Sunteți pe pagina 1din 17

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

REGLAREA EXPRESIEI GENICE LA EUCARIOTE


Fiecare celul a unei persoane conine aceleai gene, totui, ntlnim 200 de tipuri de
celule specializate. n mare parte, diversitatea celulelor este asigurat de expresia diferitor
proteine caracteristice unui tip celular (proteom). Astfel, toate celulele dein aceiai informaie
genetic, ns ea se manifest diferit. Acest fapt e posibil prin reglarea expresiei genice, care
cuprinde o serie de fenomene ce influeneaz la diferite nivele:

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

1. Reglarea pretranscripional
Reglarea pretranscripional ine de modificri ale cromatinei efectuate de proteine
specifice care faciliteaz sau mpiedic iniierea transcripiei.

1.1.Modificarea histonelor produce o influent deosebit asupra expresiei genice:


acetilarea histonelor duce la decondensarea cromatinei => accesul liber al factorilor de
transcripie la ADN => transcripie;
dezacetilarea => condensarea cromatinei => prevenirea transcripiei.

n eucromatin histonele sunt acetilate, pe cand n heterocromatin dezacetilate.

fosforilarea H1 duce la condensarea cromatinei, iar


defosforilarea H1 => decondensarea.
metilarea histonelor este un alt proces reglator care modific structura cromatinei.
Metilarea stimuleaz sau inhib transcripia n dependen de aminoacizii metilai i
numrul grupelor de metil adugate (ex: trimetilarea Lys 4 din H3 stimuleaz
transcripia, dimetilarea Lys 9 din H3 inhib).

1.2.Modificarea epigenetic a ADNului


Adugarea sau extragerea unor radicali (metil, acetil) la molecula de ADN modific
forele de atracie cu histonele, cauznd condensarea sau decondensarea. Metilarea ADN-ului
inhib expresia genic. Grupa metil mpiedic interaciunea factorilor cis i trans reglatori
(interaciunea factorilor de transcripie cu secvenele de ADN specifice). La vertebrate, se
metileaz doar citozinele din secvene dinucleotidice CpG. Metilarea ADN-ului se motenete
datorit unei metiltransferaze specifice (maintenance methyltransferase) care actioneaz asupra
secvenelor CG care sunt cuplate cu secvene CG metilate:

Citozinele din secvenele recunoscute sunt metilate, asigurnd motenirea acestei


modificri datorit metiltransferazei. Totui, aceast modificare este dinamic: imediat dup
fertilizare are loc un vast proces de demetilare care afecteaz tot genomul. El se poate realiza
prin inhibarea activitii acestei metiltransferaze, ceea ce ar duce la demetilarea ADN-ului odat
cu fiecare replicare. Alte ipoteze se bazeaz pe prezena unei demetilaze. Oricum, odata cu
dezvoltarea noului organism, metiltransferazele metileaz de novo ADN-ul n secvenele CG
2

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

nemetilate, fiind dirijate de alte proteine reglatoare. Secvenele CG sunt raspndite n tot
genomul, ns ele au o frecvena mare n promotorii genelor, iar metilarea acestor CG
previne interaciunea factorilor de transcripie cu situsurile lor din ADN => inhibarea
transcripiei. Aceste secvente CG formeaz situsuri CpG care sunt abundente (~1 situs : 10
nucleotide) n promotor, formnd insule CpG:
(a) Insula CpG din promotorul unei gene, frecvena CpG: 1/10 TGATGTCGGTTAGTAGTCGTAATTTAGCGATGCTTACTGTACGTGCTTATGGGCGTA
TGTGCGTAGGCCTCGATGCTGCGATCGTCGGGGTAATGCGATCCGGGCATTAGCCG
ATTAGCTACGTGATCGATAGGCGTAATGGCTA
(b) Alte secvente de ADN, frecventa CpG: 1/100TGATGTCGGTTAGTAGTGCTAATTTAGGCATGCTTACTGTAGCTGCTTATGGGGCTA
TGTGGCTAGGCCTGCATGCTGGCATGCTCGGGGTAATGGCATCGCGGCATTAGCGCA
TTAGCTAGCTGATCGATAGGGCTAATGGCTA
Toate modificrile enunate anterior sunt epigenetice: modificri care influeneaz fenotipul far a
modifica secvena nucleotidic de ADN (reglnd expresia genelor). Epigenetica este o ramur relativ noua a
geneticii care studiaz aceste mecanisme, inculsiv motenirea lor n anumite cazuri. Unele modificri epigenetice
sunt de durat scurt (ex: acetilarea histonelor, transcripia, dezacetilarea histonelor), nsa altele influeneaz
expresia pe o durat mai indelungat => unele se motenesc. Acest fenomen implic o form de memorie celular.
Un exemplu al importanei memoriei expresiei genice este dividerea celulelor specializate, n rezultatul creia se
obin de asemenea celule specializate: celula fiic motenete memoria modelului de expresie a genelor celulei ce
s-a divizat (exemplu de motenire epigenetica). Motenirea modelului de expresie nu e destul pentru obtinerea a 2
celule fiice identice specializate: motivul principal sunt factorii de transcripie sintetizai de celelalte celule
specializate din mediu (exemplu de reglare la nivel transcripional care induce specializarea celulelor nou formate).

