traducere exactà a mesajului genetic.
Proteinele sînt polimeri de aminoacizi.
Toli aminoacizii, cu exceplia prolinei, au o structurà de
bazi comunà, prezentînd un radical R, o grupare COOH Ei o
grupare NHz. Prolina are doar gruparea COOH Ei un atom de N
inclus in radical. Unii arninoacizi sînt b,azici (iizina, arginina qi
histidina). Lizina poartà un rest NHz în cadrul radicalului.

L2B
Acest rest are tendinfa de a accepta protoni devenind
Alfi aminoacizi sînt acizi purtînd la nivelul radiea'lului-NHt.
resturi
COOH care au tendinla de a pierde protoni. Existà Ei amin,o-
acizi aromatici care prezintà inele nesaturate de carbon în ra-
dicaiii lor. Doi aminoacizi poartà un atom de sulf în radical
(cisteina, metionin,a).
Legarea aminoacizil'or între ei (polimerizarea) se face în
urma inter,acliunii grupu,lui a-NH2 al, unui a,tninoiacid cu gru-
pui a-COOH al celui de-al doilea aminoacid cu elirberarea unei
OH
ilt
molecule d,e apà. Se formeazà, o legàturà peptidicà A-C-N-.
Prin polimerizarea aminoacizil'or rezultà o ca,tenà polipeptidicà
care are un schelet de N qi C sub formà de zig-zag analog schele-
tului glucido-fosforic al catenei polinucleotidice cu radicalii R
proiectafi în afarà într-o manierà alternativa.
Distribuirea liniarà a aminoacizilor în caúena polipeptidicà
reprezintà stu:uotura primarà a potrifptídei oonsideratà. fn a,nu-
mite condilii fiziologice, de temperaturà sau de pH ,Er€ ioc
interacfiunea diferililor aminoacizi din catena polipepticlicà
prin intermediul unor punti de H, al, unor legàhrri bisulfidice
(S-S) clucînd la configuralii spafiale bi- sau tridirnensi,o-
naie. Prin punîi de hidrogen dintre aminoacizi vecini rezultà
o structurà secundarà regulatà numità aonfigura{ia u-helix, ai
càrei modei a fost elaiborat pentru prima datà de càtre 1,. Pau-.
Iing înainte de 1940.
Proteinele pot fi alcàtuite dintr-o singurà catenà polipepti-
clicà (mioglo,bina, histonetre, ADN-polimeraza etc.) sau din 2, 3
sau n catene polipeptidice în care caz ele prezintà o str"ncturà
cuaternarà. Astfel, hemoglobina ,este alcàtuità din patru catene
polipeptidice separate numite globine, douà catene cú Ei douà
cate'ne B, rasociate într-un mod complex. ARN polimeraza de E.
coli este o proteinà oligomericà alcàtuità din 6 subunitàli poli-
peplidice.

4.1. DESFASURATiEA pnocnsur,ur DE BrosrnrnzÀ


I'ROTEINICA

Ribozomii joacà un rol esen!Íal în ibiosin't'ez.a proieinicà, adi-


cà în decodificarea informafiei genetice. Ei condili'oneazà in-
teracfiunea speciflcà, codon-onticodun, fapt evidenliat prin eln-

$ - Dr:;cifrind tainele ereditatii, vol. I 129


perient€ în care s-a urmàrit ac{iunea streptomicinei. S-a con-
statat cà acest antibiotic poate altera procesul de decoriilicare
a ARNnr. Streptomicina reduce de trei ori rata de încolpcrare
a fenilalaninei în polifenÍi'alaninà cînd se folosegte un sistem
acelular de sintezà proteinicà în care în calitate cle AIìirTr:i. est'e
utilizat poli-U. Reducerea ratei de încorporare rr fenilai.aninei
este însà înso{ità de încorporarea leucinei (CLTTJ), izoleucinei
(AUU), tirozin,ei (UAU) qi serinei (UCU). Con:luzia e.ste cà pre-
zenfa streptomicinei permite altor tipuri de ARNú, altele decît
ARNú legitim pentru fenilalaninà sàr ràspundà Ia codonii tlUU
în traduc€rea ARNm poli-U. Citirea greqità a codului genetic
este determinatà de interacliunea streptomicinei cu ribozomii
din am,esúecul d.e re,ac{ie a sistemului acelular de sintezà pro-
teinicà. Situl de acliune al streptomicinei este subunitatea ribo-
zomalà 30 S, fapt dovedit de experiente de asamblare a parti-
culelor ri'bozomale din subunitàîi 30 S de la tipul mutant re
zistent la streptomicinà gi subr.rrnitàti 50 S de Ia tipul nornnal
sensirbil. Asemenea ribozomi sub acfiunea streptomicinei nu
condifioneazà o citire greqità a mesagerului genetic. Nomura a
efectuat experienfe de disociere a subunitàtilor 30 S extrase
de Ia bacterii rezistente qi de la ,bacúerii sensi'bile la strepto-
miein^à qi a separat proteinele ribozomale din aceastà subuni-
tate (21 proteine ribozomale S) prin eL,ectroforezà,. Dupa 6ceea
a reconstituit suibunitati rirbozomale 30 S prin amestecarea de
variate combinafii ale celor 2L de proteine ribozomale S cu mo-
lecule de ARNr 16 S. Subunità{ile 30 S reconsti,tuite au fost
amestecate cu subunitàîi 50 S gi au rezultat ribozomi care au
fost folosifi în sisteme acelulare de sintezà proteinicà. Nomura
a constatat cà sensibilitaúea sau rezistenla ribozomilor recon-
stituili la citirea greqità indusa de streptomicinà a mesajului
genetic confinut de ARNnz depinde în întrqgime de faptul dacà
o singurà proteinà ribozomalà S, qi anume proteina ribozomalà
S12, derivà de Ia subunitàti 30 S a'le rbacteriilor streptomicino-
sensi'bile sau streptomicino nezistente. La formele sensi,bile ia
streptomicinà, acest antitbiotic se combinà cu douà situri din
ARNr 16 S blocînd sinteza proteinicà. Tulpinele rbacteriea-re re-
zistente la streptomicinà au proteina Srz modificatà, ceea ce
face sà fie ascunse cele douà situri de legare a streptomicinei.
Dovada, suplimentarà cà proteina ribozomalà S12 participà în
procesul de recunoaqtere codon-anticodon a fost adusà de con-
statarea cà unii supresorÍ nonsens care sînt eficienfi ]a tipul
sàlbatic, normal streptomicino-sensitbil sînt ineficien{i la mu-
tan$ii streptomicino-rezistenfi. Secven]ier'ea aminoacizilor pro-

130
teinei ri'bozomale Srz a evidenliat faptul cà la tiput str,epto-
micino-rezistent apar substítufii de a,minoacizi în pozifiile 42
sau 87. Iatà deci cà o simpla substitutrie de aminoacizi în oa-
tena polipeptidicà Srz interferà cu fidelitatea cu car€ oodonii
ARNm sînt împerecheafi cu anticodonii ARNú în procesul de-
oodificàrii mesajului genetic. Desfàqurarea procesului de bio-
sintezà proúeinicà presupune inifierea, alungirea qi terminarea
catenei ca qi în cazul sintezei polinucleotidelor

4.I.I. INITIEREA CATENEI POLIPEPTIDICE

Catena polipeptidicà ,este sintetizatà treptat înoepînd cu un


arnin,oacid N-terminal qi terminùrd cu un aminoacid C-termi-
nal. ARNrr, care poartA mesa{ul peurtru sinteza unei catene po-
lipeptidice qi care deci dicteaza secventa de aminoacin a aces-
teia este citit stadial de càtre aparatul de sinúezà protefuricà,
cîte un codon la fiecare moment, începî:rd de la capà,tul 5' spre
capàtul 3', fiecare oodon fiind r€cunoscu,t de catre antioodonul
cor,espunzàtot din ARNú, aoesta din urmà purtînd un aminoacid
corespunzàlot codonului dfut ARNm. Zamecnik gi Hoaglancl au
ajuns la concluzia cà prima etapà în biosin,tez,a proteinicà este
activarea aminoacizilor cu ATP catalizatà de càtre enzime orni-
noaeilsinúetnze specifiee fiecàrui aminoacid. Ac,este enzime au
fost descoperite de càtre Paul Berg de l,a Standford University.
Ele se mai numesc amino-orcil-ARNú-sizúefuze qi reprezintà fac-
torii celulari care ,,cunoscc eodul genetic, deqi însàgi secvenla
lor Ce aminoacizi este codificatà în ADN.
Aminoacizii nu se ataqeazà direct la matrileùe ARNmciprin
interrnediul ARNú care repr,ezintà o moleanld adaptmre de ra-
cordare specificà, recunoaqterea oodon-anúicodon avînd loc pe
principiul împerecherii de baze complementare cu f,ormare de
punli temporar,e de hidrogen. AtaEarea aminoacidului la adap-
tor ,este catalizatà de enzima amirwacilsintetozd care foloseEte
e'nergia rezultatà prin hidroliza ATP. Enzima se ataEeazà tra
gruparea lateralà a aminoacidului (fiecare aminoacid are en-
zima sa specificà de activare) Ei Ia molecula adaptorului (bucla
a patra a dihidrouracilului). Aminoacidul, (AA) se combinà la
început cu ATP. Înúre fosfatul din AMP qi grupul carbonil al
aminoacidului se realizeazà. o legàturà (-P-O-C-) sta,bilà,
rezultÌnd produsul intermediar AA "., AMP. Acesta se leagà
ferm de enzima activatoare pînà ee se întîlneEte cu o moleculà

131
de ARNú specificà, corespunzàtoare amirroacidului re-cpectiv.
Între riboza adenozinei terminale a gruparii CCA de la capàtuÌ
3' a,l ARNú gi gruparea canboxilicà a aminoacidului se stabileîte
sub cataliza aceleiaqi enzime aminoacilsintetaza o legàturà
-covaltentà, macr@rglcà. Energia pusà 1a dispozilia -acestei legà-
turi de càtre ATP va fi folosità în formarea legàturii pepti-
dice.
Evenimentele de activare a aminoacidului pot fi astfel re-
prezentate:

aminoacilsintetaza
r AAl +ATP (AA, - AIIP)Er*@-@.
aminoacilsintetaza
II (AA, - AMP)+ARlrll AAr - ARNtr+ AMP.

Legatura AA ARNú de tip (-C-O-C-) se stabileqte


- aderrilic terminal aI, grupàrii CCA-3' gi
între riboza acidului
grupul carbonil al aminoacidului. Iatà de ce aminoacidul nu
trebuie sà ajungà niciodatà pe matrifa ARNm. El trelbuie numai
sà se ataqeze corect la un ARNú corespunzàtor l,ui. Dacà are
loc ata$area gregità a unui aminoacid la un ARNú care nu îi
este specific (de exemplu prolina se atageazà la ARNf peurtru
fenilalaninà) intervine ARNú sintetazn pentru fenilalaninà care
face ca prin hidrolizà prolina sa fie eliminatà. AmÍnoacil-ARNt
sintetrc,a este la rîndul sàu recunoseutà (sau recunoagte) bucla
dihidrouracil a ARNú, care este diferità la diferitele tipuri de
ARNf de unde qi explica{ia specificitàfii arninmxil-ARNf-sin-
tetozd-ARNú.
Degi exista mai multe tipuri de ARNú pentru un acelaEi
aminoacid, din cîte se cunoaqte pîlrà acum exista doar o sin-
gurà aminoa,cit-ARNú sintetvzd pentru fiecare aminoacid.
Aminoacilarea ARNú catalúzatà de aceste enzime trebuie sà
fie controlatà cu extraordinara precizie càci o încàrcar',e gre-
$ità a unui ARNú eu un aminoacid necorespunzator lui are
aceeaqi valoare ca mutafia, fiind inserat tn catena polipeptidicà
ln creqtere un aminoacid gregit (Sdrimmel, 1979). A devenit
astfel clar cà ARNú este implicat în reglarea expresiei genice
càci concentrafia de aminoacil-ARNú serveqte ca semnal, pen-
tru intrarea sau scoaterea din funcliune a diferitelor gene, in-
tervenind în tnanscrierea genicà la un sit dintre promotor gi
prima genà siructuralà (vezi reglajul genetic). Deoarece sinte-

732
taeele eatalízeazà aminoacilarea ARNf ele sînt direct sau in-
direct irnplicate în reglarea expresiei anumitor gene.
Ataqarea unui aminoacid la ARNf specific este evenimentul
în cursul càruia informalia din acidul nucleic este confruntatà
cu aminoacidui pentru prima datà.
Froblema recunoaqterii aminoacid-ARNú este încà departe
de a fi clarifîcatà. Ea este însà extrem de precisà cle vreme ce
schimbarea numai a unei baze azotate din secvenla ARNú afec-
tcazà proprietàlile de recunoagtere ale acestuia.
Bucla GTìI'CG a ARNú se împerecheazà prin baze cu o -sec-
ventà complementarà din ARNr 5 S qi aceasta pare a fi regiu-
nea responsabilà pentru ataEarea la ribozom a ARNú încàrcert
cu aminoacidul activat. Lungimea constantà de I'a capàtul
3' al ARNú la bucla opusà a frunzei de trifoi se presu-
-CCA
pune a fi în legàturà cu pozi$ionarea corectà a aminoacizilor în
vederea formàrii punlilor peptidice.
A treia etapd în inilierea sintezei pr.oteinice se desfàEoarà
pe ribozom. Acesta are suprafefe specifice de legare stereo-
ctrimicà corespunzàtoare a ARNm, a AA-ARNf gi a lanfului
polipeptidic în creqtere. Rirbozomul asigurà de a$a mani,erà
asocierea acestor elemente astfel încît anticodonul sà poatà
recunoagte codonul corespunzàtor ducînd astfel la o corectà
descifrqre a mesa$ului genetic. Nu se Etie exact care din com-
ponentele ribozomale (proteine ribozomaie sau ARNr) îndepli-
neqte rolul esenfia'l în înlesnirea apoziliei corecte a ARNnz gi
a ARNú, dar recent s-a stabilit cà proteina ri,bozomalà con-
tractilà 51 are capacitatea de a determina deplierea ARNn in
vederea interacfiunii sale cu rirbozomii, legînd apoi ARNnr la
subunitatea 30 S (Blumenthal Ei Carmichtetr, 1979). Ea se leagà
ln ribozom la capàtul 3' al ARNr 16 S, dar în ribozomi activi
ea se aflà la un sit diferit. Avînd o greutate molecularà micà
(70.000 daltoni) se admite cà proteina 51 func{ioneazà, în con-
formalie alungità.
Descifrarea mesajuiui genetic determinà traducerea sa în-
tr-o secven!à de aminoacizi asambla{i într-o cat,enà pol,ipepti-
dicà. Înainùe de a începe sinteza polipeptidului riibozomul se
disociazà în subunitàlile sale sub aefiunea factorului de inifi,ere
fF.1. ln cadrul formàrii complexului'de ini{iere ARNrn se leagà
de subunitatea ribozomalà 30 S prin secvenfa sa Leader care
nu este tradusà. Apoi are loc asamblarea particulei ribozornale
funclionale prin atagarea subunitàlii ribozomale mari 50 S.
Aminoacil-ARNú se asociazà cu subunitat,ea 50 S a ribozo-
mului. Subunitatea 50 S are douà situri: unul a fost desemnat

133
situl amirwacil (A) qi în el pàtrunde aminoacil-ARNf corespun-
zàtor codonului din ARNm recunoscut, prin anticodonul din
ARNú qi al doilea sit a fost des,emnat situl peptidil (P) aare ac-
ceptà moleculele de ARNú numai dacà au trecut prin situl
aminoacil, (complexul aminoacil-ARNú trecut prin situl' A su-
ferà probabil modificàri conformalionale care permit accepta-
rea sa in situl P). Ini{i'er,e,a propriu-zisà a catenef lpolipeptidice
are loc atunci cînd situl A aL unui ribozom expune reacliei de
recunoagtere codon-anticodon acel codon de inifiere AUG din
ARNrn. Acest codon de iniliere corespunde primului .amino-
acid din catena polipeptidicà. Sitlrl A este ocupat în iniliere de
un ARNt pen,tru formilmetioninà la pr.ocari,ote sau metioninà
1,€r €ucariote, care prirn anitioodonui sàu 3' UAC 5' recunoaqte
codonul iniliator 5' AUG 3' din ARNrzr.. Acest ARNI are ata-
Eat aminoacidul formilmetioninà respectiv metioninà. Dupà re-
cunoasterea codon-anticodon, ARNú care are ataqat primul
aminoaci.d al catenei potipeptidice se deplaseazà În sittll P,
miEcare realizatà prin înaintarea ARNrn prin ri,bozom sau in-
.rer:., prin înaintarba ri,bozomului pe ARNm (miqoare de trans-
la!ie), ceea ce face ca situl aminoacil, sà vinà în dreptul urmà-
torului codon din ARNrn. Se înlelege cà miEcarea de translafie
se face de fiecare datà pe o distan!à ce corespunde la un codon.
Toate catenele polipeptidice înoep cu aminoacidul metioninà.
La procariote toate catenele polipeptidice incep cu N-formil-
metionins, car€ este astfei un aminoacid ,blocat de grupul for-
mit. Dupà sinteza pofipeptidei, grupare,a forrmil poa'te fi elimi-
natà. Metionina .este specifica,tà de codonul 5'-AUG-3' din
ARNzzz, recunoscut de anticodonuL din ARNt'er si acest
{ftxr1met este un ARNf de inilier,e.
Principiui citirii codonului de càtre anticodon est'e urmàto-
rul: dacà un codon din ARNrn este 5'-UUG-3' el va fi recu-
noscut de càtre un, anticodon din ARNú scris în dir,ec{ira inver-
3'-AAC_.5'.
sà adicà
Atît metionina cît qi formilmetionina au ca anticodon 5'-
CAU-3'care se va împerechea cu codonul 5'-AUG-3'qi
acest oodon AUG reprezintà codon de ini{iere. Deqi codonul
AUG poate fi localizat Ei în interiorul monocatenei ARNm,
ARNf de iniliere (iARNt'"') are afinitate rr-umai pentru codonul
AUG localizat la capàtul monocatenei ARNm, sau acest codon
de inifiere este clispus pe un segment din ARNTa a). o structurà
secundarà proeminentà de tip buclà (lwirpin)"
În cadrul inilierii (fig. 42) evenimentele se deruleazà. astfel:
o subunitate ribozomaià micà imteraclioneazà cu un codon ds

134
lormor€o complcrufui
cle inilicrt
ilctori dc initìtfe ARNm
ARNtr-md) '

tronslocotio
ologoco subunitòtiì ARNÍ'm't î; situt
pcptidil ínsotitó or
deplosorro r'r5oro-
mutui AFNm
J
sit omhoocil

t go?co ARNi'u #
corc vineîn iitut l\
(blori dcchngotic)

o
Fig. a2. Schema sintezei proteinice. Decodificarea mesajului genetic începe eu
cítirea codoaului de iniliere.{.UG de cAhe ARNf'-tt Si se terminà cu codonul de
terminare UAA. Codonul AUG în mod obignuit nu este plasat exact la capAtul
5' al ARNmr ci el este precedat de un rrurrAr de alte nucleotide, dar el ocupà o
pozilie specifica pe cateua ARNzr putînd fi recunoscut. Tot astfel codonul
tenniuator UAA nu este îu mod obligatoríu ultimul codon din macromolecula
AR.Nza. TJneori aceeagi moleculà ARNz posedà mai mulli codoni de iniliere gi
codoni terminatori condifionînd sinteza mai multot catene polipeptidice. În cazul

135
tronscriereo ARNte
--.--_.--.-----.
ce conline pcptido
tq sttui P

r la€oreo fiotaculc; continuorco etop?loî


aRnrtFt" A* grecedentc pcntru f iccore
"firl codon ARNm Pînó cc tsta
otins codonul tcrmrnoîor
(UAA, UAG, UGA)

tlr
@,iu
f.met

5ffi f"
dlsoctcr?o
+
rìbolomutra

I
etiberoiso .>

Itî
coteF€'r oolixDddrce I
\
tb"
t.incr
,
tCu
t lr|cl
o
ARì{rz care specificà prote'ruele triptofansintetazei la E. coli, codonul de terml-
nare,peglnl gena trp B cstc pattial folosit drept codon de inifiere pentru gena
trp A (UGAUG). Transferarea aminoacil-ARN, din situl A în situl P este însofltl
de s schimbarea conformatiei spafiale a moleculei sale (dupà Strickberger, lg70).

ini{iere AUG qi cu un iARNt*et, caîe poartà deci metionina. Se


formeazà u,n complex metioni,I-t-ARNfo AtlG numit compler,
de ini[iere: Formar,ea oompJexului de initiere implicà interven-
fra a trei factori proteinici de inifi,ere care au fost desemnafi
IFL, IF2 gi 1F3. Rolul exact al acestor fac"tori nu este cunoscut.
IF3 împiedicà asocierea subu,nitàfiùor ribozomale 30 S qi 50 S,
cînd ribozomul nu este angajat în sinteza proteinicà. Bner,gia ne-

136
c€sarà în inifiere este eliberatà prin hidroliza u,nei molecule de
GTP car,e este qi ea considera,tà facùor de ini{iere aúunci cînd se
leagà la fmet-ARNú fàrà a fi hidrolizat. Complexul de inifiere
se asociazà apoi cu o subunitate ri,bozomalà mare (reac{ie care
necesità potasiu), rezultînd ribozomul funcgional (70 S la pro-
cariote qi B0 S la eucarioùe). Din asocierea ARNr-ARNrn se
delimiteazà în subunitatea mare a ribozomului douà situri
ominoacil (A) Ei peptidil (P). În momentul asam;blàrii particuiei
ribozomale funcfionale ARNm este relinut într-o adînciturà
rezultatà din pozilia ceLor douà subunitàli rirbozomale. ARNm
expune în situl A codonul iniliator AUG oare va permite pà-
trr:rrderea în aeest sit a ARNú inifiator JMet ARNtt^"t. IFz
-
aclioneazà apoi ca translocozd. care ca'talizeazà translocafia fmet
O**1tmet Ei regiunea corespunzàtoare codonului AUG din
ARNnz din situl A în situl P. Reacfia necesità energie eliberatà
din hidr'oliza GTP. Translocarea elibereazà situl A care va pU-
tea agc€p1s alt AA ARNú corespunzàtor noului codon din
ARNrn. Astfel, ARNú - funclioneazà nu numai ca un càràug de
aminoacizi la ribozomi dar Ei ca mol'eculà adapùoare care sec-
venliazà aminoaeizii în catena polipeptidicà potrivit instmc-
fiunilor date de ARNnz.

