Sunteți pe pagina 1din 27

GENA ADNPOLIMERAZ

A
DNA Polymerase
POL[ ]

Alimov Adrian
grupa 1106

Locul de amplasare subcelular:


Nucleu
In eucariote exist cinci polimeraze ADN:
alpha POLA
beta POLB
gamma POLG
delta POLD
epsilon POLE
Ele toate sunt responsabile pentru diferite
reactii in sinteza AND-ului

Gena POLA
Localizare: Nucleu

-gena cu un singur locus


-situata pe bratul scurt al cromozomului X
-pozitia genei: 22.1 - 21.3.

Structura:

Secventa genei:
GCCATTTATTGGTAATGCTACTTCTGGTTATTTGGTTAAGACGGAGCATATATCTTTAAGTTGT
TAATCACACAGCCACTGTATCCAGACTGCTGAGAAGCAAACTATCAGGCAAAATTCAGGGC
GCGCAGCAGGAGGCAGTCGCTTTCCCGGCTCTGGGGAAAACGATCCAACCACGCCCACT
CTCCTGCCCGCCCGCGCCTCCTTTCCGGGAAAATGGGCTCTGAGAACCAGAGCGCCCTTT
CTCCCACGCGCCCAAATCTTTTCCCATCAGCATGCGTGCGCTTGCGCAGTCTCCAGGCGG
CTCCTTTCCAGCGCCCGACCGCTTCTTTCTCCTGCTCTCCTCCGGCTTCCCCTCAGCTCTAG
CTTTTCCCTAAGGGGTCATCACAGGGCGCCAAACGCGCGTCCGCGGGAAGGCCGGGGGC
GGAGCGCGGCGCGGCGCGGCACGTCAGTGGCCTTCCGGCCGGAAGTCCGCAGCCTCCC
GAGCCGCTGATTGGCTTTCAGGCTGGCGCCTGTCTCGGCCCCCGCGCCAGTTTTGGGCT
GGTTGGCGCGGAATCGGGAGATTCGGGACCATGGCACCTGTGCACGGCGACGACTGTGA
GATAGGGGCGAGTGGTGAGGGACAATTCCGCGCGCGGGGCTCCGGGTTGGGACAGTGG
CATGATTG

-Gena structurala clasa II


-lungime : 303068 kb
- 66 exoni / 65 introni
-gena house-keeping
-promotor netranscris
Tafs-uri : SRFSRF (504 AA)Lmo2CBF-CGfi1CBF-BCBF-AHOXA5CP1ACBF(2)

Functii

La nivel molecular: codifica IG pentru sinteza


ADN-polimerazei Alfa

La nivel celular: joac un rol esential n


initierea de replicare si sinteza a ADN-ului in
perioada S a ciclului celular.

La nivel de organism: pastrarea si


transmiterea IG

Expresia genei

:Transcripie
preARNm - 5486 nucleotide
Processin
ARNm - g:
5440 nucleotide

CAP-are
G-transferaza +
GTP
Poly-adenilare
Poly-Apolimeraza +
ATP
Splicing
U1-U6

:
Translaie
Polipeptid Maturizar
1462 aa e
AND polimeraza

Compozitia

Expresia in tesuturile organismului


uman

Reglarea expresiei genei POLA


1.Alegerea genei pentru
transcripie factori
transgenici
2.Activarea secvenei ADN
3.Controlul activitii ARNpol II
4.Controlul cantitii i
calitii ARNm i
protein

CUTL1, POU3F2, E2F-4,


E2F-5,CBF, CP1A,
CP1C, E47, En-1,
FAC1, FOXO1, FOXO4,
GATA-1, Hand1, LCR-F1,
LMRO-2, NF-AT, NF-1,
NF-Y, NRF-2, Nkx,
POU2F1, Pax-4a, SRF,
S8, STAT, USF-1

Patologii rezultate din mutatia


genei

Sindromul N: o boala
genetica rara
caracterizata prin retard
mintal si fizic, anomalii
ale ochilor, crestere
intarziata, afectarea
auzului i un risc ridicat
de dezvoltare a
cancerului, in special
leucemie.