1.3. Efectul poziiei genelor pe cromozom ine de genele vecine care pot avea elemente
modulatoare (En/Si) comune. Aceste gene au o oarecare legatur n ceea ce privete expresia
genic. Importana poziiei genei n cromozom poate fi observat n maladiile cauzate de
translocaii (migrarea unui segment de
cromozom pe alt cromozom): informaia genetic
nu se modific, ns expresia genelor translocate
sufer modificri => maladii. Limita aciunii
unui enhancer este dat de insulatori/izolatori
secvene de ADN ce stabilesc hotare ntre En i
promotorii genelor. Insulatorii sunt secvene
recunoscute de proteine specifice care
interacionnd formeaz bucle - obstacole spaiale
care mpiedic interaciunea dintre En i
promotorii unor gene mai distale.

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

1.4. Reglarea coordonat a expresiei genice ine de expresia diferit a unor gene inrudite
(codific proteine cu funcie similar) n dependena de perioada de dezvoltare (timp) i n
dependen de esut (spaiu).
Familia genelor beta-globinelor red un astfel de exemplu 1.

Locusul genei beta-globinei este o regiune a cromozomului 11 responsabil pentru


sinteza lanurilor de beta-globin. Acest locus cuprinde, pe lang gena -globinei, genele pentru:
-globina, A-globina, G-globina, -globina.

Gena -globinei e activa la embrion, formnd HbE (hemoglobina embrionar),


genele A-globinei i G-globinei la fat => HbF, la nou-nascut i
la adult genele -globinei i -globinei => HbA.

Globinele genelor date interacioneaz cu globinele alfa (care au de asemenea o expresie


specific), formand Hb. Familia dat de gene are un element comun cis-reglator LCR, locus
control region un En situat distal, care n diferite esuturi i n diferite perioade ale dezvoltrii,
regleaz diferite gene. Pe lang reglarea coordonat a expresiei genice, exemplul genelor betaglobinelor demonstreaz posibilitatea unui singur enhancer de a aciona asupra diferitor gene.

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

2. Reglarea transcripional
Reglarea transcripional este cea mai raspindit form de reglare a expresiei genice la
eucariote. Ea se realizeaz datorit interaiunii elementelor trans (proteine) i cis (secvente
ADN, boxe) reglatoare. TAFs-urile induc asamblarea complexului de iniiere a transcripiei care
cuprinde ARN-polimeraza i factorii generali de transcripie.

cis reglatori

vs

trans reglatori

Boxa TATA

- TFIID

Boxa CAAT

- TFIIA

Enhancer

- Proteine activatori

Silencer

- Proteine represori

TAFs pot fi hormoni sau alte substane biologic active, ele pot ajunge n nucleu din citosol, iar n
citosol din matricea intercelular, sau pot fi activate printr-un lan de reacii chimice provocate,
de exemplu, de interaciunea unui receptor cu ligandul (transducie = convertirea unui semnal
extracelular ntr-un rspuns). Spre deosebire de TAF, TSFs (transcription suppression factors)
inhib transcripia prin diverse mecanisme (se fixeaz de situsul unui TAF=> inhib
interaciunea lui cu ADN ).