4.7.2. ALU N GINEA CATEN EI POLIPEPTIDICE

De îndatà ce a avut loc ini{ierea ca,úenei polipeptidice prin


alinierea codonului iniliator AUG cu antioodonul metionil
-
iARNún''"' gi formarea unei particule rib,ozomale complete, acti-
và în sinteza proùeinicà, situi P al ribozomului este ocupat de
iARNúmeriar situl A este liber sà primeascà al doilea aminoacil
ARNú cor€spunzàbor celui de-al d,oilea codon din ARNm.
Palticula ribozomalà se deplaseazà pe monocatena ARNm, care
îgi expune astfel succesiv codonii spre a fi r'ecunoscu{i de anti-
codonul diferi{ilor ARNú. Legarea aminoacit-ARNf la situl A
este catalízatà de un factor proteinic ? care foloseqte de ase-
menea energia eliberatà de GTP.
La nivelul sitului P, grupul, a-COOH pàràseqúe legàtura
cu ARNú qi formeazà o legàturà peptidicà cu grupul a,-NH2
al aminoacidului legat de ARNú intnaú în situl A. îrecerea
aminoacidului de la legàtura cu ARNú la legàtura peptidicà se
realize'azà, prin intervenfia enzimet, peptidiltrmsfemzd, legatà

137
de subunitatea mare a ribozomului. Form'area legàturii pepti-
dice este catalizatà de enzima peptidilplimnrazd, sau amino-
acid-polim.erazd. localizatà pe subunitatea mare a ribozomului,
Se formeazà un dipepticl, iar ARNf din situl P ràmîne fàrà
aminoacid Ei pàràsegte ribozomul, al doilea ARNú purtînd d,oi
aminoacizi unili printr-o legàturà peptidicà (un rest dipeptid)
trece din situl A qi intrà în situl P. Aceastà trecere din situl A
în situi P, condifionatà de formarea legàturii peptidice a ARNú
se numeEte úronslocaf,ie (fie. a2). Ea 'este m'ediatà de un factor
proúeinic numit G a càrui acfiune este dependentà de 'energia
eliberatà prin hidroliza GTP, ca gi de o notaibilà modificare
conformalionalà a structurii rib,ozomului. Totodatà ri,bozomul
se deplaseazà pe ARNrn pe o distan{à echivalentà cu un co-
don. Noul codon va ajunge la nivelul sitului A, unde va pà-
trunde un nou aminoacil ARNf cu un anticodon corespun-
zitor. Pe màsurà ce ribozomul- se miEcà în direclia 5'-+3',
de-a lungul catenei ARNrn'are loc alungirea catenei polipepti-
dice qi totodatà descifrarea mesajului genetic din ARNm. Cer
cetàrile lui Fritz Lipmann au aràtat cà în procesul de asam-
blare a aminoacizilor intervin trei tipuri diferite de proteine
care s-au numit fo,ctori de elongofie gi au fost desemnafi
EF-'Lu, EF-?" qi EF-G. Acegtia sînt compon,ente structurale
ale ri,bozomului qi se ataEeazà la particula ribozomalà maturà
doar în faza de funcfionare a aoesteia în asamblanea aminoaci-
zilor in catena polipeptidicà.
La E. coli, EF-T, Ei ET-T, reprezintà 50/o din proteina
solubilà Ei participà în transferul aminoacil-ARNt La situl
aminoacil al ribozomului. Factorul EF_?, faciliteazà 'forma-
rea unui complex dintre f,acúorul EF-T", aminoacil-ARNú qi
GTP. Ribozomul care poartà un peptidil-ARN't, în situl sàu P
acceptà acest complex la situl sàu a,minoacil. Cînd are loc for-
marea ì.egàturii peptidice EF-T" este eliber,at iar GTP este
hidrolizat spre a da GDP qi fosfat cu ,eliberare de energie. Fac-
torul EF-G participà in tr,,anslocarea (miqcarea d.e transla{ie) a
ARN'm pe ribozom spre a fi expus urmàúorul aodon in situl A.
Transl,ocarea implicà consum de enrergie derivatà din hidroliza
unei molecule de GTP în GDP Si P. Elongarea însàqi a eate-
nei polipeptidice nu necesiúà energia eliberatà prin hidroliza
GTP, de'oar,ece energia liberà înmagazinatà în legàtura amino-
acil-ARNf este suficient de mane spre a conduce la formarea
puntii peptidice.
GTP acfioneazà agadar ca urì factor alosteric a càrui combi-
nare cu proteina EF-T" determinà o modÍficare conforma-

138
lionalà a factorului EF-T, care permite amino-actl-ARNú sà
se lege I'a situl ribozomal cerespunzàtor. Dupà e}ongarea cate-
nei polipeptidice nàscînde, GTP este hidrolizat fàcînd ca
EF-T" sà revinà la conformafia inilia1à qi sà se desprindà de
pe ribozom.
Iatà reacfiil'e în care factorii de elongalie sînt implica{i în
alungirea catenei polipeptidice (Blumenthal gi Carmichael,
1e7e):

EF T,, . GTP I aaAF.N, s EF' Tn . aaARNr' GTP


- -
EF - Tu . aaARN, . GTP f ribozom 5 ribozom . aaARN, *
+EF-T,,.GDP+PP
EF - To . GDP + EF - T, $EF - Tu . T" -f GDP
EF - T. . T. + GTP rsEF - T"' GTP + EF - T".
Viteza de polimerizare a aminoacizilor este de 15 amino-
aclzi pe secundà. Dupà ce un ri;bozom a tradus aproximativ
25 codoni capàtul 5' al ARNrn devine liber spr€ a forma un
al doilea complex de inifiere qi un al doilea ribozom începe
miqcarea de-a lungul catenei ARNnz, determinînd siurúeza unei
a doua catene polipeptidice, apoi un al treilea, al patrulea ri-
bozom q.a.m.d
Prin ataEarea mai multor ribozomi la catena ARNm rgzultà
o structurà numità poliribuotu Structura poliriibozomalà con-
dilioneazà sintez.a simultanà a numeroase ca'terne poUpeptidice
care au dirnensiuni diferite la un moment dat, în funcfie de
distanfa pe care fiecare ribozom a parcurc+ de la capàtul 5'
spre capàtul 3' al. catenei ARNm.
La procariote transerierca (sinteza ARNnt) gi traducerea me-
sajului (sinteza proteinicà) au loc simultan, Ei înainte ca sà se
ùermine sinteza AIlNrn, capàtul sàu 5' devine asociat cu ribozo-
mul spre a forma un compler dc i,nifiere (fig. 42b).
La euoariote transcrierea are troc în nucleu iar tr'aducerea
în citoplasmà unde se aflà ribozomii. Existà o specificiúate a
activitàlii ribozomilor în sinteza proteinicà care ar reprezenta
o modalitate de reglare a activitàfii genelor la nivelul tradu-
cerii. Astfel, în sistemele de sintezà proúeinicà in uitro (ace-
iularà) se consta,tà eà ribozomii izolali din oelulele interfazice
sînt mai activi decît cei izolali din celule aflate în diviziune.
În c,elulele hepatice, ribozomii ataqafi la reticulul endoplasmic
139
s€rvesc pentru sinúeza proteineloor serice pe cînd cei liberi ser-
vesc la sinteza proteinelor hepatice specifice neserice.
Alurgirea catenei polipeptidiee poate fi schematizatà astfelr

AA1 - ARlill * AA, - ARNú'#


- GTP AA1 - AA2 -
- ARNI2 + ARI{lr.
Atagarea ribozomilor la monocatena ARNrn facilit eazà, piis-
trarea structurii liniare, monocaterrar,e a ARNnz, favora,bila
unei citiri corecte a mesajului, unei decodificàri corespunzà-
toare. Îrr'- cazul în care pe parcursul catenei ARNnr apar re-
giuni dublu-catenare ribozomii le desfac spre a permite o
corectà selecfionare a AA^,i.{RNú.
Lungimea moleculelor ARNnz este heterogenà, depinzînd dr
màrimea mesajului genetic purtat. Ia E. coli màrimea medie a
ARNrn este de 900-1500 nucleotide purtînd un mesaj cìar€
corespurì.de la catene polipeptidice de 300-500 aminoacizi.
În sinteza histidinei intervin 10 enzime. Aoestea sînt sin-
tetizate sub directia unui mesaj purtat de o singurà molecull
de ARNnz.

4.L,3, TERMIN AREA CATENET POLIPEPT IDICE

Cînd ribozomul în deplasarea sa pe ARNnz întîlneEte în sl-


tui A un codon terminator la care nu mai ràspunde nici un tip
de aminoacil-ARNú are loc înrcerúamea sirutezei caùenei polipep-
tidice càci un asemenea oodon nu este neclu'r.oscut de niei un
anticodon ARNf, prezenfa sa în situl A aI ribozomului blocînd
adàugarea oricàrui alrt aminoacid la caùena poiipepti,dicà. Codo-
nii UAA, UGA Ei UAG sînt codoni terminntori. Un,eori existà
nu un singur codon terminator ci doi cod,oni termin,atori suc-
cesivi spre a asigura cà sinteza catenei polipepti'dice se ter-
minà în punctul corespunzàtor. Terminarea catenei polipepti-
dice este un proces activ qi nu se datoreqte simplulul fapt cà
un codon nu poate fi citit. Codonii terminator:i (sfop sau non-
sens) spre deosebire de codonii sens care sînt citili (necunoscufi)
de diferitele tipuri de ARNú sînt recunoscufi de càtre factori
proteinici numili Ei factori de eliberare. Semna1ele de terminare
repnezentate de cei trei codoni terminatori (nonsens) sînt recu-

140
noscute de trei factori proteinici (enzimatici) de termfurar,e
(ÎF-&, TF-Rz Fi TF-R1). TF-.R1 r€cunoagùe codonii UAA
qi UAG, TF-R2 recunoa$te codonii UAA qi UGA. Codonul
UAA (ocru) se pare cà este cel mai eficient codon terminator,
pe cînd UAG (arnber\ Ei UGA (opal : qzuy) ar reprezenta sem-
nale accesorii care sà asigure cà terminanea nu equeazà. UAA
gi UAG asigurà terminarea eficientà a traducerii la bacterii în
propor{ie de 1000/o.UGA este rareori mai eficient de 980/0, iar
la codonii terminatori ,,leakys sla,bi, adicA un terminator
aparent gregit citit ca un codon ce specificà um amfuroacid, efi-
,cien{a terminàrii esúe scazutà dar semnificativà. Aceasta duce
la alungirea eatmei polipeptidice dincolo de aodonul de termi-
inare. Codonul terminator interacfiorneazà, cu factori proteinici
care au fost notrali cu R, creînd,u-se un compler R-codon tenni-
nator-ribozom care blocheazà alungirea în aontinuare a oatenei
polipepticlice. Terminarea implicà formarea ùr situl A a u'nui
complex ce include fF-& sau TF-R2, codonul ter:rnfurator
UAA qi ribozomul. TF-RB acfioneazà atunci enzimatic ia nive-
tul sitului P spre a separa grupul canboxil al a,minoacidului C
terminal de l,egàtura sa cu ARNú printr-o hidrolizà, eliberînd
peptidul. Blocarea sitului A face ca,polipeptida completà só rà-
rnînà esterificatà la ARNú finat care ocupà situl P. Factorul
proteinic Tî-R3 va rupe aceastà bgaturà, facînd ca sa fie eli-
berafl dim ribozorn atît catena potipeptidi,cà cît qi ARNú. Tot-
odatà are loc dlsocierea riibozomului în sutbuuritàtile sal,,e mare qi
micà, proces mediat de factorul lF3 implicat dupa cum s-a vàzut
qi în medierea formàrii compl,exului de inifiere. În prooesul de
berminare a catenei polipeptidice au fost implicate qi proteinele
ribozomale L7 $i Lrz.
Sinteza proteinicà esùe îns'ofità de a.ga-numiúul ciclu riboza-
mnt (îig. 43). Mai întîi are loc asam'blarea rirbozomului din sub-
.unitàlile s'ale. Pînà în anul 1967 s-a crezut cà subunitàlile 30 S
qi 50 S ale ribozomului sînt p€rfiranr€nt cuplate spre a forma
un ri,Lmzom matur 70 S dar, din acest an, s-a stabilit cà sub-
unità{ile ribozomale se asociazà doar atunci cînd sînt active în
sinteza proteinicà. De îndatà oe a fost tradus mesajul genetic
din ARNm Si s-a terminat sinteza caúenei polipeptidice, ribo-
zomul se disociazà de pe ARNnz, subunitàlile ri,bozomului se
separà Ei eie îqi iau a$i parteneri (30 Sr * 50 51 30 52 + 50 S2
într-un eiclu de sintezà Ei 30 Sr * 50 52 respectiv 30 Sz + 50 Sr
în urmàtorul ciciu de sintezà.
Prin experienfe de marcaj cu izotopi grei Ei radioactivi,
Wlesels,on a aràtat natuna efemerà tranzientà a cuplàrii de sub-

l4',.
Q GLp, I ltet tRN,rl
() r uet"tn,vat

(\i
r)
8r i
l

J0 it:
,5,
,.:17!^,-
WJ
Alt.! m
-rY*
J j
,,
--) { -:h^
Yiiir
;,H\'m
7os, {-Èn
\,.!./lr:';/tl
,,nr,-,OnO,\j{f/

I z'-GTP tF lu
EF-ts (
tr'c I
" " i\6tp+P
lerminorea ,,Foqlod-
de eliberore
sinrezo,
-
cotenei coknei
poLpeptiúc: Fal,pcptidÌce
Produs prdein'rc

s ch e m a o ng oi ó r n t t to r ri b uo mo r e
n il,iii!i "r,ìi!,iirt
Q

"
Fig. 13. schema *ffirm:t$;;;ff3;1i,n o.r rrbozornare

unitàti rÍbozomale in constituirea de particule ribozomale ma-


tune, funcfionale. În timpul inifierii ane loc legarea faetorilor
de inifiere IF-l , IF-z $i IF-3 la subunitatea 30 S.
Inifierea mai nec€sità ARNú formil,metionil la ,bacterii sau
ARNú-metionina Ia euoariote, ARNnz asociat subunitaÉi 30 S,
GTP. Aceste cCIrnpooeote alcàtuiese aSa-numitul c.omplex de
inifiere. Complexul de inifiere se comrbinà cu o subunitate rirbo-
zomalà 50 S spre a forma un rirbozom funcfional 70 S. Proeesul
este însotit de hidroliza unei molecule d'e GTP din care rezultà
energie avînd loc $i eliiberarea facúorilor lF. Se desfàEoarà
apoi translocalia ribozomului reprezentînd deplasarea ribozo-
mului de-a lungul ARNnz pe o distanfà ce oorespunde cu fie-
(:are miqcane la trei nucleotide (oodon). Tnanslocalia rilboz,omu-
lui este un proc.es aetiv oare nec,esità energie pusà la dispozilie
prin hidroliza GTP precum qi intenvenfia unui foctor G numit
factcr de trarulonfi,e. Siturile de irrteracfiune cu G qi GTP se
aflà în subunitatea ri;bozomalà mare. Pentru realizarea transtro-
catiei riibozomale, ARNú deacilat (lipsit de aminoacid) trebuie

142
sà fie expulzat din situl P, peptidil,-ARNú trebuie sà se depla-
seze din situl A in situtr P, iar ARNm trebuie sà se depla-
seze pe subunitatea ri'bozomalà micà ast'fel, încît sà poatà ex-
pune urmatorul codon în situl A. Dupà parcurgerea înfuegii
moLecule de ARNm, ribozomul se disociazà în subunitàfile sa1e.
La o nouà reconstituire de particule ribozoma,le, subunitàlile
ribozomale se pot schimba între ele. Reciclarea necesità un
faeùor cle iniliere numit fontor de disociere ríbazomald ce men-
line poiirirbozomii, inhilbà disocienea subunitàfilor ri'bozomale
înaimte d,e a fi disponiibil mesagerul, condifioneazà, intràrile
cantitati'u'e a1e subunitàfilor mani în polirirbozomi, permite acu-
mularea de subunitàli ribozomal,e în loe de acumulare de par-
ticule ribozomal,e uniee qi este cerut de legarea ARNrn la
ri,bozomi.

CONCLUZII

Î,n procesul de biosintezà proùeinicà se realir.eazà, decodi-


ficarea informaliei genetice.
Procesul de biosintezl proteinicà este extrem de oomplex
qi implicà recunoasúeri pe bazà de complsmentariúate dintre
acizii nucleici, fur care ro1, esenfial ane relafia codorr-anúicodon.
Întreg procesul de biosintez,à, proteinicà se desfàqoarà prin
intervenlia unui numàr mare de alte proteine cu caracter en-
zimatic sau care funclioneazà in calitate de f,actori de recu-
noaqtere (inifiere, elon'gare, terminare). Este o refurnoiúà povarà
pentru celulà cînd îqi sintetir,eazà o caùenà polipeptidicà, càci
pentru aceasta ea pune î,n funcfiun,e un numàr incompararbil
mai rnare de alte proteine.
În celulele procariote cu ARNnz de scurtà duratà de
- reglarea expresiei genelor apare în principal Ia nivelul
via{à
transcrierii (vezi reglajul genetic).
La Eucariote cu ARNnz de duratà de via{à mai lungà, ex-
presia genicà este controlatà atît la nivelul transcrierii, cît qi a
traducerii. Reglarea traducerii în aoest eaz are loc in parte în
timpul inifierii catsrelor polipeptidice, ceea ce explicà de ce
factorii de inifiere eucariotici sînt mai numerogi qi mai com-
plicafi str.uctural decîú omologii tror proeariotici (Oc}roa S. qi de
Haro, 1979). Pe cînd aparatul de furifiene proeariotic oonstà di,:r
2 sau 3 faetori de inifiere, cel eucariotic imphca cel putin 7
143
sau B asemenea factori. Faetorul proeariotic IF-7, care mijlo-
ceqte legarea metionil-ARNú inifiaùor, constà dinrtr-o singurà
catenà polipeptidicà cu greutatea molecularà B0 000-90 000,
iar factorul de recunoagtere ,a ARNnz IF-3 constà dintr-o ca-
tenà polipeptidicà cu greutatea molecularà de 23 000 dal,toni.
Faetorul de ini{iere eucariotic e IF-2 este eompus din 3
subunitàfi cu greutate molecularà com,binatà de 150 000 daltoni,
iar /F-3 are nu mai putin de 10 subunità{i care dau o greu-
tate molecularà totalà de 500 000 daltoni.
Controlul tr,aducerii la eucariote implicà interven{ia pro-
teinkinaz.,elor care, atunci cînd sînt activate înhibà traducer,ea.
Se cunosc douà mecanisme majore ale oon:tr'olului tradu-
cerii la eucariote. Primul controLeazà inilierea catenei poli-
peptidice prin blocarea funcfionàrii factorului de ini{iere e
IF-*Z, blocare care este realizatà prin fosforilarea uneia dintre
cele trei subunitàli ale sale. Aceastà fosforilare este catalizatà
de proteinkinaza.
Al doilea urecanism de b}ocare a traducerii implicà degra-
darea ARNrn pe calea activàrii unei endonucleoze prin inter-
mediul unei oligonucleotide c€ are o structurà neobiqnuità ppp
A 2' p 5' A 2' p 5' A. Aceastà nucleotidà este sinúetizatà din
ATP sub acliunea tot a unei protein-kinnze.
Anumite oligonucleotide mici, afl,aùe în celulele eucariote,
formate aparenú în urma digestiei endonucleazice a ARN ce-
lular pot afecta traduoerea Ia nivelul elongafiei caùenei. EIe pot,
fi implicate în tranzilia de la o stare donmantà sau liniqtità la
o stare activà ca în emergenfa din criptobiozà, a artropodului
Arternia salina sau în fecundarea ovulului.
Bl'ocarea func{iei e IF-Z qi degradarea ARNnz dupà cu-
nogtinlele actuale inhibà traducerea într-o manierà neselec-
tivà. CercretàriLe viirtoare vor ad.uoe noi daùe asupna unor cài se
lective de modular€ a traducerii diferi{il,or mesageri, ca qi asu-
pra rolului fosforilàrii proteinelor ribozomale qi factorilor ce
intenrin în biosinteza proteinicà, allii decît e IF-z.
Recent s-a descoperit o proteinà stimulatoare a e IF-2 de-
s€mnràtà ESP, car,e determinà ca e IF-2 sà formeze un complex
ternar cu GTP qi ARNú metioni,l inifiaúor. Aoest aomplex ter-
nar se leagà la o subunitate 40 S a ribozomului eucariotic dînd
uraqtere la un complex de iniliere în care intrà Ei ARNrn. În
urma fosforilàrii subunitàlii mici a e /F-2 este blocatà furter-
ac{iunea e IF-Z cu ESP $i astfel nu se poate forma comple-
xul ternar de inifiere, fiind inhi'batà în consecintà traducerea
(Ochoa Ei Haro, 1979).