Gena POLB
DNA Polymerase Beta Subunit
Localizare:

-gena cu un singur locus


-situata pe bratul scurt al
cromozomului 8
-pozitia genei: 11.21 11.1

Caracteristica genei

-Gena structurala clasa II


-lungime : 38178 kb
- 32 exoni / 31 introni
-gena house-keeping
-promotor netranscris
Tafs-uri :USF1USF2USF-1:USF-2HNF4alpha2HNF-4alpha1CREBEgr-2Nkx61deltaCrebUSF-1
Subunitate : monomer
Localizare: Citoplasma

Functii

La nivel molecular: codifica IG pentru sinteza


AND-polimerazei Beta

La nivel celular: implicat n excizia bazelir i


reparaie , de asemenea, in acoperirea gapurilor

La nivel de organism: pastrarea si realizarea IG

Expresia genei
:Transcripie
preARNm
Processin
g:

ARNm

CAP-are
G-transferaza +
GTP
Poly-adenilare
Poly-Apolimeraza +
ATP
Splicing
U1-U6

:
Translaie
Maturizar
Polipeptide
AND polimeraza
B

Compozitia

Expresia in tesuturile
organismului

Patologii rezultate din mutatia


genei

mieloblastoza
sindrom Werner
imunodeficien
cancer
tumori
leucemie
rabdomiosarcoma

Gena POLG
AND polymerase gamma subunit

Localizare: Nucleu, si ,,unica,, care se poate


localiza si in mitocondrii
-gena cu un singur locus
-situata pe bratul scurt al cromozomului 15
-pozitia genei: 25.3 26.1
-gena house-keeping

Functii

La nivel molecular: codifica IG pentru


sinteza AND polimerazei Gamma

La nivel celular: "citete" secvene de


ADN i le utilizeaz ca abloane pentru a
produce ADN nou, contine IG pentru
sinteza POLA(Alfa)

La nivel de organism: Realizarea si


transmiterea IG

Patologii rezultate din mutatia


genei

sindromul Alpers-Huttenlocher
ataxie neuroplastica
miopatie
epilepsie
ataxie senzorial
oftalmoplegie externa
progresiva

Gena POLD
AND polimerase delta subunit

Localizare: Nucleu
-gena cu un singur locus
-situata pe bratul scurt al cromozomului 19
-pozitia genei: 13.33-13.41
-gena house-keeping

Functii

La nivel molecular: codifica IG pentru sinteza


AND polimerazei Delta

La nivel celular: activitate polimerazica 3 'la


5' , activitate exonucleazica si joac un rol
critic n replicarea ADN-ului si reparatia lui.

La nivel de organism: Realizarea si


transmiterea IG

Patologii rezultate din mutatia


genei

Cancerul colorectal
Hipoplazie mandibulara
surditate
progeroidie
lipodistrofie

Gena POLE
AND polimerase epsilon subunit

Localizare: Nucleu
-gena cu un singur locus
-situata pe bratul scurt al cromozomului 12
-pozitia genei: 24.33
- gena house-keeping

Functii

La nivel molecular: codifica IG pentru


sinteza AND polimerazei Epsilon

La nivel celular: repararea ADN-ului


cromozomial si replicarea ADN

La nivel de organism: Realizarea si


transmiterea IG

Patologii rezultate din mutatia


genei

cancerul colorectal
dismorfism facial
sindromul imunodeficientei
livedo
statura joasa

Bibliografie

SABiosciences

http://www.sabiosciences.com

Alimov Adrian
grupa 1106

GeneCards
http://www.genecards.org

Genetic Home Reference


http://ghr.nlm.nih.gov/gene/

Genetic Esemble
http://www.ensembl.org

GeneLocation
http://genecards.weizmann.ac.il/geneloc/index.shtml

SwitchGear Genomics
http://switchgeargenomics.com

National Center for Biotechnology Information


http://www.ncbi.nlm.nih.gov/