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

Exemplul 2: Reglarea expresiei genelor pentru proteine antiinflamatorii de catre glucocorticoizi.


Glucocorticoizii reprezint o clas de hormoni steroizi (=> =>difuzeaz usor prin membrana citoplasmatic) care
regleaz metabolismul glucozei i inhib activitatea imun (inflamaia). Ei reprezinta un instrument eficient al
oricrui medic. Aciunea lor se datoreaz reglrii transcripiei altor gene. Ei acioneaz dup modelul urmtor:

Hormonul din sange difuzeaz n citoplasm


Interactioneaz cu receptorul su din citosol (GR)
Intra n nucleu prin carioplasm
Interacioneaz cu secvena sa specific de ADN din promotorul genei int, secvena
numit Glucocorticoid response element (GRE)
Activeaz transcripia genei.

Exemplul 3: Reglarea expresiei genice prin CREB cAMP response element binding protein. CREB este
un factor de transcripie ce interacioneaz cu secvene de ADN din promotor CRE (cAMP response element),
reglnd transcripia unor gene importante (ex: somatostatina, tirozin-hidroxilaza, neurotrofina BDNF, alte
neuropeptide i gene implicate n ritmul circadian). CREB are un rol important n formarea memoriei de lung
durat i formarea memoriei spaiale. Activitatea proteinei CREB este influenata de concentraia cAMP AMP
ciclic. cAMP este implicat n multe interaciuni, servind drept un exemplu universal de mesager secundar.
Mecanismul de reglare a expresiei prin CREB:

Unii receptori specifici, la interaciunea cu ligandul, stimuleaz activitatea altor proteine care
catalizeaz reacia de transformare a ATP-ului n cAMP.
Concentraia mrita de cAMP stimuleaz proteina kinaza A (o protein citoplasmatic).
La activare, o subunitate catalitic a kinazei A se desprinde i ajunge n nucleu.
n nucleu, kinaza A fosforileaz proteina CREB => activeaz CREB => interaciunea CREB +
secvena de ADN (CRE) => reglarea transcripiei.

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

Enhancerii i silencerii reprezint secvene de ADN, elemente modulatoare situate distal


de promotorul genei, care, interactionnd cu proteine activatoare, maresc(En) sau micoreaz(Si)
rata transcripiei. Proteinele activatoare interacioneaz cu enhancerii i cu proteine
coactivatoare, iar cele din urma interacioneaza cu factorii generali de transcripie i cu ARNpolimeraza, reglnd rata de transcripie. Mediatorul este un complex multiproteic cu funcia de
coactivator ntlnit la majoritatea mamiferelor. Silencerii, prin interaciunea lor cu proteine
specifice, mpiedic interaciunea proteinelor activatoare cu factorii de transcripie, cauznd unui
obstacol spaial => scderea ratei de transcripie. Pe lang reglarea ratei de transcripie, reglarea
transcripional ine de alegerea direciei de transcripie (datorit factorilor generali), alegerea
catenei transcrise i terminarea transcripiei prin identificarea situsului de poliadenilare.

Rolul enhancerilor n expresia genelor:


(1) Proteinele activatoare ale
transcripiei se leag la enhancer
declannd curbarea ADNului;
(2) Activatorii interacioneaz cu
coactivatorii pentru stimularea
decondensrii cromatinei;
(3) Activatorii se leag la mediatori
declannd asamblarea ARN
polimerazei II i factorilor de
transcripie generali la boxele
promotorului.

La eucariote se ntilnesc trei tipuri de ARN-polimeraze: I, II, III. Se ntlnesc domenii


comune la toate 3 polimeraze, pe langa care sunt i domeniile specifice fiecrei proteine. Un
domeniu specific al ARN-polimerazei II
este CTD (C-terminal domain). El se
constituie din 7 aminoacizi (Tyr-Ser-ProThr-Ser-Pro-Ser) care se repet de 52 ori la
mamifere. La iniierea transcripiei, CTD
este defosforilat, ns o dat cu elongarea,
resturile de serin i unele de tirozin din
CTD ncep a fi fosforilate de ctre TFIIH,
factor general de transcriptie care ramane
ataat de polimeraz n timpul elongrii
(mecanism de reglare a activitaii ARNpolimerazei II).