144
Capitolul V
CARACÎERISTICILE ORGAI{IZARII
$I FUNCTIONaRU FACTORILOR EREDTTARI
(GENETOR)

Cel care s-a oeupat pentru prÍma datà de probiema organi-


zàríi gi funcfionàrii faetorilor ereditari, stabilind caracteristi-
cile lor a fost Gregor Mendel, pàrintele Gerreticii Etiinfa
ereditàfii. -
La organismele procariote funclionarea gi transmiterea fae-
'torilor eneditari prezintà un tablou mai putrn complex compa-
rativ cu organismele eucariote. Ciclul de vÍafà al organismelor
prooariote este simplu. Reproducenea lor se realizeazÀ prin
diviziune celularà, neexistînd diferenfieri celulare majore. Exis-
tenta unui singur cnomozom-genofor substratul fizic unic al
tuturor genelor pe cìare le prezintà o-cel,ula procariotà, faee ca
de regulà fiecare genà sa fie prezentà într-un singur exemplar,
într-o singurà c"opie, în genomul prooariot. Ea se va exprima
deci liber în fenotip, în funclie de necesitàfile de moment al'e,
celulei (vezi reglarea activitàlii genice).
La eucariote lucrurile sînt oeva mai complicate. Existenfa
mai multor genofori crpmozomii creeazà premisa pre-
zenfei în genotipul unei celule, respectiv individ, a mai multor
copii ale acel.eiaqi gene, adicà a unor stàri alternative ale aces-
teia. Comportamentul factorilor ereditari depinde nu numai de'
aspecte legate de meoanismul reglàrii activitàfii genelor, dar
qi de oomplexitaùea organizàrii genomului eucariot qi de pre-
zenfa unei gene date, în aceeaqi celutà, în c.'el putin doua stàri
al,ternative.

tQ - Descifrîud tainele ereditagi, vol. I 145


1. CICLUL DE VIATA LA ORGANISMELE SUPERIOARE

Organismele eucarioúe se pot reproduce fie pe cale asexuatà


(vegetativ lia plante, somatic la animale) fie pe cale sexuatà
propriu-zisà, cu diferenliere de sexe opuse, mascul Ei femei.
Reproducerea asexuatà se realizeazà, cel mai adesea pe calea
diviziunii celulare la eucariotele inferioare, unioelulare (al,ga
Chlorella bunàoarà) sau prin diferenfiere de org€me de repro-
ducere vegetativà, Ia plante.
Eucariotele, mai a}es cele superioare, se car,acterizeazi însA
prin reproduoerea sexuatà tipicà, în oare s,e difererrliazi anizo-
gamefi gamefi diferifi morfofizi,ologic ovulul la arrimale
- la plarnte, penúru sexul femel, spermatozoidul
gi oosfera - Ia ani-
male gi nucleul spermatic (derivat din diviziunea nucleului
generativ rezulrtat în urma diviziunii nucleului haploid al mi-
cr,osporului ,gràu,nciorul de pol'en) pentru sexul mascul.
În ciclul-de via{à la organismele cu reprodueere sexuatà
alterneaza 'o f"azà, s,exuatà (gametofiticà) qi a fazà vegetativa
(sporofiticà).
La animalele superioare precum Drosophila Ei omul, faza
sexuatà este reprezentatà doar de celulele din linia germinalà
cane produc gamefii. Ele sînt di$oide (2n), se diferenfiazà din
celulele liniei somatice prin diviziuni mitotice succesive încà din
primele faze ale emrbriogenezei Ei doar ele vor suferi meioza
sprc a deveni garne,fi.
Plantele nu posedà o linie germinalà. La plantele care se
repnoduc pe cale sexuatà, în floare, reprezentînd o parte a
sporofitului, u,nele celuie vor fi induse spre a se difermfia în
megasporofit la sexul femel qi microsporofit la cel mascul qi
aceste oeiule vor suferi meioz'a. În unna meiozei rezultà rnega-
spori (ovulul) Eí microspori (polenul) care se divid mitotic spre
a produce ceea ce se cheamà ga,rnetofit. La plantele inferioare
(talofite) ,gametofitul ,este foarte dezvoltat pe cînd sporofitul
este redus. La plantele cu flori în special angiosperme, ,gameto-
fitui este foarte redus pe cînd sporofitul (reprezentînd planta
întreagà) este foarte dezvoltat. În pr,ocesul de fecundafie din
unirea ovulului cu spermatozoidul respectiv a oosferei cu nu-
c121 spermatic, se reface garnitura diploidà de cromozomi, re-
zutrtùrd oul sau zigotul diploid car,e, prin diviziuni succesive va
g€nera un nou organism. Meioza Ei fecundarea sînt ferromene
compensatorii.

146
2. CARACTERISTICILE GENETICE AI..E MEIOZEI

Meîoza este diviziunea celul'arà cane duce la formarea ce-


lulelor reproducàtoare. În cadrul ei, dupa o singurà runda de
neplicare a ADN se desfàqoarà douà diviziuni nucleare suc-
cesive. În urma replicàrii ADN, o celulà 2n cu o cantitate 2C
de ADN va dobîndi o cantitaúe dublà de ADN de nivel tetra-
ploid 4C.
- prima diviziune meioticà rezultà douà celule care au
Dupà
o cantitate diploidà de ADN (2C) qi cu mumàr de cromozomi
redus Ia jumàùarùe (n). Acresúe oelule suferà ,o a dor.l,a diviziune
mei.oticà qi vor da patru celule cu cantitate haploidà de ADN
(1C), dar cu acelaqi arumàr de eromozomi redus la jumàtate (n),
În prima diviziune meioticà, anume în gnofom. acesteia eve-
arimentul cel mai important esùe sinapsa crpmozomilor omologi
cane condifioneazà reducerea aparen'tà a numàrului de cromo-
zomi. Cromozomii ibicromatidici avînd o crantitaúe 4C de ADN
(duplicafi) se asociazà în perechi, pe bazà de omologie, for-
mind bivatenfli. În metafaza primei diviziuni meiotice fiecare
bivalent se aqazà in placa metafazicà, astfel ca unul dintre
cromozomii omologi sà fie deasupra, iar cel,àlalt dedesubtul pla-
nului ecuatorial al acesteia. Aceastà agezare a cromozomilor
omologi oe alcàttriesc bivalenfii condifioneaza o disjuncfie
(segregare) ordonatà spre polti a cromozomilsr omologi, di'n
fiecare bivaJent unul diurtre omologi migrtnd spre un pol (deci
într-un gam,et), celàla,lt în mod obl,igaúoriu, Iegic de,terminat,
migrînd spre polul opus (într-un alú garnet). Din prima diviziu-
ne meioticà nezulrtà doi nruclei fii, fiecar.e avînd un numàr de
cnomozomi reprezerrutind jurnàtate din gamitura diploidà a
celulei somatice. De asemenea, acesti nuclei au o cantitate
de ADN redusà la jumàtate fafà de cantitatea de ADN a nu-
cleului interfazie de dinainte de meiozà.
Prima divizir:ne meioticà este redu{ionalà. Nucleii ha-
ploizi rezul,tafi din prima diviziune meioticà suferà, fàrà a mai
avea loc o sintezà interfazicà de ADN, o a doua diviziune me-
ioticà care se desfàqoarà dupà mecanismul mitotie tipic, cu cli-
varea longitudinalà a centromerului Ei migrarea spre poli nu de
cnomozomi bicromatidici ca în prima diviziune meioticà, ci de
cromozomi monocromatidici. A douà diviziune meioticà desà-
vîrgeqte astfei qi reducerea cantitàtii de ADN, care de 1a 2 C
ajunge ùa 1 C, canrtiùate specificà gannefilor haploizi. Iau n,a9úere

147
patru nuciei hapl'oizi ca rezultat a douà diviziuni meiotice suc-
cesive.
Celuiele organismelor diploide care se reproduc pe cale
sexuatà, prezintà douà seturi de cromozomi, unul provenind
de la mamà, adus la nivel.ul zigotului de càtre ovul, altul pro-
venind de la tatà, adus la nivelul zigotului de càtr'e sperma-
tozoid. Fiecare set de cromozomi este atrcàtuit di,r: crom'ozomi
neomologi, neasemànàtori. În cadrul complementuluii diploid
însà, doi cîte doi cromor,omisînt asemànàtori adicà omol,ogi, unul
fiind de provenien[a maternà iar altul de provenienta paternà.
Asemenea cromozomi ornologi poartà aeeleagi gene în loci oo-
respunzaúori qi prezintà aceeagi morfologie. Astfel', star,ea di-
ploidà a organismelor eucario,te implicà existenla locil,or omo-
togi qi a genelor alele; cel pufin cîte douà gen'e din genotipul
organismului eucariot controleazà acel'aqi caracter. In timpul
meiozei aceEti cromozomi omol'ogi se împereeh eazà,, formînd
bivatenfii. În împerecherea omologiior un rol esenfial revine
compl,exul ui sinaptinemal.

3. LOCALIZAREA GBNELOR PE CITOMOZOMI

În anul 1903 Sutton a starbilit relalia dintre comportamen-


tul crornozomilor în meiozà (segregare) pe de,o parte qi disjunc-
tia (asortarea) independentà a genelor pe de altà parte, fapt
care a stat la baza elaboràrii teoriei cromozomale a ereditàfii
de càtre Morgan qi Ecoala sa, în 1919.
S-a putut constata cà o genà nu poate sà corespundà la un
cromozom întreg de vreme ce oricare .organism, fie el, proca-
riot (unde existà un si,ngur cromozom) fie eucariot posedà
mai multe gene decît cromozomi. Singura posibilitate ràmînea
'ca pe un singur cromozom sà se afle mai mutrte gene care
sînt lincate sau înlànluite. S-a stabilit cà fiecare genà ocupà
o anumità pozilie (toczs) strict determinatà pe cromozom Ei cà
pe cromozomii omologi alel,ele unei ,gene ocupà pozilii cores-
punzàtoare. Mai exact alelele unei gene ocupà acelaEi locus pe
cromozomii omologi. Ulterior pozilia ocupatà de o genà pe
cromozom a fost asimilatà cu gena ca atare, încÎt atunci cînd
se vorbeqte de un locus genie se înlel,ege gena propriu-zisà,.
Piuralul de la locus este loci.
Genele plasate pe un acelaqi cromozom manifestà tendinfa
de a se transmite înlànt-uit I,a desce'n'denfi, în virtutea faptului

148
cà ele sînt fizic înlànfuite, iar cnomozomul este trecut ca en-
titate integrà, discretà, din celula inifialà îan celulele fiice.
Pe de ,aùtà parte, genele care sînt localizatn pe diferifi cro-
rn'ozomi (pe cromozomi neomologi) nefiind înlànfuite segnegA
independent unele de altele càci qi perechil,e de cromozomi în
anafaza primei diviziuni meiotice (AI) segnegà independemt
unele de altele. Dacà dintr-o pereche datà de crnomozomi, cro-
rnozomul de origine maternà migreazà spre un pol, în mod
legic determinat cromozomutr de origine paúernà migreazà spre
polul opus. Dar, considerînd o arltà peredre de cromozomi, ru
es'te o'bligatoriu sà migreze spne polul spre cane a mi'grat din
prima per,eche cromozomul matern tot, cromozomul de ori-
gine maternà. Astfel, spre poli, în nuclei fii, rezultali din
prima diviziune meioticà, vor mlgra cr,omozomi de ori,gine di-
ferità, mate'rnà qi paternà, migranea fiind un evem.iment deter-
minat stohastic, probarbilistic. În asemen€a nuctrei vor apar€
constelalii genetice de cromozomi, respectiv de gene diîerite ca
origin'e (materne qi paterne), ca provenienfà, de cele care au
fost la genitori.
Aceste concluzii au fost desprinse însà dupà ce s-a studiat
fenomenul ereditar la nivel ceL,ul,ar.
Dar, îna,inúe de a fi cunoscute mecanismele in,time ale me-
iozei qi implicarea cromozomitor în ereditate, Gregor Mendel,
studiind hibridarea la mazàre, a ajuns la concluzii care îEi
pàstreazà în total,itate valabiliúaùea qi astazi, astfel cà el, càlu-
gàrul augustin Gregon Memdel, nàscu't la Heinuendorf (Cehos-
lovacia) în t822, este aonsider,at fondatorul qtiintei er.editàlii.

4. DESCIFRAREA NATURII GENOMULUI (GENOTIPULUI}


PRIN STUDIUL FENOTIPULUI (ANALI7,A GENETICA)
(GENETICA FACTORIALA SAU FORMALA)

Cercetàrile lui Mendel se deosebesc radical de ceie ale pre-


decesorilor sài (cei mai reprezentativi fiind Knight, Goss, Ch.
Naudin) prin trei elemente de n,outate: modul de a privi expe-
rienla qi de a alege materialul potrivit, introducer,ea discoarti-
nuitàfii qi folosirea maril,,or populalii, oeea oe permite exprima-
rea nezultatelor prin numere Ei pr,elucrarea lor ma'tematicà, ca
qi folosirea un.ror simrboluri simple pentru desemnarea fac.to-
rilor er,editari de naturà corpusculanà, prin care devine posi-
149
bil un meîncetat d,ialog diurtre experiment Ei teorie, dintre expe-
rimentator qi experienfa sa.
Noua metodologie, prelucrarea statisticà Ei reprezentarea
simbolicà impu,n ereditàlii o logicà internà. Cu Mendel, inter-
pretarea fenomenelor biologioe dobîndeqte dintr-o datà rigoare
matematicà. Gîndirea sa a fost o gîndire revolufionarà. EI a.
ajuns la concl,uzia cà tràsàturil,e (caracterele) ereditare ale unui
individ sînt distincte, fiecare transmi!îndu-se ca unitàli sepa-
rate de l,a pàrinti la descendenli mu direct, aqa cum credeau
predecesorii sài, ci indirect, prin intermediul unor factori ere-
ditari. Astfel, deqi un individ poate sà posede mii de tràsàturi
distinete care alcàtuiese individualitatea sa, fiecare din aceste
tràsàturi sînt controlate de càtre unitàli ereditare sau factort
eredifuri oare au un caracter discret (în sens de distinct din
punct de vedere fizic). Mendel a stabilit cà ereditatea urmeazé
legi simple qi exacte pe baza càrora poaùe fi prezis comporta-
mentul oricàrui factor ereditar care dirijeazà un anumit carac-
ter. Moqtenúrea caracùerelor se face dupà reguli foarte exact'e,
matematice.
Prin experien!à dar Ei intui{ie genialà, Mendel a statuat cà
diferitele caractere a}e unui organism dat sînt determina,úe de
factori ereditari de naturà materialà, localizali în nucleul ee-
lular, fiind in dozà dublà în celulel,e somatice gi în dozà simplà
în celulele reproducà'ùoare (gamefi). Prezenfa factorului ere-
ditar în doza dublà a fost probabitr sugeratà lui Mendel de par-
ticiparea a doi incliviei diferifi la uraqterea unui singur individ
la organismele c€ se reprodue pe ca,le sexuaità. Este acum uEor
pentru noi sà apreciem cà aceastà situafie corespunde cu ac€ea
a numàruiui de eromozomi sau a cantitàlii de ADN, dar Mendel
nu qtia acest l,ucru, deoarece la vremea cînd a elaborat tezele
sale mu se d,escoperise nici cnomozomii, nici ADN, nici meioza.
Mendel a mai stabilit cà factorii ereditari în celul,ele soma-
tice fiind în doz.à du'blà se aflà su,b formà de pereche sau cum
a definit el cu terrnenul grecesc sub formà de alele.
Acum qtim cà factorul ereditar mendelian este o genà qi
cà gena poate exista sub forma a douà stàri alternative, nu-
mite alele din care una este dominnntd (A) gi alta rece'siud (a)"
Aceste douà Súàri ,aù,ternative ate aceleiaqi gene sîn,t rezulrta-
tul posi,bil al mutafiei bidirecfionale: A, ' a. Existenfa genelor
poarte fi sesizatà numai cînd ele determinà un caracter ce poate
sà aparà sub douà stàri al,ternative. Abia atunci vom putea qti
cà existà o genà care, într-o anumità stare determinà o anumità

150
formà a caracterului considerat (ibob neted în cazul formei bo-
bului de mazàre) qi într-o altà stare determinà cealaltà formà
a caracterului (bob zbîrcit).
Cele douà alele ocupà acel'agi locus pe o pereche datà de
cromozomi omologi. Astfel, dacà alela A se aflà pe cromozomul
cle origine maternà, într-un anumit sit sau locus, p€ cromozo-
rnul omolog de origine paternà, ùl acelaqi locus se va afl,a fie
gena ,,Att, fie ale,la sa ,,a6t. Situarea alelelor poate fi qi reci-
procà, ,,Att pe cr,omozomul de origine paternà qi ,,a( pe cetr
de origine maúemà.
Într-un alt locus pe aceeagi pereche de cromozomi omologi
se aflà altà genà ,,Btt prezentà sub forma alelelor ,,Bs qi ,,bs.
Genele A Ei B, fiind plasate pe acelagi cromozom se transmit
de regulà împreunà la descendenfi.
Pe celelalte perechi de cromozomi se aflà alte gene (X, Y,
Z etc.) qi transmiterea lor la descendentr nu este legatà direct
de transmiterea genelor A Ei B.
Gena A prezentà cu alelele sale A gi o în ace,laqi locus pe
,cei doi cromozomi ,omologi poate determina variafia expresiei
fenotipice de regulà a unui singur caracter.
Prezenfa unei gene sub forma a douà stàri alternative (ale-
le) poaúe fi comparatà cu un întrerupàtor electric care prezintà
douà stàri posibile, alternative:
închis în acest caz lumina este stinsà;
- deschisEiEi în acest caz lumina este aprinsà.
-Sà exemplificàm din experienlele lui Mendel. EI a efectuaú
hibridàri de mazàre. Mazàrea prezintà mari avantaje pentnt
studiul comportàrii factorilor eneditari (genelor) deoarece este
o planta autogamà (fiecar'e plantà produae atît polen cît qi
ovuie) qi prin autofecundare se pàstreazé nealteratà puritatea
geneticà. Din aceastà cauzà mazàr,ea prezintà multe soiuri pure
'care se d,eosebesc tranqant între el,e prin caractene contrastante
(bob neted ,bob zbîrcit; bob galben ,bob verde; flori roqii
- port înalt port pitic etc.)
fl'ori al'b,e; - car,e se mai numesc
-gi earacùere alelomorfe qi- care pot fi o'bservate cu uEurin!à. Pu-
ritatea geneticà a unui soi este d'ovedità de faptul cà prin ,out,o-
fecundare se pàstreazà nealterate caractercle sale, adicà se
transmit fidel, neschim,ba;te, de-a lungul generafiilor, dînd o
,d,escenden!à uniformà qi asemànàtoare formei inifiale. Pe de
altà parte, un soi impur genetic va da naqtere prin auúofecun-
dare la o desoendentà neuniJormà, ad.icà va segrega.

151
4.1. MONOHIBRIDAREA,

Încnrciqind un soi pur de mazàre cu bob neted, cu un soi


pur de mazàre cu bob zbîrcirt Meardel a ,oblinut în prima gene-
rafÍe (F1) organisme hibride cane prezentau feno,tipic (exterio-
rizau) doar caraeterul de boib neùed. Experien{a de încruciqare
ln car'e se ia în considerafie doar o pereche de canactere aleto-
morfe se numegte experien!à de m,onohibridare. în al doilea an,
a cultivat rboabel.e hitbride dirl Ft làsînd pl,antele sà se autopole-
nizeze Ei a oibfinut cea de-a doua generafie (Fz) de plante. în
,acest cazp lîngà plante care fàceau boabe uretede au apàrut qi
plante care fàceau boab,e zbîrciúe. Deoarece în prim,a genera-
fie, dintre cele douà caractere contrastan,te neted-zbîrclt, s-a
manrife,stat doar caracúerul de bob neted, Mendel a numit acest
caracter, caracter dominanú, iar factoruL ereditar care îl deter-
minà l-a considerat factor ereditar dominant qi l-a simbolizat
cu litera mare ,,Ao. În acelaqi timp caracúerul de bob zbîrcit,
neexprimat în Fr, a fost consid'erat oarracter reeesiu, iar facto-
ml care ît determinrà a fost considerat factor ereditar recesiv
qi a fost n,otat cu litera micà ,,at'. În virtutea celor spuse pînà
acu.m, experienta de hibridare a luí Mendel poate fi astfel sche-
uratizatà (fig. 44).
Analiza femotipicà a celei de-a doua generalii (Fz) a aràtat
cà proporlia dintne plantele cu iboabe netede gi pl,antele cu boa-
be zbîrcite era de 750/o neted la 250/o zbîrcit, sau simplificat
de 3:1. Aoesta a fost numit rraport de segregare Ei s-a, cofrstatat
a fi aproximativ acelaEi în toaúe experienlele de hibridare de
acest tip. Analiza genotipicà judecatà dupà feno'tip gi bazatà pe
inrtuilie a sugerat eà existà trei categorii diferite genotipiee de
organisme AA, Aa qi aa. Aparilia doar a douà caúegorii fenoti-
pice de organisme în cadrul unei popul'a{ii în care probabi-
listic apar patru posibilirtàli de combinare a gamefilor i-a su-
gerat lui Mendel cà în cazul structurii genotipice Aa se ex-
úerioriaeazà qi ca în oazul hllorizilor din F1, doar carastenrl" do-
minant. Probabilita,tea aparifiei caracterului dominant esùe de
3/4, íar a oelui recesiv este de l/4, de unde raportul fenotipic
de segregare 3:1, oel genotipic fiind de 1 AA:2 Aa: 1 oo. De

152
PARINTI fGenitorii'
-*- Hc'r czrgol recesiv botr zbkit'
Meroz cr isepororeo toctonlrr
er€drl.rír ín gometi drfecrlr I
Gomei'

PRìMA GENERAIIE (Fl)


Él
I II I orEor-,sme t00Tohererozigote
(hitrrcel
\_y

rtil x
ii' ú
, "/?
'ol
I
o
>-:
Gomeir

A DOUA GENERATIE (Fzl)


il
frt tD frr;
'l
24o,6 50Vo z Jlo Seg.egore drpó,
hofiozrgot domrnonte heterozigote homozrgot recesive J SenotiR I l, 2,1l:
l---_--
'l
75%o bob neted 25o4bob zbîrcil Segregore dr.rpó,
lfenotrp (3 neted:
j t zuîrcrt )

Fíg. 44. Monohibridarea (segregarea sau separarea factorilor


ereditarí).

fapt, rezultatele experimentale oblinute de Mendel privind ra-


portui fenotipic de segregare în cîteva experiente sînt redats
în tabeiul 3.
sà consideràm cîteva aspecte legate de oomportamentul fac-
torilor ereditari. Factorul éreditar A este dominant. El condi-
lioneazà un caracter dominant, caracter care se manifestà în
toate generaliile, indif,erent dacà intrà sau nu alàturi de fac-
torul ereditar recesiu în struc"tura geneticà (î,n genotipul) ce-
lulei, respectiv organismui consi'derat. EI se exprimà în- fenotip
atît cînd se aflà în d,ozà du'blà (AA) cît gi atunci cînd s,e afló

153
Tabel nr. 3
Raportul lcuotiplo de segregare în erperienlele lui lùIendel

dr
Genitori (Pórinfi) Fl F2 lnaport
segfegaîe
I

Plante de bob neted x bob neted 5471 plante cu 2,96: I


boabe
uetede
Plante cu bob zbîrcit 1850 plante cu
boabe zbîr-
cite
Plante cu bob galben x bob galben 6022 galbene 3,01 :I
plante cu bob verde 2001 verzi.
Plante cu flori rogii x flori rorsii 705 rogii 3,15 :I
Plante cu flori albe 224 albe
plante cu póstAi verzi x pàstài verzi 428 vetzi 2,82: I
plante cu póstài galbene t52 galbene

în dozà simplà (Aa). Structura geneticà AA este homozigo'tó


d"omirwnúd pe cînd structura geneticà Ao es,be heterozigotó.
Factorul eredita'r a este recesiv. El condilioneazà un ca-
raeter recesiv EÍ nu se poate exprima atunci cînd intrà în struc-
tura genotipului alàturi de factorul ereditar dominant (A) la
formele heterozigote (Aa). Se spuo,€ cà Ia organismele hetero-
zigote dominanla poate sà mascheze genotipul. La organismele
homozigote recesive (aa) fenotipul refl,ectà genotipul.
Factorul ereditar recesiv nu se manifestà decît atunci cînd
se aflà în dozà dublà, adieà este plasat pe ambii cromozomi
omologi, stare care se numegte hòmozigotd recesiud (aa).
O singurà situalie se cunoaqte în care în mod normal fac-
toml ereditar recesiv se exprimà atunci cînd se aflà în dozà
simplà. Este cazul factorilor erreditari plasali pe cromozomii de
s€x Ia masculul de drosofilà sau mamifere. Formula cromo-
zomalà a sexului mascul în aeeste cazuri este XY. Cei d'oi cro-
mozomi de sex nu ,alcatuiesc o pereche, nefiind omologi. De-
altfel ei nici nu Be împerecheazà, intim pe toatà lungimea lor în
meiozà. Cromozomul Y poartà foarte puline gene priqrtre care
qi cele care intervin în masculinizare. Cromozomul X este un
cromozom activ genetic. El poartà mulùe gene. Dacà o genà de
pe crqmozomul X se aflà în stare recesivà (a), ea se exprimà fe-
notipic chiar fiind în dozà simplà, càci pe cromozomul Y, ure-
fiind omolog cu X, nu se poate afla niciodata alela sa domi-
nantà (A). Aceastà stare, în care gena recesivà ,,a35 s,e exprimà
fenotipic, chiar cînd se aflà într-un si,ngur exemplar se nu,meste

154
stare de hemizigolie. Hemizigolia poate apare gi la organismele
aneuploide monosomice la car.e lipseqte unul din crornozomi
unei perechi de cronnozomi.
Un alt aspect legat de f'actorii ereditari mendelieni se referà
la segregore. În procesul hibridàrii, factorul ereditar dominant
nu se amestecà cu factorul eredita,r rec€siv. Fii'nd de naturà
corpuscularà, aceEti facùori numai coexistà în genotipul hibrid,
se alàturà, fàrà însà a se contopi. Factorul ereditar dominant
nu determinà nici o alterare a factorului eredi'tar recesiv, ci
numai nu-i permite exprimarea sa fen,otipicà (î1 ,,dominàs).
Acest lucru este dovedit de reaparifia factorului ereditar reoe-
siv în generalia F2. Raporturile dintre factorÍi ereditari, domi-
nant Ei recesiv sînt mai degrabà raporturi funclionale, cel re-
oesiv neputÎnd fu'ncfiona î'n prezenfa celui dominant, sau pro-
dusul sàu de sintezà este acoperit de produsul specificat de fac-
t,oruL domina,nt.
Reaparifia factorului recesiv în F2 a sugerat lui Mendel
fenomenul de segregare. Segregarea factorilor ereditari se su-
prapune segregàrii cromozomilor omologi din bivalenli î,n
timpul meiozei. Fiecare din cei doi cromozomi omol,ogi conline
fie factorul ereditar ,,A((, fi,e factorul ereditar ,,as a,ja încît prin
separarea lor spre poli opuqi, aceEti factori ereditari vor fi se-
parati qi ei în nuclei diferili respectiv în gamefl diferifi atît
la pàr'intele de sex femel cît Ei la pàrintele de sex mascul.
Cîncl într-o ce1ulà se aflà douà alele (Aa) acestea vor fi dis-
tribuite egai în gameli. Din cei patru produgi ai meiozei (ga-
meti) doi vor primi 'alela ,,Att $i alîi doi alela ,,as. Raportul de
segregare alelicà este 24:2a sar simplificat 1:1. Acest fenom'en
de segregare, disjunclie sau dezbinare a factorilor ereditari se
numegte principiul, segregdrii sau prima lege a lui Mendel. Ea
statueazà cà dacà orgarnismele pot fi pure din punct de vedere
genetic (homozigote domirnante AA sau homozigote recesive oo)
sau impure di'n punct de veder",e genetic (heterozigote Aa), game-
lii sînt legic puri din punct de vedere genetic prin faptul cà,
derivînd în urma divizunii meiotice, cînd are loc reducerea nu-
màrului cle cromozomi respectiv separarea factorilor ereditari,
ei confi,n fie f,ac0orul ,eneditar A, fie factorul ereditar o, nici,oda-
tà, în condilii normrale, ,arnbii faet'ori er,edirt'ari. Principiul segre-
gànii (s,eparàrii f,acùoriior erreditari)

tn.(, oo<2, AA<1) * aplicà în cazul factorilor ered.itari


plasali în acelagi locus pe cromozomi omologi.

155
Considerînd fenomenul segregàrii, se constatà cà dacà în
F1 org'anismele rezulta'te din încrucigarea a doi geniùori puri
genetic (soiuri pure sau linii pure) sînt TAAo/o h,eterozigote,
datorità fenornenului de segregare, procentul organismelor he-
terozigote se reduce, cu fiecare generalie la jumàtate (fig. 4b)
astfel cà teoretic, dupà circa B generafii, în populalia respecti-
và predominà organismele homozigote. Prin autopolenizarea
organismelor homozigote rezultà doar organ,isme homozigote
conform sehemei di,n fig. 45.
Prfur autofecundarea organismeior heterozigote a,re loc se-
gregarea oaracterel.or. Aceasta este o cale de a deosebi orga-
nismele homozigote de cele heterozigote.
Reducerea heterozigoliei Ei creEterea homozigofiei are mare
irnportamta î,n practica amelioràrii. D,e exemplu, fenomenul cle
heterozís (vigoare hi'bridà) are la bazà,, ca mecanism genetic,
constitufia 1000/o heterozigotà, a organismelor hibride. Inseam-
nà cà acest fenomen se manifestà cel mai intens în prima ge-
nerafie. În celelalte g'enerafii prin sqgregare se redute graAul
de heterozrgofie qi implicit valoarea heterozisului. Totoda(.à se-
greganea are importan!à practicà în o',blinerea de forme homo-

,/-1, F1 (orsantsnp t00o/o hpteroz:ú:tFt

tY
I Aufofecu ndare
l( segregà )

?5"/" l7j",/o ì5o/o l?,5o/o 2 5 a/"


{-5"h
17.90/o '/
Fig. 45. Schema red.ucerii heterozigofieí qi cregterii homozigofiei cu
fiecare generalie de autofecundare (autopolenizare).

156
zigote linii prrîe (linii
consangoínizate) din a caror încruci-
gare se-oblin, hibrizi simpli care, la rîndul lor, prin încruciqare
dau hibrizi dubli. Aceste aspecte genetice stau la baza ob{ine-
rii liniilor consangvinizate, a hirbrizil,or simpli Ei dubl,i de po-
rumrb, floarea soarelui etc.
La animale consangviurizarea se realizeazà. prin încruciqàri
de tip incest, mamà-fiu, tatà-fiicà, sorà-frarte etc. încît nu se
obline o puritate absolutà a liniilor consangvinizate. De ase-
menea segregarea are mare importa.n!à în sfatul genetic. O ma-
ladie ereditarà umanà, determinatà de o genà recesivà care s-a
manifestat la bunici, sare peste o generafie (pàrinti) qi se ma-
nifestà din nou la copii. În funclie de naturà dominantà sau
recesivà à g€n€i qi de fenomenul de segregare se poate stabili
riscul de aparilie a'bolii.
Cazutr acesta în care un element (alelà) al perechii de fac-
tori ereditari este complet do,minant iar celaLalt element, este
complet recesiv se numèqte dominn:nfd completd. În cadrul sàu,
în genenal uru se poate spune, judecînd dupà fenotip, dacà un
Índivid este homozi,got sa,u heterozigot pen,tru alela dominantà.
Genotipul unui individ care prezintà fenotip dominant poate fi
úotuqi determiurat dupà fenotipurile qi frecvenfa lor analizate
la desaendenlii pe care acesta îi produce în urrtà; încrucigàrii
sale cu un individ homozrgot recesiv pentru acea pereche de
faetori ereditari. Aceastà încruciqare se numeEte test cross. Fe-
notipurile Ei frecvenga lor la desoendenlii rezultafi din test cross
oorespund tipurilor qi frecvenfelor genotipice ale gamelilor
produgi de organismul al càrui genotip este necunoscut. Cînd
individul test'art a avut unul dintre pàrinfi sau stràmoEi recesiv
pen'tru perechea de factori er,editari analiza,tà, test crossul se
mai numeg"te back cross sau retroînuucigare. Dominanfa face
ca numàrul claselor fenotipice sà fie mai mic decît numàrul
claselor genotipice. De as€menea dominanfa cauzeazà, regresia,
adicà pàrhfii care sînt fen<vtipic extrsmà pentru un caracter
cantitativ (productivitate) dau descendenfi care sînrt în medie
mai pulin extremi. Deoarece dominanla mascheazà prezenla
geureJ.or recesive, o încrucigane dintne doi indivizi de acelaEi
fenotip (de exemplu cu blana neagrà, culoarea fiind un ca-
racter cantitativ A) luafi la întîmplare poate produce descen-
den{i de culoare deschisà (a). Acoastà tendin{à a pàrinlitor (A}
care feno,tipic sînt extreme, de a da descendenli care nu sînt
extreme se numeqte regresie.
La orga,nismele polipl,oide fenomenul de s,egregare este rnai
cornpltoat, în sensul cà raportul de sqgregare este de 35 A :7 o,

L57
deci frecvenfa cu care apare organismul homozigot recesr'v ,este
foarte micà (tabelul 4)
Tabelul 4
Rozultatul lneruelgúrll a douú organlsmc poli'
plolde reprezentin.l ttntl pure genctlo (homo-
zlgote AAAA x aaaa) in a doua gonorafio
(AAaa x AAaa)

IAA

IAAAA I n^o^" lAAaa


4AAAa Itoea". 4Aaaa
lAAaa +eaaa laaaa
|

Cind se considerà perechi d,e factori ereditari ptasali pe cro-


rnozomi diferifi se constatà cà apar aspecte n,oi ale comportà-
rii acestora.

4.2. DIHIBRIDAREA

Mendel qi.a propus sà urmàr,eascà modul cum se transmiù


simultan douà perechi d'e factori ereditari: una cane determinà
f'orma bobului (A:neted; wùbîrcit) Ei alta care determinà cu-
loarea bobului (B-galben; b:verd€). Pentru aoeasta a încru-
ciEat un soi pur cu bo,abe neted'e Ei gal'bene (AABB) cu un soi
pur care prezenta boabe zbîrcite qi verzi (aabb). Asemenea ex-
perien!à de încruciqare în car,e se iau în considerafie douà pe-
rechi de caractere se nume$te dihibrid&re. ln prima ,gtsneragie
a oblinut ,o populafie hibridà pentru am,bele caracter,e (AaBb),
care prezenta caracùer,ele de rbob neted Ei galben, ceea oe în-
s€@rnnf, cà acestea sînt caracter,ele dominante, cele de bob
zbîrcit 9i verde fiind deci canacùere recesive. Pentru a obline
a doua generalie a làsat sà se autopolenízeze plamtetre dublu-
hibride din prima generalie dupà schema din fig. 46.
Analizînd tabelul, numit în unele lucràri mai vechi în
mod sugestiv ,,gahul cornibinàrilor mendeliene(( sau tabelul lui
Punett se consbatà cà prin segregarea facboriùor erreditari î01
meiozà derivà patru cartegorii distincte de game{i rnaseuli qi tot

158
atîtea de gam'efi femeli. În pro-
pÀtjttli o
cesul de fecundare are loc uni- +
rea pe bazà de probabilitate a
gamelilor mascuùi cu cei femeli,
adioà fiecare gamet mascul. (sau 6AMÍIi
femel) are Sanse egale cu ale
oelorla'lfi 3 de a se uni cu fie-
care din gamefii de sex opus. F1
Rezultà 16 posibilitàli de com-
binare, respectiv 16 coantbinalii
de factori ereditari. În virtutea
relaliei dominan!à-recesivitate,
oriunde se întîLnesc factorii ere-
ditari dominanti A respectiv B
,@j@" F2

va fi exprimat în fenotip carac- AB Ab aB aÌ)


terul respectiv (neted sau gal-
ben). Cîrrd ei sînt prezenS si- AB AAB B AABb AaBB ìAaBb
multan în acelaqi genotip, vor Ab AA Bb AAbb AaBb jealr
fi exprimate fenotipic atît ca- aB Aa BB AaBb aa3il laarr
racterul rneted cît qi canac"terul
gal'bern. Caracterele reaesive vor ab AaBb Aa bb aaBb aa bb
fi exprimate feurotipie doar în
cazul în oare factorii ereditari Fig a6. Dihibtid.area (Segregarea in-
recesivi (o qu b) nu sînt în pre- dependeutà aereditari).
perechilor de factori
zen\a factorilor ereditari domi-
nanfi corespunzàbori (A qi B).
Din analiza celor 16 combinàri de factori ereditari se constatà'
urmàtoarele :

simultan ambii factori dominanli @B) condi-


' prezíntiexpresia
9/16
lionînd caracterului neted gi galben;
3/16 prezintà un factor ereditar dominant { altut recesiv
' óondilionînd dezvoltarea unui caracter dominant gi a
altui baracter recesiv (l Ó _ bob neted gi verd'e) ;
3/16 prezintà celàlalt_fa-ctor ereditar dominant 9i pe celàlalt
recesiv (aB : bob zbîrcít ;i galben) ;
1/16 prezintà. ambii factori ereditari recesivi condilionînd.
exprrmarea fenotipicà a caracterelor recesive de bob
zbîrcit gi neted.
De fapt, în experienla sa, Mend.el a obligut -în F, 556 de
plante diirtre care-315 au produs boabe neted'e ;i ga-1b^e19, 108
6oabe netede gi verzi, l0l boabe zbîrcite 9i galbene 9i 32 boabe
zbîrcite gi verzi.
159
Deoarece probabilitatea apariliei unui caracter dominant
este de 314 iar a unuia recesiv este de ll4, gi probabilitatea
apariliei simultane a douà evenimente înd.epend.ente este egalà
cu produsul probabilitàtii apariliei lor separate (individuale) este
u;or sà desprindem de unde rezaltó"raportul de segregare 9:3 :3:1.
Probabilitatea apariliei lui A este de 3/4, a lui B tot de 314,
a lui a de ll4iar a lui D tot de l/4. Probabilitatea apanlíei simul-
tane a lui A gi B este de 314 x 314 :9/16.
AB
- 314 x 314 - 9116 bob neted pi galben
Ab : 314 x U4: 3/16 bob neted gi verde
aB:314 x ll4 3116 bob zbîrcit gi galben
-
ab: ll4 x ll4: l/16 bob zbhcit gi verde
De fapt raporturile rezultà din desfacerea expresiei

G^+:i,)*(+" *ioJ.
Admi!înd cà P reprezinti probabilitatea evenirnentului X
(gamefi nerecombinali) iar q probabilítatea evenimentului Y
(gamefi recombinali) respectiv contaprobabilitatea evenimen-
tului X (l-P) se poate calcula frecvenla apanliei recombinàri-
lor în caz;ri, unei încrucigàri dintre organisme dublu heterozigote
(AaBb x AaBb). Rezultà patru tipuri de gameli femeli gi patru
tipuri de gameli masculi. Dintre acestea, douà sînt nerecombinante
(AB gí ab) gi douà sînt recombinate (Ab Si aB). Probabilitatea
apariliei unui eveniment este egalà cu raportul dintre numàrul
cazurilor favorabile ;i numàrul cazurilor posibile. Probabilitatea
apariliei sirnultane a douà evenimente este egaló cu produsul pro-
babilitàlii apariliei lor separate. Probabilitatea X- P:+.
Probabilitatc'a I-{ :I:;t I
p +I:li Q:l -p; p
-1 - q

Frecvenla gamelilor nerecombinali - +a T


Frecvenla gamefilor recombinanli g d
'z - Zt

Pentru a calcula probabilitatea de aparilie a unui anumit (t


r(
tenotip se proce deazó" astfel : pentru fenotipul Ab : e'
pt, p(l-p),p(l-p) pr+p-p'+p-pr :_:2p-p' _
p(2-p) r(
' fÌ
4' 4 4 4 4 4

160
Tot astfel se procedeazà' în vederea calculàrii probabilitàfii
de aparilie a celorlalte fenotipuri (AB, afl;t aó) folosind datele
din tabelul 5.
Analiza fenotipicà a indivizilor din generalia Fz a aràtat cî-
teva aspecte import,ante privind comportamentul factoril,or €r€-
ditari. În primul rînd s-a dovedit încà o datà realitatea segre-
gàrii factorilor ereditari. Dar mai importantà este aparilia unor
categorii noi de indivizi. Astfel, în clihi,bridare s-a pornit de la
clouà tipuri de plante: cu bob neted Ei galben (AB) gi cu bob
zbîrcit Ei vei'de (cb,) gi în F2 au apàrut pe lingà aceste douà
tipuri iniliale încà d'ouà tipuri care prezenitau un caracter de
la un genitor Ei ait caracter de la celàlalt genitor. Avea loc deci
1a descendein{i o dezbinare a cuplurilor de caractere parentale.
Si,ngura explicalie plauzútbil,à era urmàtoarea:
La nivelul hibridului din prima generalie (AaBb) perechea
de factor:i ereditari care determinà forma ,bobului (Aa) segregà
independent de perechea de factori ereditari care determinà
culoarea bobului (Bb) Ei astfel se creeazà posibilitatea proba-
bilisticà a asortàrii independente a factoriior ereditari astfel
încît în acelagi g'amet va putea trece un factor ereditar de la
o pereche Ei un factor ereditar de ia ceaialtà pereche (fig. a7).
Acegti gameli se ,numesc game[i recombh,a[i. Dacà ,n'u ar fi o
segregare independentà a cetror douà perechi de factori eredi-
tari, aiunci ar lua naqtere doar douà categorii de gameli qi anu-
me rgamelii nerecom,bi,nanli AB gi ab care ar condiliona for-
marea a douà caúegorii de organisme cu bob neted Ei galben
AABBOt X aabbd

Fig- 47. Segregarea indepen-


dentà a perechilor de cromo-
zorni însolità de segregaîea
(disjunctia) independentà a pe-
rechilor de factori ereditari,
evenimente caîe se presupun
reciproc Ai se suprapun, des-
fàgurîndu-se în meiozà., Ia fot-
maîea gamefilor.