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

3.

Reglarea posttranscripional
Reglarea posttranscripional acioneaz n procesul de maturizare a preARNm i
transportul acestuia spre ribozomi. Unul din fenomenele-cheie, n contextul reglrii
posttranscripionale, este controlul splicing-ului alternativ. Aceast etap n processing-ul
preARNm-ului ofer posibilitatea obinerii unei mari varietai de peptide dintr-o singur unitate
de transcripie.
3.1 Controlul splicing-ului se realizeaz prin 2 mecanisme fundamentale: pozitiv i
negativ. Controlul positiv se desfasoar prin proteine activatoare de splicing (splicing enhancers)
care identific un situs specific n apropierea situsului de splicing. Ulterior, ele stimuleaz
activitatea spliceozomului. Mecanismul controlului negativ const n ataarea unei proteine
supresoare de splicing la preARNm, fapt ce mpiedic interaciunea spliceozomului cu situsul de
clivare.
Alte moduri de obinere a diferitor variante de ARNm din una i aceiai gen sunt:
utilizarea promotorilor multipli, situsurilor de poliadenilare multiple.

Exemplul 4: Iniierea transcripiei de la diferii promotori din aceiai unitate de


transcripie. n cazul dat, intronul 1 conine un promotor => iniierea transcripiei datorit lui
conduce la un peptid fara exonul 1, n cazul n care splicingul nu are loc.
n exemplul de mai jos este prezentat obinerea amilazei hepatice sau a celei salivare n
dependena de promotorul ales la iniierea transcripiei:

Prin urmare, nr. multiplu de promotori ofer noi posibilitai de reglare a expresiei genice.

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

Exemplul 5: Expresia difereniat a genei IgM pe baza a 2 situsuri de poliadenilare (=>


poliadenilare alternativ).
IgM se ntilnete sub 2 forme: monomer i polimer. Forma monomer se afl legat de
membrana unor limfocite B. Forma polimer circul liber prin ser. Cele doua variante de IgM se
obin din aceiai gen datorit poliadenilrii alternative:

n sinteza IgM membranar, clivarea preARNm i sinteza cozii poliadenilate are loc dup
exonul 6. n sinteza IgM din ser, clivarea preARNm are loc dup exonul 4, excluznd astfel
exonii 5 i 6.
3.2 Editarea ARN reprezint fenomenul de modificare a secvenei unui ARN sintetizat.
Datorita acestui proces, n cazul unui ARNm, poate fi modificat secvena de aminoacizi.
Intilnim 2 tipuri de editare la mamifere: deaminarea Adeninei => Inozina, i deaminarea
Citidinei => Uracil. Inozina este un nucleotid ntlnit n ARNt, dar i n ali transcripi, prin
urmare, acest tip de editare are un rol esenial n sinteza ARNt. Se cunosc canale transportatoare
din creier, ARNm-ul crora de asemenea se supune editarii A=>I, proces efectuat de enzima
ADAR sau adenosine deaminase acting on RNA. Experimentele efectuate pe oareci
demonstreaz importana acestui proces: deleia genei ADAR la oareci a cauzat moartea
oarecilor odat cu ncetarea procesului de alptare.
Editarea C=>U are aplicaii practice relevante n contextul apolipoproteinei B (apoB),
componenta a lipoproteinelor. n unele
celule a tubului digestiv are loc aceast
editare,
rezultatul
creia
este
producerea
unui
codon
STOP
(CAA=>UAA) => o protein mai
scurt. n ficat, enzima care realizeaz
editarea nu este expresat => se
produce o apolipoprotein B mai lung.
9

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

3.3. Transportul ARNm este o alt etap a expresiei genice care poate fi controlat.
preARNm-ul nu poate fi exportat din nucleu dac nu are coada poliA. Exportul din nucleu este
mediat de proteinele porului nuclear (receptori) care nu permit trecerea ARN-ului instabil sau
nematurizat, dar este realizat de exportine. Odata n citozol, ARNm-ul ncepe a fi translat de un
ribozom, iniial liber. Proteina destinat exportului, membranei celuare, RE, AG sau lizozomilor,
va avea o secvena specific de aminoacizi la capatul N-terminal => odat cu sinteza primilor
aminoacizi, alte proteine recunosc acea secvena specific i fixeaz ribozomii mpreun cu
ARNm i acea secven deja sintetizat de REr. Alte proteine recunosc diferite secvene n
regiunea netranslat 3 a ARNm-ului. n aceste cazuri, translatia eficienta nu incepe pna n
momentul n care ribozomii i ARNm-ul se afl la destinaia potrivit. Mecanismele de
direcionare a ARNm-ului la o anumit destinaie sunt posibile datorit interaciunii ARNm-ului
cu diferite proteine, formnd RNP-uri (ribonucleoproteide). Secvenele recunoscute de aceste
proteine se afl de obicei n regiunea netranslat 3.

10

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

4.

Reglarea translaional
Reglarea translaiei se realizeaz n mare parte datorit factorilor de translaie care
particip la iniiere, elongare i terminare. Fiind implicate n biosinteza proteinelor, aceti factori
sunt indispensabili oricrei celule. Dar, lasnd factorii de translaie deoparte, exist alte
mecanisme complexe de reglare a expresiei la acest nivel. Mecanismele date se bazeaz pe
stimularea/inhibarea factorilor de translaie i interaciunea cu ARNm ce se supune translaiei.
n diferite situaii celulele sunt nevoite s micoreze rata de sintez a unor proteine.
Astfel de situaii pot fi: micorarea concentraiei factorilor mitotici n mediu, insuficiena
nutrienilor, influena virusilor, trecerea celulelor n G0, etc.
Un rol important n micsorarea ratei de sintez n asemenea situaii o are eIF2. eIF2 este
un factor de iniiere a translaiei responsabil de legarea ARNt-Met de subunitatea 40S a
ribozomului, proces n urma cruia eIF2 ramane ataat la 40S.

Dup aceast interaciune, ARNt-Met interacioneaz cu ARNm, cutand codonul


START (AUG). Odat cu identificarea AUG, eIF2 transforma GTP-ul legat de ea n GDP i se
detaeaz de 40S. Iniial, eIF2 are ataat un GTP, ns odat cu iniierea translaiei are un GDP.
Pentru a readuce eIF2 la starea iniial, o alta protein, guanine nucleotide exchange factor
(eIF2B), cauzeaz detaarea GDP de eIF2 astfel nct eIF2 capteaz un alt GTP din citozol, fiind
gata de iniierea unui alt proces de translaie. Acest fenomen de reutilizare a eIF2 poate fi reglat
prin fosforilarea eIF2. eIF2 fosforilat interacioneaz prea strans cu eIF2B, astfel nct eIF2B este
inactivat. Dat fiind faptul ca moleculele de eIF2 sunt mult mai numeroase dect eIF2B, este
destul de fosforilat o mic parte din totalitatea eIF2 pentru a preveni reutilizarea celorlalte eIF2 i
a inhiba considerabil translarea tuturor ARNm. Procesul descris este o parte a mecanismului de
trecere a celulelor n faza G0 a ciclului celular (starea non-proliferativ a celulelor, caracteristic
celulelor specializate i nalt specializate).