I I - Descifrînd tainele ereditófii, vol. I 161


(t) Tabehtl 5
t9
Probabllltàflle de aparlflo a dtferltelor fenotlpurl

Gamefi AB Ab aB ab
\
o\ó
a\ (?) r*) {;) (?r
AB ABAB ABAb ABaB ABab
I -p 1-p_(l-p)' p p(l-p) I -p p(l -
._: p)
t?) 2 oo
-2
P

Ab ABAb AbAb AbaB Abab


p 1-p p p_p2 ppp2 l_-p_p(l-p)
:- p(l -p) p
t;) 224 224 224 2

aB ABaB AbaB aBaB aBab


1-p_p(l -p) ppp2 p p_p2 P.L:-P:qO-P)
(*l 224 224 224

ab ABab Abab

(?t I -p L___r_(l-p): p I -p p(l - p) f-!r p p(l-p)


t 2 2 24
(AB) $i cu ibob zbîrci,t qi ve,rde'(ab), adicà s-ar pàstra ú,ipurile
inifiale, paneurtale, de organúsyne.*
Cunoscînd cà în meiozà ar,e loc disjuncfia independentà a
perrechilor de cromozomi omologi gi qtiind cà factorii ereditari
sînt plasati pe cromozomi, este ugor de tras concluzia cà pen-
tru a segrega ind,ependent unra de al,ta, cele douà percchi de
fac[ori ereditari Ao Ei Bb tre{buie sà fie plasate pe ,pe'rerohi di-
ferite de cromozomi.
Segregarea independeu:tà a douà pereehi de factori ereditari,
respeetiv de caracúere în care apare naportuL de segnegare
9 :3 :3 : 1 poate fi uqon redusà la segr,eg€ulea a douà cara'cúere
aleilomorfe, dacà se considerà segregarea separatà a fiecàrei
perechi de caractere. Astfel, oonsiderînd pe,redrea Ao, fàcînd
abstractie de perechea, Bb r,aportul de segrqgare va fi
9.3 t2
_t_
16'16 - -16^pentru factorul I gi

3l 4
pentru factorul 6I sau simplificînd. va fi deci
-t_
t6'16 l6
3.1 adici 3A la \a
14

Situalia este identicà pentru perechea Bb, cînd se face


absúraclie de perechea Ao.
Peutru a càpàta o anumità" certitudine, mai exact pentru
a se asigura statistic cà segregarea este o lege, Mendel a aplicat
testul chi-pdtrat y2 l, ! în care se introduc valorile agtep-
-
tate potrivit raportuloi à" sgregare stabilit în alte experienle
(9: 3 : 3 : l) gi valorile care se determinà în experienla curentà
actualà.

* Disjuncfia independentà a perechilor de factori ereditari impor-


bantÈiqi în prac.tica a,melioràrii face oa din or,ganisme dubùuihet€n:ozigote
de tip {AaBb, prin ,autofecund'are, sà se oblinà pe lîngà orìgriulisÍtele d,u-
blu homozigote inigiale (AABB qi aabb) noi categorii de organisme dublu
homozigote (AAbb pi aaBB) ca qi al,te oategorii homozigatn pentru o
singu,rà pereche de caractere (A,abb sau aaBb). Aceste,a, alàturi de onga-
nismele recombinante, pot sA reprezinte obiective irnportante în progr'a-
mele de ,ameliorare.

163
Astfel, dacà într-o experienfà de ttp AABBXaabb se obtin
urmàtoarele daúe (tabelul 6)
Tabelul 6
Caleulul lui It pontru Eogrogatoa ln F, a raportului g: 3: 3: I

Valcri AB Ab Total

observate (0) 2834 920 951

a;teptate (e) 2808 936 936

Diferenfa (d:0-e) 26 16 t5
dr 676 256 225
Dr
e
4,24 4,27 I 0,21

valoarea Lui Xz de 2,75 pentru cele 3 grade de libertate (4


clase fenotipice 1) corespunde l,a o probarbilitate de tr'ans-
gresiune care este- mai mare de 0,30 dar mai micà de 0,50
(p 0,50 0,30). Aceasta inseamnà cà din 100 de repetàri ale
- experienfe
unei - date, la 30 pînà la 50 dintre e1e vor apare de-
vieri probaibile de la naportul 9 :3 :3 : 1, egale sau mai mici
decît cele observate. Cum valoar,ee, lui p esùe clar mai mare
de 0,05, rezultatel'e observate pentru raportul 9 : 3 :3 : 1 sint
în acord cu oele agteptate pentru asortrarea independentà a
d,ouà perechi de alele. Repetabilita,tea 1,or cu o as€menea frec-
ven!à nu se poate datora întîmplarii ci mai curînd qqor cauze
intrinsece a desfàEuràrii me'c,anúsmului ereditar la nivelul c,B-
lulei dupà anumite legi ,exacte. Astfel, segregarea apare Ìegic
determinatà gi statistic asigura:tà. Considerarea caracteruiui sta-
tistic al fenomenului ereditar se bazea'zà p'e admiterea cà fiecare
dintre produqii meiozei (gametr) prezintà qansà egaià de a par-
ticipa în procesul de fecundare. Marile evenimen'te genetice
se desfàEoarà însà în meiozà.
Cea de-a doua lege el,aboratà de Mendel gste legea esor-
tdrii sau. disjwtcfiei indepenlnnte ,a perechilor de factori ere-
ditari (gene) qi se referà la gene oare sînt plasate pe cromoz,omi
neomologi.
Niciodatà gaarrefii nu vor fi Aa, Bb, ABb etc. decît numai în
cazurile anormale, rare cînd are loc nondisjunclia meioticà a
cromozomilor oare este însofità în consecin!à de nesegregarea
factorilor ereditari. Cînd se fac încruciqàri între douà soiuri

164
pure, luîndu-se în oonsiderare tnei perechi de factori ereditari
(AA, BB, CC X dn bb cc) tabloul segregàrii este mult mai corn-
p1ex. Asemenea experien?e se numesc experienle de trih,ibri-
dare. Se 'oblin cîte B tipuri diferlte ca genotip de gamefi atît
masculi cît qi ferneli Ei r,ezultà 64 de oombina{ii dînd un r,aport
de segregare de 27:9:9:9:3:3:3:1, ceea oe înseamnà cà
frecvenfa de aparilie a formelor homozigoùe este proporlional
rnai redusà decît în monohibridar,e sau di'hi'bridare.
Segregarea independentà a per',echilor de fac'tori ,ereditari,
respectiv a perechilor de cnomozomi r,eprezintà în sin,e un me-
canism de recornbinare genutied, intercromozomnld. Acest tip de
re oombinare geneticà carac bertzea'zà, doar organrismele eucariote
càci doar ele conlin mai multe grupe de lineaj, r'espectiv mai
mulfi cromozomi neomologi. Recombinarea inúercrom,ozomalà
reprezintà segregarea de cromozomi întregi în' meiozà care
determinà segregare,a de gene nelincate adicà de perechi de
alele localizate în cromozomi n,eomol,ogi.
Fenomenul disjuncliei independente a per,echilor de cro-
mozomi respectiv a perechilor d,e factori ereditari este de fapt
un fenomen predeterminat de ag€Zarea rand'omizatà a om'olo-
gilor din bivalenli fa!à de planul ecuatorial al plàcii metafazice.
În virtutea acestui fapt, prorbabilitatea ca toli cromozomii de
origine maternà de la nivelul tuturor bivalenfilor sà se aEeze
deasupra planului ecuaúorial sau toli cromozomii de origine
paternà de la nivelui tuturor bivalenlilor sà se aEeze sub planul
ecuatoriai al pl,àcii metafaziae este egalà cu pr'obabilitatea ca
aceEti cromozomi de origini diferite sà se aqeze unii deasupra,
allii dedesubtul planului ecuat'orial. Asemenea agezare rando-
mizatà a cromozomilor d'e origin'e maternà qi paternà fa!à de
planul ecuaúorial al p1àcii metafazice în metafaza I condilio-
neazà distribu{ia independentà a perechil,or de cromozomi, res-
pectiv de factori ereditari spre poli în anafaza I. Din aceastà
cauzà este corectà interpretarea în termeni de predeterminare
pe care o dàm fenomenului de disjuncfi'e independentà a pe-
rechilor de faetori ereditari. În absenfa urir€i asemenea prede-
terminàri factorii ereditari de origi,ne maternà (AB) ar migra
totdeauna la un pol,, pe cînd cei de origine paúernà (ab) ar
rnigra ia po1ul opus, rezulúînd doar douà tipuri de game{i (AB,
respectiv ab), neexistînd posibilitatea apari{i,ei de gameli re-
combinanfi, (Ab Ei oB).
Distribulia polarizatà,a crom,ozomilor particulari ia un pol
al fusului de diviziune are l,oc foarte r,ar qi duce la o asortane
ner,andomizatà $i 1a o segr,egare nerandomizatà de markeri ge-

165
netici. Sqrqgarea independentà a perectrilor de f'ac"tori' u€di-
tari respectiv a pereohil,or de cromozomi cane asigurà necom-
binarea geneticà intercromozomralà face ca probatbilitatea ca
doi garnefi sà fie 'asemànàtori sà fie,foante micà. Astfel, cun-
siderînd omul, catre aret în gamitura diploidà 46 cromozomi, iar
în gamefi 23 de cromozorni gi adrnifînd cà în fiecare cîorlozóm
s-ar a,fla doar o genà, proba,bi,litatea oa doi gamqi sà fie iden-
'tici grenotipic este o" (;)- iar ca doi indivizi um.mri sà fie
identici genetic este de (+ft. Aceasta reprezintà o probabili,tate
extrecn de micà qi este posibil ca în populalia umanà de la ori-
ginile sale sà nu fl exisùart doi iqldivizi asemànàtori. Ercepfie ar
pu,tea sà facà gemenii monozigoli care pot avea o constelalie
identicà de faretori, ereditari nucleari dar qi în acest caz pot sà
aparà diferenle în oonstelatia de facùori ereditari extranucl€ari
(rnitoctndriaùi de exemplu), distribuirea mitocondriilor în
timpull diviziunii fiind mai pufin echilibratà. Distri'bulia echi-
li,bnatà a fagtorilor ereditari nucleari este asigunatà de mecarnis-
mul mitotic de diviziune.
Dar probabilitatea ca doi indivizi ai unei specii daúe sà fie
identiei este qi mai micà dacà luàm în considera{ie faptul cà
pe fiecare cromozom n'u se sflà o singurà genà ci mai multe
gen€. Consideirînd spe.cia uma,nà rei,ese cà fiecare individ este
o enrtiúste geneticà irepetabilà.
Cercetàrile lui' I\ttendel, au pus pia'tra de temelie a Geneti-
cii. Publicate într-o rwistà de sla,bà circulafie sub titlul ,,Ver-
suche ùber Pflanzenhybriden( el.e au fost date uitàrii. Savanlii
timpului erau încà cu a'tenfia îndreptatà spre teoria lui Darwin
asupra originii speciilor prin seleclie naturalà, uitind de alte
descoperiri tot atît de geniale. Se spune cà Meurdel nu a avut
loc înr seool,trl lui. Elr a fost pur Ei simplu mutat în secolul nos-
tru. Destinul luii qtiinfific a fos'ù qi mai dramatic dacà ne gîndim
cà Menilel a murit cu Bîndu} cà ceea ce a descoperit el s-ar
putea sà nu fie o realitate a naturii. Acest fapt s-a datorat efec-
tuàrii unor ercperiernle de hi,bridare Ia Hùerupdwrn, plantà apo-
micticà, cane nu are deci o meiozà ti,picà qi, cum este qi firesc,
nu s-{a supus legilor mendeliene a,le eredi;tà{ii.
Cercetàrile lui Mendel a'u revolufi,onat bíologia. Pentru pri-
ma datà, dupà 23 de secole, era dàrîmatà concep{ia lui Hippo-
crate despre transmiterea directà a caracterelor de la, pàrinli
tra descendenli.

166
Rel'uaúe 1o alte plante qi la animal,e, legile descoperite de
Meerdel privind comporrtarea factorilor ereditmi s-au dovedit
tmiveml aplioabile, iar excep(iile nu au fàcut decît sà currfir-
ilre rqula, extinzînd qi' dezvoltînd concep,m lui Mendel despre
crndita,te.

4.3. EXCETTII DE LA BAFORTURILE MENDELIENE


DE SEIGBEGARB
CAZUBI PABrICUTIIRE DE ENEDITAÎE

1.3J-. NMTNANTA INCOMPLETA SAU SEMTDOMTNANTA

Corrtns, redescoperitorul legilor lui Mendel a,làturi de


Tschermak qi Hugo de Vries, încruciqînd un soi de Miruhilis ja-
lng cu ftro.ri roqii (AA) cu 1rrì, soi cu flori aìXbe (aa) a oblinut
în prima genera$e tritbridà (Aa) doar plante eare fàoeau flori
noz. Prin autopolerrizaîeà, acestora (Aa X fu) a ob.tinut în F2 un
raport de segregare diferit de cel mendelian obí$nuit (3 : 1).
2s% 50% 25%
Amta a fos't de 1 : AA :2 Aa : I u. Dupà cum se vede, în acest
îotu toz alb
caz rapÉul de segrcgare Senotipicà corespunde cu raportul de
segregane fenotipicà, iar homozigo{ii dominangl (AAJ se expri-
mà fenotipic diferit (rogu) de heterozigoli (roz). Gena A n,u se
marrifestà ca, totatr dominrantà asupna lui ,d' iar ,pf' nu se ilna-
nifestà ca total, recisivà fatà de A. Cele douà gene se nra-
nifesG cu intensi,tat€ egalà. Fenomenul s-a numit dominsnPd
incompleúò sau sqnidsrnirwr4d. Î'n experienfele pe maeàre era
o domirran!à completà qi segrqarea in acest Gaz s-a numit se-
gregame de tip Piswn. La Mirabiùls este vorba de o dominanfà
incompletà iar segrqgarea sra numit de tip Zm càci fenomenul
a fost prima datà observa,t lia porumb prin încruciEarea un,ei
varietà{i' cu 'boabe albastre cu o varietate cu rboabe albe din
caFe au ie.qi,t plante hi'bride cu boabe violacee. Tot astfel din
încrucigarea unor gàini cu penaj negru cu gàini cu penaj ,alb,
rezultà gàini de Andaluzia care au penajul al,bastrui. Cum gài-
nile de Andoltnùs, (cu penajul albàstrui) sînt impure genetic
(,hihride) ele segregà în fieoare generafie, din care cauzà n-a
fost posibilà crearea unei, r'a$e de gàini cu penajul albàstrui.
La om, cel' mai cunoscut exemplu de dorninanfà incompletà
este oel al anemiei falciforme. Gena muta,núà s conditioneazà

r67
sinteza unei forme mutante a catenei 0 a hernoglobinei qi facc
ca sà aparà hemoglobinra HbS în loeu1 hemoglobinei normale
HbA.
Indivizii hom,ozigoli s/s de regulà mor înainte de maturitate,
prezentînd anemia falciformà. Heterozigolii Sis sînt viabili qi
prezintà eritrocite f,aiciforme, dar anemia 1or nu este atît de se-
verà ca la indivizii s/s, prezentînd numai tultburàri de respira-
lie ia altitudini mari, unde oantitatea de oxigen e redusà. Cînd
hemogiobina unor asemenea indivizi este analizatà electrofore-
tic se constatà cà aceasta oonfine carntitàli echimolare de catene
normale gi de ca'tene muùante {3. Acesta ar fi un caz Ce codo-
minnnfd, dacà se considerà ,,fe,notipul in vitro((. Aceast,a înseam.
nà cà ambeie gene S gi s funclion e'azà cu aproximativ aceeaEi
eficien{à. Dominanfa lui S este incompietà, dar adesea se con-
siderà cà cele douà alele S si s sînt codominante.

4.3.2. SU P RADOM INÉNTrr

Cînd fen,otipul heterozigotului (Aa) depàqeqte prin caracte-


risticile sale cantitative ambii genitori homozigoli se înregis-
treazó. fenomenui de supradominanfd. Supnadominanfa s-a în-
r,egistrat în cele mai multe cazuri în care se ran,aliz eazi màri-
mea, pr,oductivitatoa qi via,bilitatea descendenlilor. De. exemplu,
la Drosophila, gena care deterrninà culoarea albà a ochiLor este
lecesirrà (zp) iar gena care determinà culoarea ro$ie, norm,alà
a ochiior este dominantà (tn+).În stare hetenozigotà fu:+/tr.:) se
constatà o creqtere notabilà a cantitàtii de pigmenfi (în speci,al
a sepiapterinei) atît fa!à de homozigolii cu .oohii aùbi (u/u:) cît
Ei fala de homozigolii normali (u+/ut+1

În cazul codominanfei genotipul heterozigot dà nagtere la un


fenotip diferit fafà de ceie det'errninaúe de genotipuriie ,homo-
zigote. Aoest fenomen se înregistreazà qi în semidominanfà
(dominan{à incompletà). în cazul codominanlei însà, spre de-
osebir,e de semidominan{à, genele alele ,nu au raport de domi-
nan!à sau recesivitate, ele fiind dominante fafà .de, alte gene

168
dintr*o serie de mai multe alele, dar codominante uura în ra-
port cu ceaùaltà.
De exempiu, la om grupele sanguine au un determinisiu ge-
nic'polialelic. Grupa sanguinà A are formula genotipicà 14^
homozigot dominant sau l l0 heterozigot.
Grupa sauguinà B are determinismul genetic LÍIB respectiv
FlÙ.
Grupa sangvinà 0 are determinismul genetic 1010.
În toate aceste cazuri alelele I ;i lB se manifestà ca domi-
nante fa!à de alela /0 care este recesivà. Cînd. însà cele douà
alele dorninante se întîlnesc în genotipul indivizilor cu grupa
sangvinà AB, care are deci formula l^lB, nici una dintre ele
nu manifestà dominan!à sau recesivitate f.a!à" de cealaltà. Ele
codominà . fl c9.1d!!io-neazà. apurt.fia.,unui nou fenotip (gtop.*
sangvinà AB) diferit de cel al pàrinlilor (mama grupa sangvi-
nà A, tata - grupa sangr;i1[ B sau viceversa). -
Un exemplu tipic de cod,ominan!à es'úe locusul esterazei-î
de la Drosophila melonogaster. Una din cele d,ouà alele ale
ecestei gene pr,oduce o formà F ce migreazà rapid (fcrst rnigra-
ttng) pe gelul electroforetic iar cealaltà alelà produce o formà
S a enzimei esterazice, ce migreazà îneet (slous migroting).
Analiza extractelor din indivizi heterozigofi, desemnali F/S
aratà cà cele douà tipuri de enzimà sînt prezente în cantitàfi
tga,le. Prezcnfa unei proteine nu are vreun efect aparent asu-
pra eantitàlii sau activitàtii eeleilalte enzime. Asemenea enzi-
me se numesc ismime.
Majorita'tea wozlrnelor sînt d eterminate printr-o interacliun e
al,elicà de tip codominan!à, gi ele se pun în eviden!à în extracte
celulare nu prin analizà fenotipicà propriu-zisà a întregului or-
g'arrism càci indivizii F/F, F/5, S/S nu pot fi deosebili dupà
tenotip, ci doar prin analizà electroforeticà, tipuriie homozigote
prezenúînd o singurà bandà electroforeticà pe cînd tipul hete-
nozigot prezintà douà ,benzi, una F, alta S.

4.3.4. ALELE MU LTIPLE (POLTALELTA)

Alelele reprezintà alternative ale ace,leiagi gene, controì.înd


expresii diferite a,le aceluiaqi caracter. În urma mutaliei genei
de tip sàlbatic care de reguià este dominar,rrtà (A) apare alel,a
sa reeesivà (o). Mutafia este mult mai rarà în sens invers

169
(a-+A). Genele la organismele diploide se aflà sub formà de
pereche (alele) Ei sînt dispuse în, acelagi locus F cromozomi'
omologi. Fiecare din crei doi cromozomi ,omologi ai unei perechi
va oonline î,n, ,locusul corespunzàtor doar cîte o alelà dintr-o
pereche de a'lele ,ale unei gene, fie A, fie a. Niciodatà cel,e
douà alele nu vor fi plasa,te (suprapuse) în aceleqi locus, pe
acelaqi cromozom.
Proc,esul de mutalie s-a desfàEurat progresiv în timp qi el
a dus mai întîi la aparilia din gena inilialà A a alelei sale re-
ces,ive ,,at6. Dar într-o altà etapà, din ac€eaEi genà inifialÈ A, &
putut deriva alela,q care controleazà o altà expresie a raceluiagi
caracter. Mutalia genei A, desfàEuratà înx diferite sensuri a
determinat aparilia unei serii de alele 'c1, @' o3 . . . ant care
controleazà varia{ia expresiei aoeluiaqi caracùer. Asemenea gene
poartà numele de polialele sau otrele mttlbiple. Seria h, o2, as. . .
an este o serie polialelà. Toate aceste alele ocupà acelaqi locus
pe cromozomii omologi. Aceasúa nu înseamnà cà toate alelele
vor fi plasate în acelaqi timp, într-un singur locus pe perechea
de cromozomi omologi. Fenomenul polialeliei este un fenomen
populafional, ceea ce înseamnà cà la unii indivizi ai populafiei
considerate, pe o perectre de cromozomi omologi se aflà într-un
ltocus precis delimitat perechea AA; la alti indivizi pe areeagi
pereche de cromozomi omologi, în acel,aqi locus, se va afla
pe'rechea are, la alfii ortla q.a.m.d. La indívizii heterozigoti pe
tln crornozom omolog, înúr-un locus dat se va ,afla alela domi-
nantà A, íar pe celàla1t cromozom omolog, în acelaEi locus (lo-
cus corespunzàtor) se va aflta fie alela r,ecesivà a1, fie ale,Ia re-
cesivà a2'etc.
Cazul citat la codominan!à este în acelaEi :timp un caz de
polialelie. Cele úrei gene IA, Iu $i 70, ocupà acelaqi locus pe
cromozomii omologi qi oontroleazà variafia grupei sangvine în
populafia umanà, fàcînd ca unii ilrdivizi sà ai,bà grupa saqgvinà
A, alfii grupa sangvinà B, al,tii grupa sangvinà AB qi af{ii gru-
pa sangvinà 0.
Existà un principiu fundamental al imtrnoltogiei potrivit
càruia urÌ orgarrism, în condilii normale, ru va produoe anti-
corpi împotriva sa. Astfel, dacà una di,n,trre proteinel'e produse
d,e un organism este antigenul-P, atunci anticorpul anti-P nu
se va produce în serul aceluiaqi organism. Eri,trocitele umane
prezintà antigene, pe cind serul sarugVin oonfine anticorpi. Cînd
serul de la un individ cu grupa sangvinà A se amestecà cu
eritrocitele de la un individ cu grupa sangvinà B, apare r.eacfia
de aglutinare. Tot la fell se înf;implà cînd serul de Ia indivizi cu

170
grupa B se amestecà cu eritrocitele de la indivizi cu grupa
sangvinà A. Pe de altà parte, amestecul de ser qi de celule
de la acelaqi imdivid, sau mai exact de la indivizi care au
aceeaqi grupà sangvinà nu determinà ooa,gularea. Aceste ràs-
punsuri' diferite sînrt determinaùe de o clasà de antigene loca-
liaa'tà pe suprafafa eritrocitelor. Astfel, alteùa dominantà fé'
specificà antigenul A qi anticorpi anti,-B, alela domi,nanúà 18
specificà antigenul B Ei anticorpi anti-A, iar alela recesivà 10
mu specificà nici o structurà anúigenicà.
Analiza biochimicà a eviden{iat, faptul cà antigenul A este
o o-N-acetil-D-galactozaminà, atagatà de un gl,icolipid sau glieo-
proteinà, aflnte la slrprafala eritrocitului. Antigenul B es@ o
o-D-galactozà. Persoanele cu grupa sangvinà A au enzima
a-N-acatilgoloctolm.núltransfetwn care ata$eazà galactozamin'a
la l,ipidul sau proteina de la suprafafa eritrocitulr.ri. Persoanele
cu grupa sangvinà B posedà q a-D-galncbsilhwtsfeonzd care
a,taqeazà galactoza la compugii de pe suprafafa eritrocitului.
Pensoa^rrele cu grupa sanrgvinà AB au amrbele tipuri de anti-
gene qi deci ambele tipuri de enzime, apar€nt în canúitàti echi-
rnolare (alelele Io Si IB sînt codominante).
Serul persoanelor cu grupa sangvimà AB nu oonline anti-
oorpi an'ti-A, nici, anticorpr anúi-B, din cane cauzà persoanele
cu Brupa sangvinà ,48 sînt primitori r,uliversal.i de transfuzii
de sînge.
Alela -10 nu condilionazà sinteza weunei enzime gi per-
soanele cu €rupa sangvinà 0 nu prezinrtà antigene A qi urici
anrtigene B. Eritrocitele lor sfurt n€utne, dar în serul lor se aflà
atît antiaorpi am.rti-A cît qi anticorpi anti-B.
Pentru deùeeùarea celtor patru fenotipuri se folosegte neac-
tia de a,glutimarre (fig. 48) cu douà tipuri de antiser (anticorpi)
anti'A gi anti-B, conf,orm ta'beùului 7.
Ier,anhi,a dominanlei celor trei atele este ,(7o : 18) > l0 (ta-
bet S). De regulà o alelà necesivà (precum este atela l0) care
specificà o pnoteinà fur,activà es,te rarà comparativ cu alela sa
dominantà (aqa cum sînú alelele fA sau 1"). În cazulr acestor
alele însà rapare o @(c€pfie de la regulà, càci persoanel,er cu gru-
pa sangvfurà 0 sflnt muLú mai frecvente în popul,afia umanà decît
persoanele cu alto grupe sangvine, ceea se înseamnà cà frec-
venla genei I0 în populafia um,anà este marne.
Existà o anumità distrirbufie geogrraficà a grupelor sangvine
în populafia umanà. Cea mai constantà disúritbufie o are grupa
B. Frewenfa cea mai mare es,te înrqisùratà în Asia cenùralà
gi este de 25-300/c. De aici, frecvenfa drescnegtc în toate di-

t7t
Donor
(cnhgerc)
G-,ps ,Je
Singe

("€Ù

,í€\
1i + F )

*_ */

rol
it
L_ __l
Fig. 45. Acfiunea serului de la peîso&ne cu gnlpe sangvine v.À-
riite (receptori)asupra d.iferitelor tipuri de eritrocite (donori).
Aglutinatea celuleloi indicó reacfia anticorpilor serului cu anti-
genele celulare.
' Tabelul 7

Roaegia de aglutinare in stabilirsa eelor patru fenotipuri ale grupel sangvlnG

,ArA sau Galactozamina anti-B I B, AB A9i0


tAr0 (A)

t&" "^t Galactoza anti-A I A, AB Bqio


tBto (B)

Galactozamina nici un A,B,ABgi0


(a)+ tip (primitor
Galactoza (B)
toto Níci ua tip anti-A * A,B9i Numai de la
f anti-B AB (donator uni
sal)

L72
Tabclul g
Btabllirea grupelor sanguine ale eopiiilor rezultafi ùn eAsàtorla unor persoenG
su rllforito grupe sangvlne Ee laeo dupú urmAtoarea sehemA:

Grupa sanguinó Formula Formula genotipicà f sanguinà


lfenotip)
a pArinfilor
genotipicà
posibilà a copiilor | "ron"
(f enotinur)
t copiilor
i
0x0 1010 x 1010 I loio
--"--lX lic,lAj
lolo I raro
lal0
0xA rîtn *- iArn
Asau0
1010 x
la10
I
lAlo gi l.olo

X lBlB lBlo
0xB 1010'à:

1o1o' y 1B1o lBio $i lolo Bsau0


OxAB
-U:r
Éf'-- 1 1o gi 1n1o AseuB
lala x lal-{ lAIA
1"r" r_lg lalArSi lAlo A
lalo x lalo lAlA:gf lolo Asau0
----_
lala x lBlB IAlB AB
lalo x 1BlB, e1e1B qi.1B1o AB, B
AxB 14,10 1 1B1o lA,lB, lAlo. 1810. 1o1o A, B, AB, O
1a1A ; 1B1o ?talB, lAlo AB, A
1B1Bl y,1B1B lals B
1B1B-;a'1410 | tola 9i ltlo B
tBto x lBlo I ltlE, lplo: ,i lolo Bsau0
1B1B I 1a1n I t^tt qi lBtB AB sau B
lBlrry talB I tAlB, tnt., latl tBla AB, B, A
É1a x lAlB I lap, IAÉJBIB A, B, AB

recîiile, a,jungînd în Franfa qi Anglúa 1a 5-t00/0, iar în popu-


latiile naturale ale Australiei $i Americii de sud este foarte
micà sa'u nulà.
De asemenea, o distrirbufie asemànàto,are se înregistrcazà în
Africa, unde fnecvenfa gen'ei 18 este oe€, mai mare îrl Congo,
de unde descreqte în toate direcfiile.
Gena 7o, prezintà frecvenla cea mai mare în Europa de
Vest, Australia qi unele zone din America de Nord. Modelul sàu
de distribulie este mai universal, dan mai putin regulat. O
frecven!à mai mare a sa se înregistreazà în populafiile diil)
Tibet, la boEimanii din Africe de sud, pigmeií din Congo, negîii
din Fitripine Ei unele populalii din sudul l,rÀdi€n.

L73
Gerra I0 esúe mai frecventà in toatà trumea, dar cea mai
cnea
ftratt^à frecven!à apare în populafiile natunale din Ame-
(750/o)
rica (indien,i americani), în r-urele regiuni al,e Afriqr" Au^stralia
gi Orierrùnl mijlociu. În Europa €8 €lue o frecventa de 5l4go7r.
Unele triburi de indieni americani prezintà fiecventa de 100f^
a genei 10. Altele au o frecven!à de 490/o I0 Si 1tt/o IA sau
B7o/s 10 Ei L3o/o 74.
În cazul càsàtoriilor A X 0, B X 0 sau AB X 0, in ca,r'e fe-
meira are grupa San€viftà 0 apare o r,educ€re cu 250/o a niumà-
r-ului de oopii cu grupa sangvinà A sau B. Indivizii cu gralpa
sarlgvinà 0 produc in terul sangvin anticorpi A qi B.- fo timpyl,
vieÉi intrau-terine, unele celule sangvine de tip A, formate de
fo'eiusul A, intrà în circulafia sangvinà a mamei (mai ales fur
timpul naqterii cînd se rupe p}acenta) qi acfioneazà ca rr,tigene
care stimuleazà producerea de antioorpi anti-4. La naq'"terea
urmàtoare anticoipii formafi în tirnpul sarcfurii preoedente trec
în, circulafia sangvinà a fàtului, producîndu-i moartea-
Asemenea Asatorii dintre femei cu gl:upa 0 qi rbàr'bafi cu
alte grupe sangvfure se numes c AB0-incom'patibile.
niistg de asemenea o corelafie directà dintre grupa sang-
vinà 0 Ei incidenta uloerulnri duodenal, persoanele cu grupa,
saqgvinà 0 prezentînd o probabilitate de 400/o mai mate d:e a
fa!à de persoanele cu celelalte grupe sangvine.
face boale,.au
La om mai fost descrr$i qi atli loci georici ce sÈcificó qi
alte antigene ale grupelor sangvine. AEa sinú detenminan$ti
genici M, N gi Rh.

5. FACTORUL Rh
Stud.iindu-se asemànarea imunologicà dintre sîngele uman
;i cel al maimalei Maccacus rh,esus, s-a constatat cà serul iepuri-
ior imunízalí cu, eritrocite de maimu!à dà o puternicà reaclie
de aglutinare a eritrocitelor la un numàr mare de oameni. S-a
admis cà oamenii pot conline un factor responsabil de aceastà
reaclie, factor desemnat Rh, de la denumirea speciei de maimufó.
Ulterior s-a dovedit cà factorul este ereditar gi reprezintà alelele
rh+ (Rh) ;r rh (Rh- ) ale aceleiagi gene implicate în determinismul
reacfiei imunologice. Alela d.ominantà rh+ (Rh) condifioneazi
reacfia de aglutinare, pe cînd. alela recesivà rh (Rh-) nu deter-
minà reaclia de aglutinare. Oamenii pot avea d.eci Rh pozitív
;i Rlz negativ. Cînd cuplurile parentale sînt homozigote, -
nu
apar probleme de aglutinare gi descendenlii se nasc normal.
Complicaliile apar însà atunci cînd tata are Rlt, pozítiv iar mama

174
R h- Rh-
ei Rh+ Rh+ of

Rh- Rh+ (coPii hetcrozigolil

x Rh+ Rh- ol
.Rh- Rh- o
+ /\
/\
t\ Rh-Rh-
50%Rh+ Rh- 50'/o

( nn Pozitivdar (Rh negativl


62Ss7s2i gati )

Fig. a9. Transmiterea factorului Rh.

Rh negativ fig 49. În acest caz se nasc copii heteroziggli (rh*


rb+ xih- rh- - rh+ rh-). La prima sarcinà, antigenul speci-
ficat de factoral rh- al fàtului heterozigot pàtrunde în circulalia
sangvinà a mamei gi d,eterminà aici formarea de anticórpi anti-
Rh.- Anticorpii apoi pàtrund în circulafia sangvinà a fàtului.
Viala acestui, dacà e vorba de prima sarcinà nu este periclitatà,
dat.fiind faptul cà titrul anticorpilor nu este prea ridicat. Prima
nagtere se desfàgoarà normal. La a doua nattere însó, embrionul
heterozigot (rh+rh- ) d,eterminà gi de aceasti dati, prin prezenla
factoruluí rh+, sintezà d.e anticorpi anti -rh în organismul matern.
Titrul anticorpilor antí-Rh sintetizali la a doua nagtere se
adaugà aceluia realízat la prima nattere, dublîndu-se. Mama este
imunizati îa!à, de antigenul rh+ de la sarcina precedentà prin
anticorpii deja prezenlf în corpul sàu. Dar acegti anticorpi pà-
trund în circulalia sangvinà a fàtului gi, fiind în cantitate mare,
determinà o puternicà reacfie de aglutinaîe a eritrocitelor fàtu-
lui. Aceastà reaclie de aglutinare stà la baza malad.iei eritro-
blastosis foetalis, în urma càreia fàtul moare.
Accidentele d.e eritroblastozi pot fi prevenite fie prin trans-
luzli masive de sînge prin care se înlocuiegte o parte din sîngele
matern, reducîndu-se astfel titrul anticorpilor, fie prin scoaterea
fàtului cu mult timp înainte de termenul na;terii (corespunzînd
perioadei în care titrul anticorpilor cregte exponenfial) gi cregte-
rea lui în incubator.
Sînt încà d.ispute privind natura locusului Rh. Unii admit
cà este vorba de un singur locus genic cu mai multe alele, pe

L75
cînd allii consid.erà cà în determinarea acestei reaclii de tip
antigen-anticorp intervin mai multe gene strîns lincate (siste-
mul c d t), fiecare cu o a1elà dominantà gi alta recesivà. Alela
recesivà rh este cea mai frecventà (55%) în populafia bascà a
Spaniei. În Europa, frecvenla genei rh éste de-4}o/o, în Africa
de 23o/o iar la negrii americaní 28%. Ale1a este foarte pulin
frecventà sau chiar absentà în populalia chinezà gi japonezà
ca gi în populaliile indiene ale Americii ;i Australiei.
Alela rh+ are o distribulie mai neregulatà, prezentînd toto-
datà mai multe tipuri. De exemplu, tipul .RZ0 sau cDe are o
frecven!à d.e 5o/o în populaliile europene, chineze, indiene ameri-
cane gi aborigene australiene ;i 600/" 1a negrii africani gi pigmei"
IIn alt típ, Rh 1 sau CDe are o frecven!à de 55% în popuialia
europeanó, Sí 600/" în populaliile asiatice, 58% în populalia de
aborigeni australieni gi numai 25% în populaliile africane gi
indiene americane.
Persoanele cu Rh negativ produc anticorpi fa!à de celulele
rogii Rh pozítive, dar nu are loc gi o reaclie reversà.
Un interesant fenomen de polialelie a fost descris la Drctso-
phi,la melanogaster, la care díferitele nuanle a1e culorii ochilor
sînt determinate de o serie polialelà. Astfel, tipul sàlbatic are
ochi de culoare rogie, nuanià determinantó. de gena dominantà
7p1*. Diferitele nuanle ale culorii ochilor, aitele decît culoarea
rogie, se manifestà recesiv fa!à de culoarea rogie a tipului normal.
Aga sînt culoarea coral, determinatà d.e alela ú, culoarea sîn-
gerie (blood,), determinatà de alela ubl, culoarea eosinà (trf),
ciregie (cherry wù), honey (ú), buff (u\, tinged (ut), pearî
- Alela
(rú) Si iaory (zai). u este recesivà fa!à de toate aceste alele,
descrise mai sus gi determinà în stare homozigotà (ulu) culoarea
albà (uhite) a ochilor la drosofilà, ea condilionînd absenla oricàrui
pigment pentru culoarea ochilor.
Celelalte alele conditioneazà" producerea unor cantitàli varia-
bile de pigment, ele fiind recesive fatà de alela u+ dar dominante
unele fa!à de altele, ordinea descrescîndà a dominanlei fiind I
19* nW@ *U)bl ->Uc ->ZlF -*Wi *Wbî -->,tyt -*W0 *Uti *tD.
Culoarea ochilor la om este tot un caracter determinat prin
alelism multiplu. Seria polialelà în acest caz redatà în sensui
descregterii dominanlei este urmàtoarea:
*Eó (ochi negri) -> E3t (ochi càprui-verzui) -> Eb, (ochi albagtr:
Eb- E3t (ochi negri cu reflexe verzui)
176
6. VARIANTELE ELECTROFOREIICE
$r sEMNrncaTIA LOR

Blectroforeza s-a dovedit a fi o metodà foarte utilà în stu-


diul genetic al populafiilor, în starbilirea relafiilor interalelioc
qi în studiul fenotipului, la nivel molecular.
Principial ea se bazeazà pe faptul cà moleculele care pne-
zintà o anumità încàrcàturà electricà, suspenda,te într-un me-
diu aonductor de electricitate vor migra în cîmpul electric spre
polii acestuia, în func{ie de natura încàrcàturii lor. Mediul con-
ductor constà din tampon menlinut într-un mediu de susfinere
ponos precum hîrtia de filtru, acetat de celul'ozà sau gel agar,
amidon sau poliacrilamidà. Moleculele id,em'tice migreazà cu
aceeaEi rartà qi dupà o perioadà datà de 'timp se vor ooncentra
într-un acelaEi punct în mediu formînd o bandà distinctà, bine
delimitatà. Datorità structurii sale particulare în aminoaeizi,
fiecare protei,nà are pe de o parte o formà gi o dimensiune
caracteristicà, iar pe de alta o încàrcàturà electricà netà pon-
tivà sau negativà. Într-un cîmp electroforetic, are loc o sepa-
rare clarà a diferitelor tipuri de mol,ecule proteinice. Mobili-
tatea electroforeticà reprezintà un criúeriu fenotipic de studiu
al structurii genetice qi variabilitàtii, iar puterea sa de rezolufie
este atît de mare încît pot fi decel,ate diferen(,e dintre douà
peptide de ordinul a numai un aminoacid. O proteinà consta
dintr-o singurà catenà polipeptidlcà (rnonomm), din douà ca'úene
polipeptidiee (dimu\, din trei (trimer), patru (tetrarner) sau
mai multe catene polipeptidice (maltim^er). Fiecare caúenà polÍ-
peptidicà este sintetlzatà de cîte o alelà. O proteinà multime-
ricà poate fi formatà din catene polipeptidioe identice sau ne-
identiee. Dacà are loc omogenizarea drosofilelor omorîte într-o
solufie tampon Ei omogenatul este supus electroforezei, se
poate studia modelul ,el,ectr,oforetic aI unor enzime cum ar fi
enzimel,e esterazice specificate de locusul est-6. S-a cons,tataù
cà anumite stocuri de musculife diferà prin mobitri'tatea electro-
foreticà a esterazelor, uneùe prezintà esteraze c€ se deplaseaza
rapid într-o unitate datà de timp, formînd o rbandà numità ,,Fs
de la cuvînúul englez ,,fastc. Genotipul unor asemenea mus-
culile este considerat a fi FF. Alúe stocuri de muscutrife au un
tip de estqozd-6 care se deplaseazÀ încet în aoeeagi perioadà
de timp, formînd o ba,ndà numitA ,,S( (de I'a slow) avînd geno-
tipul, SS. În urma unei încrucigàri FF X SS rezultà în F1 indi-
vizi heterozigofi (FS) care prezintà ambele modele electrofore-
1,2 - Descifrînd tainele ereditàfii, vol. I T7T
)

+ tice Pentru enzimà, n€-

!!
-
fiind o combinalie dintre
diferi,ùe r:nitàfi Proteiniee
sau subunitàti Produse de
fiecare alelà (fig. 50). Re-
zulità cà duPà modelul
el,ectroforetic, enzima este'
direclra de
ii,|íirii"" !' razà-6 este o proteinà mo-
Fenot ip F s F.s iíóteiàùor nom,ericà. Faptul cà ln he-
6 enotip F F ' .ss FS , terozigoli apar ambele mo-
dele electroforetice cores-
Fig, 50. Reprezentarea diagramaticà a fe- pUnZà,toare atît, alel,ei, F
notipurilor bectroforetice privlnd euzima cît Si alelei S înseamnà cà
esteraz6 6 la D. T9*ogaster (din esùe vorba de o rela{ie de
Levine, 1973).
codominanfà dintre cele
douà alele. Studiuù electro-
foretic al fosfatazei, a,lca,liiure la drosofilà a rrelevaù aparifia în F1
a unei tbenzi, de morbilitate intermediarà FS care repr"ezintà de
fa,pt o proteinà hi,bridà. S-a apreciat cà enzima este un dimer
care ln súare homozigoúà este reprezentatà de caúene polipepti-
dic,e identice, pe cînd în: stare hetenozigotà poate fi, formatà fie
din subunitàfi identioe, fi,e diù subunitàfi neidentice. De ase-
merf.e,a formarea unei benzi inùermediare, suplimeinrtare bénzii
F gi ,benzii, S, indicà exist'enfa unei rel,a'fii de oodominanfia din-
tro alele. Desooperirea unei a,lele O oane oondilion'eazÀ a,bsenla
oricàrei ,benzi' ,pe eoloama electroforeticà indicà existenfa, în de-
,terr:ninismul genetie al fosfatazei alcaline, ,a unei serii polÍalele
(4 s $i o).
Din com'binrafia S X O r,ezultà ur fenotip SO în cane se ma-
nifestà un fenornen de dominan!à inr,complertà.
Electr,oforeza a deveurit astfel r-nr- €xc€lent mij[oc de dece-
trar,e indirectà a genotipului prin auraliza fenotipului la nivel
molecular.
Tot un caz de polialelie se întîlnegte gi în determinismul
genetic al culorii blànii la iepuri de casà 9i a fost evidenliat prin
încrucigàri dialele între iepurele albino (rt) complet lipsit de
pigment melanic, himalaiai (chù) de culoare albà, dar cu extre-
mitàtile de culoare neagrà gi chinchilla (t',ù) de culoare gri
gi tipul sólbatic (CC) de culoare neagrà. Alela C este dominantà
fa!à de toate celelalte alele (tabelul 9). ferarhia dominanlei este
Cebùc.
L78
Tobclul 0
Scrla dc alele pentru plgmontaÉa
blànll la lepurl

Fenotipuri Genotiputi posibile

negfu CC, Cúh, 66h, Cc


Chiuchilla cch Càh
gri deschis Cch dah, CghC
himalaian chcL, chc
albino cc

7. INTERACTIUNEA GENEI,OR

Sînt numeroase cazurile în carre p€rrtru exteriori,zarea unui


singur carasùer colaboreazà mai multe perechi de g,ene d'in
inúeracfiunea càrora pot apare în F1 oaractere cu totul noi, iar
în F2 apar allte rapor-Luri de sqgregare ce se, ab,at aparent de la
raporturiile mendeliene. Perechiùb de gene car'e interacfioneazà,
nu ocupà 'acrelaqi looq^s .pe cro'Inozomi omol,ogi, ci ele sînt pla-
sate fie fur [oci di'ferifi pe aÉ€la$i cromozomi sau în cromozomi
diferiti, neomoLogi. Ase,menea gene sint nea,lele.
Interacfiunea genelor nealele poate schimba uneori felurile
fenotipului fàrà a schimba numàrul fenotipurilor. De asemenea
cînd. douà perechi de gene nealele afecteazà acelagi caracter,
numàrul fenotipurilor poate fi mai mic decît numàrul genoti-
purilor. Genele nealele pot interacliona contribuind prin catenele
polipeptidice pe care le specificà 7a alcàtuirea unei molecule
complexe care servegte ca produs genic funcfional. Holoenzima
transcriptazei de la E. coli (arpB'oor) este codificatà de 5 gene
nealele d, p, p', ar gi o . Tra fel, enzima lactic dehidrogenazl
de la om gi alte animale reprezintà un tetramer (ArBr), cele
patru catene polipeptidice fiind specificate de d.ouà gene nelin-
cate A gi B, care cod.ificà catene d,e aceeagi lungime, d.ar care
au secvenle diferite de aminoacizi. Se pot produce cinci tipuri
de molecule de lactic ilekidrogenozd, care diferà în reaclia 1or
fa!à de diferite substraturi An, ArBr, ArB, gi Ba. Tati deci cà
d.oi loci produc în mod normal 5 produgi funcfionali. Se cunosc,
însà gi alele rare ale locilor z{ ti B gi indivizi hibrizi care pot
forma f2 tipuri diferite de lactic dehidrogenazi. Un al treilea

t79
locus C codificà o altà polipeptidà care intrà în alcótuirea enzi-
mei lactic dehidrogenazó, din testicule gi spermatozoízí, crescînd
numàrul potenfial de lactic-dehidrogenaze diferite ce se pot
forma în lesuturile germinale. în acest caz interacliunile genice
apar imediat dupà traducere, înainte ca produsul genic sà fie
plrs în circuitul metabolic.
Diferifi loci nealelici care codificà acelaqi produs sau un
pr,odus similar se numese izoloci. Nonalelele de la nivelul izo-
locilor se numesc izogene.
În cazul enzimei lactic dehidr,ogerLaza pot interacfiona trei
izoloci spre a produce mai multe izoenzime similare lactiede-
hidrogenazice care s-au numit isozime.
Izol.oci sub forma a douà perechi de gene duplicate sînù
impiicafi în determinar€o pigmentafiei pielii la om qi a ca-
riopsei la grîu ca Ei a pigmentaliei unor flori.
Tipurile de ARNú gi ARNr pot fi codificate de izoloci. La
E. coli se par'e cà existà gene unice pentru fiecane tip de ARNú.
La drosofila existà circa 60 izoloci pentru ARNú reprezentînd
circa 750 gffi€, localizate în circa 100 si,turi în tot genomul.
Existà deci în medie circa 12 izol,oci pentru fiecare tip de
ARNú.
Un caz de interacliune a genelor fàrà a se modifica rapor-
tul, de segregare, dar care duoe la apari ia de fenotipuri noi a
fost întîlnit la încruciqarea dintre rasa de gàimi Wgandotte cu
creasta tip ,,trandafirs qi rasa de gàini Bruhmns cu creasta tip
,,m,azàre66. Cele douà caractere sînt dominante fa!à de tipul
,,creastà simplà36 întîlnit la rasa Leghortt.
Bateson gi Punnett au admis cà tipul de creastà ,este de-
terminat de intenacfiunea a douà gene nealel,e R 9i P.

x rrPP
RRpp
Wyandotte Brahmas
RrPp
creastà ,,nucà"
Din interacliunea genelor do- RrPp x RrPp
minante R gi P apare un nou 9/16 RP creastà ,,nucà"
fenotip-creasta ,,nucà." iar 3/16 Rp creastà ,,trand.afir"
din interacliunea genelor re- 3/16 rP creastà. ,,mazàre"
cesive lri !. apare alt nou fe- 1/16 rp creastà simplà
notip, creasta simplà.

180
Se cunosc însà qi oazuri de interae{iune genicà în care are
loc atît schimbarea raportului de segregare cît qi aparifia de
fenotipuri noi. Acestea sînt complem.en'taritatea, epistazia Ei
polimeria.

S. COMPLEMENTARITATE GENICA

Este fenomenul prin care, din interacliunea a douà sau mai


multe gene nealele rezutrtà o expresie fenotipicà diferità de
aceea determinatà de fiecare g,enà în parte. Genele comple-
mentare pot fi dominante sau recesive.
Se deosebe$te o complemeultaritate dominantà qi o comple-
mentaritate recesivà. În eazul complementaritd.lii dominante
este vorba de o interacliune dintre gene nealeie în care expri-
rnsreà unui anumit caracter necesità prezenla concomitentà a
douà sau mai multe alel,e dominante. Astfel, Bates,on gi Pun-
nett au încrucigat douà varietàli de Lathyrus odoratru cu flori
albe qi au oblinut în F1 plante cu fl,ori r,oqii. Aceste plante din
F1, auúopolenizate au dat o descendentà în F2, oar€ a segregat
în raportul de 9 roqii la 7 alibe. Simbolizatà, experienla aratà,
astfel:
AAbb x aaBB
albà albà,
F, AaBb
roFr
AaBb x AaBb *9/16 AB I rogii
3lt6 Ab I
3116 aB \7 albe
t1rc au I
Pentru apa,rifia culorii roqii a petalelor, este necesarà in-
teraefiunea a douà gene nealel,e dar în stare dominantà, A Si B"
Toate oombinafiile în care în stare dominantà apare doar una
din aceste gene nealele oondi{ioneazà culoarea albà a petaLe-
lor. De asemcnea, culoar€a al'bà este determinatà qi de alelele
recresive ale aceslor gene nealele.
Abaterea de lb raportul mendelian de segregare este numal
aparentà. Altfei, chiar qi acest fenomen de comptrementaritate
confirmà tegite mendeliene ale segregàrii.

181
Existà qi o cornplemcnfuritate rer,esi,uó, in sare manifestarea
unui a,numit caracter ,necesità prezenfa ooncomittsntà a douà
sau mai multe gene nealele, recesíve. Acest tip de interacfiune
genicà a fost observat cînd s-a studiat ereditatea formei capsu-
lelor de la ,traista ciobanulnri (Ch:pselln bu;rsvl-paseor*). Încnr-
cis,îndu-se o varietate cu capsulà ùriunghi,ulara cu o uarietate
cu capsul,a ovoidà se ob{in în F1 plante cu crapsule triuqghiu-
lare. Ín Fz apare un raport de segTegare de 15/16 pliante cu
capsula ,trir:,nghiularà qi l/16 pÌ,ant€ cu capsula ovoida. Sim-
bolizínd experienfa se poate scrie:
A1 ArAsAz x àraràz3z
. triunghiularà | ovoidà
Fl Ar er As aa
triunghiularà
I autolrclenizare
e/16 Ar-A'-ì
3ll6 Ar - &z &z i tSTtS triunghiularà
F2 3/16 ararA2- |
t6 àr ?r àz 4z Ì l/16 ovoidà
1/

Lini,a (-) semnificà prezenfa, fie a alelpi dominante (A1 sau


A2) fie a celei recesive (a1 sau a2).
Rezul,tà cà pentru a se exprima caracterul de cupsulà ovoi-
dà, tr.ebuie sà interacfioneze douà gene nealele in ltare reoe-
sivà (q $i oz).
S-a co,nstatat cà aceastà plantà este un tetraploid prezen-
tínd nu doi cîte doi cromozomi omolqgi, ci patru cîte patru cro-
mozomi omologi pmrtru fiecare pereche, din care catrzà s-a creat
lrosilbilít'atea duplicàrii genirce prin poliplloidie, rezultf,,nd gene
similare ca acfiune 'dar care sînt, nealele situate în, iloci diferi{i,
moqtenindu-se ind,ependent.

9. GENE INHIBITOARE SAU INÎERACTIUNE


DOMTNANTa $r RECESTVa

Gene inhiibiúoare domin'ante au fost observate la mumeroase


organisme. La pàsàri, din încrrrciqa,rea rasei, Leghortl (penaj
alb), cu rasa Wgwdoúúe (penaj alb) se obtine în generafía Fr
pàsàri cu penaj altb, ia'r în genenalia Fz'rezultà o proportie de

182
13 alh :3 colorat. Acest raport care apare ca o excepfi,e de 'la
sqgreganea mendelianà se datoreqúe faptului cà rasa l"qlwrn
cu pen;aj alb posedà, î,n ac''elaqi timp, gena dominantà C (de la
colour), care determinà culoarea neqgrà qi o genà inhibióoare
f care, în stare dominantà, supreseazà rnanifestar@ gerrei C.
Rssa Wyandott€ posedà gena c (alela recesivà a geurel domi-
manrúe C) care determinà în fenotip absenta pigm€nitatiei qi gena
i, alela reoesivà inactivà în supresia genei, C.
fn îrncruciqàri cu rase cu penaj colonat, rasa Leghúm se
comportà ca domina,ntà pe cînd rasa Wyondotte * comportà
ca recesivà.
Indivizii de culoare al,bà apar în toate cazuri,le în ca're es'te
prezentà gern I ca qi în cazurile în care este prezentà alela
recesivà c. Indivizii cu penaú colorat apar numai în cazul în
care gerlrù C scapà de con'trolul genei I qi este alàturi de gena i.
C C I I l-eghorn alb x ccii Wyandotte alb
F. C cli (alb)
9/16 CcIi alb I
3/16 c c I i.
I,t
negru- ^" "
F, 3/16 C cii 1t_- I
arb : 3 nesru
1116ccii alb I

10. GENE EPISTATICN

Cînd douà sau mai mulJte gene acfioneazà asupra acelnriaqi


caraoter, o genà poate mascra efectul celeilalte gene, cam în
ac€ea$i màsurà ln oare efectul unei gene recesive esúe mascat
de alela sa dominentà. Aoest fenomen prin care o genà poate
masca sau supres,a efectul altei gene nealel,ice (situatà într-un
a1i0 losus) a fost m'umit epistazie. Gena epistaticà este o genà ce
aparfine u,nei perechi de alele, care împiedicà m,anifestarea ale-
lei domilrante dinúr-o altà pereche de altele. Gena supresatà
poartà numele de Eend" hipastaticd.
Fenomenul de epistazie este implicat în aproape ,toaúe ti-
purile de interaclitine genicà. Domínanfa implicà supresia ge-
nicà intra-alell7ci (mascarea expresiei umeii aleLe recesive de
càúre alela dominantà din aoeùagi I'ocus). trpistazi;a cuprinde su-
,pnesi,a genicà iruter-alelicó (masoans pe care o exercità u,n locus
genetic {rsupra expresiei ,unui alt locus genic). Raportul feno,ti-

183
pic clasic de 9 : 3 : 3 : 1 observat l,a desoendenfii unor pàrinfi di-
hibrizi se modificà datorità epistaziei În raporturi care repre-
zintà cornbinalii ale acestuia.
Gena epistaticà poate fi dominantà sau recesivà.

a) Gene epi,stutice dominante (12 : 3 : 1)


Fenomenul epistaziei dominante a f'ost observat la o încru-
ciEare între Auenn tatua cu boabe negre qi Auena satiua (ovàz
cuitivat) cu h:oabe galbene.
AABB (boabe negre) x aabb (boabe galbene)
I
F1 AaBb boabe negre
,,
La/
AABó negrc
Aabb
F2
3 aaBb cenugii
I aabb galben

CeIe 12 oombinafii care conlin gena dominantà, A, în stare


homozigotà sau heter.ozigotà sînt de culoare neagrà; 3 combi-
nafii care au gena dominantà B în stare homozigotà sau hete-
rozigotà qi nu confin gena A sînt de culoare cenuqie iar o
combinalie cu genele recesive ob pruduce boabe galfbene.
Din eele de mai sus rezultà cà gena dominantà A împiedicà
expresia genoi dominante B ce determinà cul'oarea cenugie qi
este deci epistaticà pe cînd gena dominante B, a càrei acfiun'e
este înhibatà, este hipostaticà.
b. Gene recesiue epi,statice (9 : 3 :4)
Un exemplu de epistazie recesivà ni-l oferà ,er,editatea cu-
lorii blànii la anumite rase de cîini. La încruciqarea o douà
rase de cîini, una homozigotà albà cu una -homozÍgotà maron,
se obfin în F1 numai descendenfi de cul.oare neagrà. Încruci-
gàrile indivizilor din F1 au produs descendenît în raportul de
segregare I negru : 4 alb : 3 maron, ceea c€ se poate demonstra
ln diagrama de mai jos:

184
B Bcc (alb) x bbCC (maron)
t
F1 BbCc (negru)
J
I RbCc negrú : 9
F"Î Bbcc alb-------.--
bbCc Íl3.roo:3 4
1 bbcc alb-.---
În acest caz, alelele B qi b produc culoarea neagrà Ei res-
pectiv maron, dar numai în prezenla alelei dominante (C) de la
un alt locus. Pentru a distinge aceastà inter,acfiune de o relafie
dominantà qi recesivitate, se spun€ cà. cc este epistatic fa!à de
B sau b,' adicà homozi'gofia alelei c previne formarea oricàrui
pigment, indiferent de alelrele pentru alte culori. Efectul pe
care alelele cc î1 au asupra lui B poartà numele de epistozie
recesiud.

11. GENE DUPLICATE CU EFBCT CUMULATIV (9 :6 : 1)

Dacà condilia dominantà (fie homozigotà, fie heterozigotà)


la unul din loci (dar nu la amîndoi) produce acel,aqi fenotip, ra-
portul de segregare în F2 va fi 9 :6 : 1. De exernplu, trnd'e sînt
implicate g'ene epistatice în producerea anumitor substanle cum
ar fi pigm,enlii, g'enotipurile dominan'te de La fiecare l,ocus pot
fi considerate ca producînd în mod independent o unitate de
pigme,nt. Astfel, gen,otipurile A-bb qi aoB produc fiecare cîte
-
o unitate de pigment, avînd deci acelaqi fenotip. Genotipul aabb
nu produce pigment, dar în gen,otipul A-B- efectul es,te cumu-
lativ Si in consecin!à vor produce douà unitàli de pi;gment (o
cantita0e du,blà).
Se poate constata cà atr:nci cînd epistazia opereazà între doi
Loci genici numàrul feurotipurilor ce apar la descendentii ruror
pàrinti dihibrizi, va fi mai pufin, de patru deqi segregarea are
Ioc pentru douà perechi de gene cu efecte fenotipice diferite.
.A.ceasta se datoreqte mascàrii efectului unei gene de càtre
cealaltà, generalia Fz confinîrnd numai trei clase fenotipice în
loc de patru iar în cazul oomplrcmentaritàfii arumarul claselor
fenotipice se reduce la douà aga ctun reztrltà din úahelul 10.

185
Tabchtl 10

Ccle gase útpurl de rapoÉurl eplstatiee

Genotipurile

elslslr

fnteracfíune dominanta gi recesivà

Gene duplicate cu efect cumulativ

Erprimarea în, fantotiP a genelar

12. PENETRANTa $I EXPRESIVITATE GE0ÙICA

Genotipul reprezintà totatitatea factorilior ereditari (gene-


lor) pe care o specile, un individ îi preziortà îm struchya sa gel-
neticà (gen,om). Aceste gene se manifestà în afiumite conditii
de mediu. Din interac{iun€a genotipul'ui cu mediul rezultà fe-
ulotipul, care reprezintà to'talitateia caract€nelor $i însuqirilJor
(morf'ologic€, hioehimice, de comportament etc.) pe care un
organism le prezintà I'a un moment dat, in oondílii determinrate
de-mediu. În interac{iunea oomplexà genotip-mediu, genotipul
deùerminà limiùele între care só poate manifesta fenotipul. În
feno,tipuli a doi indivizir oe apartin ,aceleiaqi specii pot sà aparà
diferenle, rru rmrnai debermina,te de n,atura genelor, naúurà care
poate fi dominantà sau reoesivà, ci Ei de varialia aourdiliilor de
mediu. Mediul deci poate influen;fa raportul, fenotitpic de segre-
gare. O genà prezentà la toli indivizi'i fu o anumità oatqgqrie
óenotipicà în anumite oondifii de me'diu poate sà s,e exprime în
fenoúip la ùoli indivizii, caz în care se spune ca mani està o
penetraor!à completà s,au de 1000/0, dar în al'te oondilii de qe-
diu, d'eqi pneze,ntà la tofl indivizii, ea nu se manÍfesta 'decît
la unii di'n'tre ei gi în acesú oau se sprute cà o as€nr€{ogà genà
186
are o penetranfa incompleta sau are o penetran!à sub L000/0.
Prin penetrantà se întelege deci frecvenfa cu care o genà sau
o combinafie de gene este exprimatà feno'tipic. De exemplu,
genele care au fost analizate de Mendel (4, B etc.) prezinrtà o
penetnanfà completà, ele manifestîndu-se la tofi indiviziÍ pur-
tàtori ai lor, pe cînd genele care condifioneazà, rezistrenla sa,u
sensibilritatea la bolli au penetran!à redusà, irroompletà, deoare-
ce ele nu se exprimà la ,to!i indivizii, ci doar Ia ,aoeia cane au
f'ost supuEi unei infec{ii oaracteristice (aoeasta reprezenthd o
anumità condi[ie de mediu).
Penetranta este un fenome,n de tip ' totul sau nimic: pene-
tran{à completà sau penetran{à incompletà. Un ex'emplu foarte
convinrgàtor de penetran{à nù-l oferà cazul a doi gemeni mono-
zigrof,, deci care au aoeeaEi structurà genotipicà,'dar lal care la
unul, gerìa perrtru ,,buzà iepure6s esùe penetrantà (se exprimà în
f'enotip) iar la celàlal,t este neperetrantà (nu se exprinnà în
fenotip).
Penetranfa incompietà caracterizeazà multe gene dominante.
Schizofrenia este determinatà în unele c,azuri de douà gene do-
miurante cu penetran!à incompletà.
Influenla me'diul,ui se exercità nu numai asupra numàrului
de indivizi care exprimà în fenotip o arÌumità genà ci qi asu-
pr,a Írltsnsitàtii exprimàrii în fenotip a acelui caraeter, as-
pect cane se numegt'e erpresiuitate gen'icó.
Oda,tà ce gena este penetrantà ea va man,ifesta frecvent va-
rialiuni în expresia sa fenotipicà. De exemplu, polidactiùia la
om, determinatà de o genà dominrantà, prezinúà expresivitàfi
di,ferite: mîini normale degete suplimentare la picior, pi-
cioare normale - suplimentare la mînà, polidaetil.ia
deget'e
-
apail:E l,a mîna dr'eaptà dar nu la stîurga, la stînga dar nu la
dreapta, sau la am'bele mîini qi picioare etc. În condilie hetero-
zirgotà (Pp) gena polidactirliei are o peuretramfà de mai pufin' de
7000/o càci uneori ea nu reuqeste sà producà vreun efeet feno-
tipic detectabil.
Nepenetranla unor gene înseamnó, 00/o expresivitate.
Datorità condifiilor diferite de mediu, aceeagi genà poate
produce sfecte foarte evidente la unii indivizi în timp ce la
al,!i indivizi efecte abia vizibile.
Gena recresivà ?rg ca,re determinà caracterul de aripi vesti-
giale la drosofiilà prezintà o expresivi'tate diferità în funcfie de

t87
temperafurà: la temperatura oamerei apar arlp1 vestigiale dar
eare se pot apropia de dimensiunea aripilor normale, pe cînd la
temperaturi scàzute apar aripi vestigiale propriu-zise (extrem
de mici, rudimente de aripi).
Mediut intrauterin la mamif,ere, chiar pentru gemeni mono-
zi,gofi poate fi foarte variabil, din punct de vedere al poziliei
ocupate de gemeni în uter, aI conexiunilor placentale ,si acestea
pot afecta diferit expresivitatea genel,or 1a cei d'oi gemeni.
Varialia expresività{ii unor gene se poate datora însà Ei
influenfei unor aite gen,e cdr€ se numesc gene modificatoore,
dintre care unele sînt reducdtmre, slàbind expresia fenotipicà
a altei gene neal,ele, iar altele sînt amplificatoare, întàrind ex-
presia fenotipicà a unei alte gene nealelice.
Penetranla qi expresivitatea pot altera raporturile cunos-
cute de segregare Ei sà determine ca ades,ea fenotipul sà nu
exprime fidel genotipul. Primul care gi-a dat seama de irnpor-
tanfa mediului în expresia genicà a fost Wilhelm Jahonnsen,
cel care de fapt a introdus qi noliunile de genà, gmotip Ei
fenotip.
Existà qi cazuri de imitalie fenotipicà numità fenocopie. In
aeest caz un ac,elaEi caracter poate fi produs de alele diferite
dar care aclioneazà în medii diferite.
Indivizii care diferà genotipic Ei oane sînt diferili în acelagi
mediu pot deveni fenotipic similari cînd condiliile lor de rnedir.l
diferà. Asffel, tulpini de E. coli his+ gi his- cr,esc Ei respectiv
nu eresc pe mediu de cul'turà lipsit de histidinà. Dar tulpina
hts- va putea creEte ca Ei tulpina h.is+ dacà mediul de culrturà
eonfine histidim'a. Astfel o oelulà his- pe un mediu de culturà
care oon{ine histidina este o fenocopie sau o imita{ie fenotipicà
a unei celule his+. Tot astfel un individ uman car,e suferà de
diabet m,aladie ereditarà care determinà producerea unei in-
suline -anormale dacà ia insulina sub formà de medicament
-
va deveni o fenocopie a persoanelor genetic normal,e pentru
gena insulinei qi care nu iau insulinà. Existà qi ca:zuri de feno-
copiere a caracterel,or anormale. Astfel, embrionii umani nor-
mali ai càror mame au folosit talidomida se vor dezvolta în
copii cu diferite rr,ralformafii care imità (fenocopiazà) persoane
anormale ce suferà de maladia er,editarà focomelin cauzatà de
o singurà g,enà mendeli,anà în condilie homozigotà.

lBB
13. DETERMTNISMUL GENETIC AL CARACTBRELOR
CANTITATIVE
Cercetàrile lui Mendel s-au referit la analiza unor caractere
discrete, discontinui, care se încadr'eazà în clase discrete de tip
neted zbîrcit; gal,ben verde.
-
Johansen - modalitatea de transmitere ,a un,or
a cerceta't însà
caractere ce pr'ezintà variabil,itate continuà, cunoscute drept
caractere cantitative. El a lucrat tot pe o planrtà autogamà ryí
anume pe fasole. Dintr-un lot initial el a seleclionat L9 boabe
de fasole, fiecare avînd o greuta,te specificà qi le-a cuitivat
spre a obline 19 linii de fasole, care în virtutea faptului cà fa-
solea,este o plantà auúogamà erau pur,e* qi în ceea ce priveqte
caracterul greutàlii. Din fiecare linie de fasole a selectat apoi
boabele ceie mai usoare qi boabele ceie mai grel,e pe care le-'a
cultivat separat. În fiecare an a ales din descendenla boabelor
ugoare, pe oele mai gr,ele pe car'e de asemenea le-a culrtivat se-
parat. Din cele 19 linii pure d,e fasole sînt reprezentate grafic
doar liniile 3, 11, 13,qi 17 (fig. 51A). Comparînd aceastà di-qtri-
bulie cu distribu{ia greutàfii 'boabelor la genitori, în mod sur-
prinzàtor acestea erau simil,are
Astfel, o plantà ieqità din boabe de 150 mg aparlinînd iiniei
a 3-a dà naqtere prin autofecundare la descendenfi ale càror
boa,be au o greutate rnedie de 200 mg afiatà între limitele 150
Ei 250 mg. O situafie asemànàtoare se înregistreazà în celelaite
linii. Johansen a atribuit greutatea rnedie a boabelor ca dato-
rîndu-se constituliei geurotipice, pe cînd variafiii'e pozitive sau
negative fafa de aceasta ca da,t,orî,ndu-se fluctuafiilor de mediu.
Din suprapunerea u,nei multitudini de cunbe de distributie de-
t tNi/,, : LiiilAlí Llti,iAl2 LiNi...î
I
I

'i
lir
ctifoíectJnilare ù
,j;-'.a.:,:a.i;i-'a.ii-
"rfafecundare
a;ttofprundare
.. |
t.
1"
rl
f'l
I

-/ ,/
y'.._.-__::*- ,./ -,--\-
,.--\
--l--:----')v -1*)>'-
i 5C 2-',; ?tC 1,50 500 55A 5C0 55C (AC 750 80 0 85{}

î r,: ! I i4i r A B ;-t,.i.n i L 0R i.ì\t,.r,r


Fig. 51. A. Selecfia celor patru linti în experieula lui
Johansen (explicatii în text).
+ Linia purà reprezintà totali,t'atea descendentilor unei pi,ante aut&-
game hcrnczigote.

189
ributie
Toisf

?00 900

Fig.51. B. fneficienfa selecfiei în cadrul liniilor


pure (explicafii în text).

termi'natà de sienotip a rez{.rltat o aurùà a distribu{iei nor,male


a frecven!,elor (fig. 518). Aceastà experientà ,a demonstrat cà
dife,ritel€ condi{ii de mediu pot produce diferen{,e fenotipice
îartre irudivizi, dar aceste diferenle nu se rnoqtenesc.
Greutatea boa'belor de fasole apare ca un caracter cantita-
tiv care prezinrtà o variabiUtate de tip continuu, oecilînd de
la o lraloare minimà la una maximà în cadrul unei populafii
date.
Johansen' a tras din experien!.ele sale o cvncluzie cu im-
portan{A rna,jorà pe rtru pnactica amel,ioràrii plantelor qi anima-
lelor (caracterele cantitative fiind de o excepfio,naH wrloare
pentru aceas'ta, refel'i'ndu-se la caracteristicile de pro-
duc$e) gi anume cà selecfia este ineficieortà în cadrul liniilor
purc. Selecfia este eficientà numai in cadrul unei populatii
heterqgene (cele 19 linii de fasole luate în ansarnblu). Dar
cercetàrile sale nu au oferit o rezolvare fll privire Ia natura
genotipuri-lor care stau la 'baza celor 19 linii pure diferite.
Observa{iile efectuate de suedezul Nilsson-Ehle (1910)
au aruncat o lumina Ei asupra acestei probleme.
Încà din 1906, Yule sugerase ca variafiile cantitative con-
tinue ar trrvea la bazà o multitudine de gene individuale al
càror efect se cumuleazà, este aditiv. Asemenea idei avusese
qi Mendel cînd a fost pus în situafia de a explica varia{iile în
intensitatea culorii roqii la florile de mazàre (de la nosu
deschis la rogu închis).
Nilsson-Ehle a sta,bilit prrn experier,r,{e de hidridare la
grîu cà în determinúsmul culorii ,boabelor intervin trei perechi
de gene neale,tre care condi{ioneazà sim'teza trnei eantità{i anu-
mite de pigment.
Îrrcruciqînd un soi de grîu cu boabe roqii (AA, BB, CC) cu
un, soi cu boabe albe (w, bb, cc) în F1 se obfin plan,te cane for-
mau boabe de culoare rogie (AoBbcc). Prin autofeeundarea in-
divizilor din Ft a oblinut în F2 un raport g€neral de sqgr€gare

190
d€ 63 rosii la I atbà. Dar cu-
loarea rosie prezeruta dif€r'ite
nuanfe, sugcrînd existen{a
unei sqgrqari pentnr trei ge-
n€ echivalente cu efect cu-
mtrlativ (aditiv) fie. 52.1
O I
Se deduce eà aparifia ctr-
lorii roqii este determina,tà de
trei perechi de gene urealele
cu efect curnul,ativ ,AA, BB
CC, iar culoarea aIbA de ale-
lele lor cn, bb, cc. Nilsson-
Ehle a tras concluzia ca nu-
màrul total al alelelor domi-
na,nte a celor trei perechi de
gtene determinà graduJ de
pigmentare. Cu alte cuvinte
fiecare genà dominantà poate
fi oonsideratà cu o conúribu-
{ie de o dozà }a culoare rogie
iar efecttrl fiecarei doze este I
qwl qi oúitia. I 20)

L,àsînd Ia o ,pafte a tneia


pereche de g€ne, se poate
calcula probabilitatea de a
obfine 0, l, 2, 3 qi 4 doze ale
a,lelelor domina,nte din în-
crucigarea AaBb X AaBb aga
cum rezulta din fig. 53.
alb #r0s"
Observafiile facute de
Nilsson-Ehle pot fi explica,te Fig, 52. în cazul
Segregarea caracterelor
prin prezenfa genelor dupli- încruciglrii a
douó soiuri de gîîu ce
carte, svînd în vedere faptul difetà prin ttei, petechi de gene care
determinó culoarea boabelor. Distribulia
cà grîul este o plantà hexa- frecvenfei culorilor este prezentatA în
ploidà, La care, deci, fiecare histogramA (dupA Strickberger, 1976).
locus este reprezenrtat pri,n 3
perechi de alele, ceag ce dis-
tinge însà aceste rezulta,ùe de cazurile simple de complemeurúa-
ritate recesivà este faphrl cà, îrr* arLresnfa dominanfei, seglegrarea
nu d,uce la aparifia a numai douà clrase fenoti,pice, ci caracterul
culoarea boa,belor se comportà asemanàtor unui caracter ca-nti-
tativ.

191
Numàrul tciol Probóbir\lolcO
Penlru A Penlru I Pentru A îi B ct.,doze"o"' totclà
dómtnonte

., <i-'-- -Bg5=t/z
B =1/t AABB: %e .\ ..- /. (roiu locrte inshis) Vs
AA=)c 4qg6:70 =\
--oo AAbb = '46
=%
\> 3(ro?c ?rcr,'s)

-86 =llu
:
^.:t
Aagb :1/c
11, t- oAt
Aa-1!z "'l-ad-r/z
\o o=h
,,
Aabb:'rB,-,-r./ ./ 21ro9u)
.-E à=1/': raBB-'/',s/ -\ l(roguPot)
L/s
aa -=., */-1 g6=1,/t a."0: t1s --')
o6=y,. aabb:t/re 0 (olb )
lt
/ts

Fig. 53, Segregarea caracterelor-'îtr cazul încruciqórii unei varietàfi de gdu cu


boabe ro$ii cu o varietate de grîu Rapoît de segîegare: l5 (l :
n"lal"nilialbe.
Prezenla fiecàrei gene se faee simlità în schimbarea gradatà
a fenotipului, genele cumulîndu-qi efectele par{iale. Ideea unui
efect de aditivitate cantitativà a genelor asupra fenotipului
(adesea numità ereditate can'titativà) a fost o idee r,evolufionarà,
ea furnizînd baza genotipicà pentru curba normalà adesea gà-
sità la varia{iile caracter,el,or cantitative cum ar fi înàlfirnea,
greutatea, culoarea etc.
Williams (1964) prezintà un interesant exemplu de polime-
rie aCitivà la porumb, al càrui endosperm are o constitufi'e tri-
ploidà (rezultat din feeundarea nucleului secundar al sacului
embrionar care este 2 n de càtr,e unul din nucleii .spermatici
(n). Relalia dintre numàrul dozelor din gena Y, care eondi-
lioneazà culoarea galbenà a endospermului Ei conlinutul în
rzitamina A al ac,estuia $i gena A care determinà culoare,a
albà a endospermului este redatà în tabelul 11.
Tabalul 11

cH'XlHil""l'T#:#"Hl*l,"Ji"ffi
l'fff"'
(dln Giosan gi SAdescu, 1972)

Doze d.e Y Genotipul


Vit. A (unitàti
la gram)
0 vyv 0,05
I yvY 2,25
2 YYY 5,00
YIrY 7,50

1,92
Se cunosc foarte multe cazuri de pol,imerie cu situa{ii si-
milare celor descrise rnai sus, dar pro,babil cea mai famiiiarà
este ace€a a pignentatiei pielii Ia om în care participà cel pu-
fin patru pereehi de gene (gene cuadruplicate). Presupunîndu-se
dorainaarfa genelor care produc pigmentafie Ei aditivitatea sim-
plà a fiecàrei alele dominante, se cun'osc n,ouà cl,ase diÎerite
de pigmenta{ie în care numàrul genel,or donninante este cu-
prins între 0 Ei B.
Cazul siurplificat aI pigmeritaliei pielii la orn este redat de
formulele genotipice PLPLPyP, pentru negri i Pt/rPrlp, pentra
mulatri tipici ;i Pt:!t/r?, pentru albi, din care rezultà cà în
d.eterminismul acestui caracter cantitativ (d.eterminat în uitimà
irstan!à de cantitatea de pigment melanic sintetizaté, în mela-
nofori) intervin douà perechi de gene nealele PrP, îi Pr!, 9i
cà intensitatea pigmentaliei este cu atît mai mare cú cît mai
rnulte alele d.ominante intrà într-o constitulie genotipicà datà.
Din càsàtoria unui negru (PtPlPzPr) cu o femeie a1bà (ft|tfrfr\
reaa.Ttà" copii mulatri. Din càsàtoria a doi mulatri (PtptPrp, x
x PTPLPT?,) u^ rezulta o descend"entà în care aparg o segregare
într-un raport diferit de cel mendelian în caatl dihibridàrii 9i
anume 1 negru (PLPÌzPz) 4 mulatru închis (PLPtPzPz sau
PrPrPzP),6 mulatru tipic (Pt?tPrfr), 1 alb (!rqrfr?r).
Se poate deci conchide cà bazele geneticii mendeliene pot
explica- ereditatea caracterelor cantitative (care se prezintà cu
o varialie continuà) prin acliunea unui numàr mare de gene
(polimerie sau poligenie).

14. GENE I..E[ALE

În 1905 geneticianul francez Cuénot a studiat o varietate


de goareci cu blgn1 galbenà. în contrast cu ;oarecii ctl blanà
cenugie ce reprezintà tipul sàlbatic. Prin încrucigarea goarecilor
galbeni cu ;oareci cenugii dintr-o linie purà, el a observat un
iaport de segregare 1 : 1. Aceasta sugereazà cà alela pentru
blàna galbenà este dominantà asupra alelei pentru blana cenugie,
În urma încruci;àrii între ei a goarecilor galbeni, Cuénot a regà-
sit descendenfii galbeni gi cenugii în raportul 2:1, o deviere
clarà de la propò4ia mendelianà de 3: 1. Aceasta 1-a dus la
concluzia cà goarecii galbeni sînt het"erozigo!í. Raportul de

t$ - Descifrind tainele ereditófii, vol. I 193


segregare de 2: l, în loc de 3: I arati ci l/4 din indivizi au
dispàrut gi anume homozigotii dominanfi.
v/+ x vl+
Y/Y Y/+ vl+ +l+
neviabili galben galben agouti
/l

25% 50% 25%


Segregarea genei pentru culoare galbenà Cy) la qoarece, într-o
încrucisare Yl+ X Y/+

De fapt, raportul t:2:l este transformat în raportulr 2:1 prin


moartea clasei homozigote gal'bene în uter.. Tr,elbuie de rnemar-
cart cà gena Y esùe dnrnùwttú pri'n efectel,e fenotipice asupra
culorii; blànii, în plus ea esùe gi nacesiaó în efectul lierùal, deoare-
ce alela trebuie sà fie homozigotà penrtru a determina moartea
fàtuliui. Se spune cà g€na Y este dominrantà vizibil gi recesivà
letal. Efecte'le aoesúei gene sînt, plei.otropdce adicà gena are un
efect fenotipic multiplu asupra culorii Ei asupra viabilitàfii.
În afa,rà de I'etalitatea de dominantà, în narturà se întîlneq,te
q,i o letuli.ffie de recesiaitute descoperità de Baur (1930) Ia
Anúirrhinrtm mnjus var : cruireq. 'În urma autofecundàrii are loc
în F1 urmàtoarea segregar€: L/3 plantre cu frunze verzi,, l/3
ptanrtre cu frunze verde-pal' qi 1/3 plante cu frunae galbene, aga
cum rezultà di,n, ta,berlul 12.
Tùclul '12

Letalltatoa ds reoeslvitato la Antlrrhinum

cenotirurl Fenotipul

cc verde (normal)
Cc verde pal (aurea)
cc gAbui (letal)

Cantita'tea de clor,ofilà le Antirrhiurum esúe controlata de


càtre o genà recesivà irreornpletà care manifestà un efect le'tal
în stare homozigotà qi un efect fenotipic distinet în stare he-
ter.ozigotà.

194
Penetranla genelor letale fie recesive fie dominante poate
sà vari,eze, astfei cà nu toli indivizii afectali genotipic vor fi
letali fenotipic. Anumite gene letale au un îna1t grad de pe-
netran!à ;i expresivitate, permi!înd un mic procent de supra-
vieluire sau chiar deloc (penetranîà 1000/o) printre genotipurile
afectate în stadiul embrionar sau postemrbrionar. Alùe gene nu-
mite senúletole sau su'bvitale permit supravieluirea unei pro-
por{ii mai mari de genotipuri afectate (500/0-300/c). Se vede
deci cà vitalitatea este un caracter influenlat de un spectru larg
de gene, care variazà de la letalitatea completà la subl,eial, la
subvital, apoi normal Ei în mod ocazional la supervital sau Ia
genotipuri superioare celor medii. Dar, ca regulà, genele l,etal,e
sînt considerate acelea al,e càror efecte cauzeazà moartea or-
ganismului, în mod obiEnuit, în primele stadii de dezvoltare,
oricum înainte de reproclucere.

15. PLEIOTROPIA

Reprezintà un fenomen genetic opus polialeliei. EÌ se înre-


gistreazà atunci cînd o singurà genà nu con'troleazà expresia
unui sin,gur caracter, ci a mai mulúor caractere. Pleiotropia ar
putea fi definità ca efectul fen'otipic multiplu al unei sin,gure
gene.
La mazàre, chiar l\{endel a constatat cà pelechea de gene
cal'e determinà culoarea fl,orii acfioneazà gi asupra culorii se-
minfelor gi asupra prezenfei sau absen{ei petelor roqietice de
pe stipele.
La drosofilà, gena ug care determinà forma vestigialà a ari-
pilor, controleazà, în acelaqi timp qi alte caractere precum dis-
tribulia periqorilor pe partea dorsalà, modificarea spermatecii,
ducind Ei la reclucerea vitalitàlii Ei fecunditàlii.
La mamif,ere, incluzînd omul, gena care este impiicatà în
albinism, afecteazà de asemenea vàzul Si auzul. În aoest caz
toate sectoarele corpului care sînt afectate au o origine comunà
în dezvoltarea embrionarà timpurie qi anume ectodermicà.
Astlei la om, în cazul sindro,rnului Lobstein, este implicatà o

195
genà care determinà deopotrivà surditatea, fragilitatea vaselor
gi modificàri ale scl,eroticii.
Nu este exclus ca marea majoritate a gerreior sà se mani-
feste pleiotropic, aspect care este izvorît din caracterul de in-
tegraiitate ai celulei, respectiv al indi-;idului biologic care,
func{ionînd ca sistem unitar Ei avîncl o stare aiteratà într-unul
din componentele sale subordonate, prezintà alteràri qi în alte
elemen,te în urma interactiunilor structurai-functional,e.

Redactor: ADRIAN CJR.\NESCU


l-elinoredactor: CONS'IANTIN RUSU
Apàrut: 1981. Bun de ti.par: 25.09.1S81. Comancla nr.2l0ll
Crili
de tipar: 12,2i>. Hìr1"ia: veliné 90 g/mp. Format: 6f i.Brji 1{)

Tipaiul executat sub comanda nr.312/1981


la Înfrcprinderea Poligraficó Cluj,
Municipiul Cluj-Napoca
B-dul Lenrn nr. 146
Republica Socialistà Romània