11

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

Reglarea lungimii cozii poli-A influenteaz direct rata translaiei. n timpul translaiei,
coada poli-A interactioneaz cu diferite proteine, care o apara de exonucleaze. Drept raspuns la
diferite semnale, aceste proteine se pot detasa de coada poli-A, facilitand scindarea ei de catre
exonucleaze. Odata ce coada poli-A ajunge la un numar critic de nucleotide, se declanseaz un
proces de degradare a ARNm-ului dat. n acest proces se implic deadenilazele. De obicei,
ARNm prasete nucleul cu coada poli-A, care n citozol i n timpul translaiei se scurteaz pna
la momentul n care cauzeaz degradarea ARNm-ului. Totusi, cozile unor ARNm specifici
continua a fi sintetizate n citozol: cazul ovocitelor i zigotilor. Majoritatea reactiilor de
degradare a ARNm-ului sunt inhibate n aceste celule, fapt ce le permite acumularea ARNm n
citozol. Acest proces are un rol important pentru supravieuirea i dezvoltarea urmatorului
organism. Asadar, n ovocite i zigoti, ARNm citoplasmatic are doar 10-30 A la capatul 3. n
aceast stare, ARNm-ul nu este translat, insa la un anumit moment dup fertilizare, cand
produsul acestor ARNm este indispensabil, o poli-A-polimeraz citozolic sintetizeaz coada
poli-A => se iniiaza translaia acestor ARNm. Chiar i la etapa de blastomeri, nucleul celulelor
nc este inactiv, nsa necesitatea sintezei proteinelor persist. Astfel, proteinele se vor sintetiza
din ARNm transmis de la zigot prin diviziunea citoplasmei n timpul mitozei. Cercetarile
demonstreaz ca distributia difereniata a ARNm-urilor n citoplasma ovocitului => distribuia
difereniata a ARNm-urilor n citoplasma zigotului => diferii blastomeri mostenesc diferite
tipuri ARNm => genomul se activeaz n mod diferit => primele fenomene de difereniere a
celulelor.
Pe langa mecanismul de scurtare de catre exonucleaze a cozii poli-A, exist alte
mecanisme de degradare a ARNm. Unul din ele reprezint nlaturarea CAP-ului (decaparea),
urmat de aciunea exonucleazelor n directia 53 (n mecanismul precedent, exonucleazele
acioneaza 35). n general, majoritatea ARNm-urilor au o durata de viaa mai mica de 30
min, dar exista exceptii: ARNm pentru -globina are o durata de viaa de mai mult de 10h. Orice
ARNm este supus acestor 2 procese de degradare, iar durata vieii sale este determinata
nemijlocit de secvena de NTP-uri. Regiunea 3 netranslat are un rol deosebit de important n
determinarea durata vieii, caci ea este recunoscut de proteine care iniiaz procesul de
degradare.
Pe langa mecanismele generale de degradare a ARNm-ului descrise mai sus, exist
mecanisme specifice unor anumite ARNm:
Exemplul 6: Influena fierului asupra translaiei feritinei i a receptorului transferinei.
Feritina este o proteina globular care reprezint un depozit de fier. Ea stocheaz i elibereaz fierul prin
mecanisme bine determinate. Rolul ei principal este reglarea nivelului de fier n citoplasma. Transferina este o
proteina capabil de a capta fierul. Spre deosebire de feritina, rolul ei este reglarea concentratiei de fier n mediul
extracelular (plasma sangvin). Receptorul transferinei reprezint un canal membranar care regleaz concentraia de
fier n mediul intracelular. Aceast protein asigur endocitoza mediat de receptori a complexului transferina-fier.
Reglarea cantitaii de fier transportate n celula se efectueaz prin reglarea nr. de receptori ai transferinei, fapt
efectuat prin degradarea ARNm.

12

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

n cazul deficitului de fier intracelular, aconitaza citozolic se fixeaza de un situs din regiunea 5
netranslat (secvena lider) a ARNm-ului feritinei, blocnd iniierea translaiei. n acelai timp, ARNm-ul
receptorului transferinei interacioneaz cu o alta aconitaz datorit unui situs din regiunea 3 netranslat. n absena
aconitazei, ARNm-ul receptorului transferinei este instabil din cauza unui situs de clivare recunoscut de
endonucleaze, ns aconitaza acoper acest situs, facilitnd translaia. n rezultat, n cazul deficitului de fier
citoplasmatic, feritina nu se sintetizeaz => fierul nu se depoziteaz, iar datorit intensificrii sintezei receptorului
transferinei, mai multe complexe transferin-fier vor fi endocitate => fier intracelular.

n cazul surplusului de fier intracelular, aconitaza i schimb conformaia => nu interacioneaz cu


ARNm-urile pentru feritin i receptorul transferinei. Drept rezultat, secvena lider a ARNm-ului pentru feritin este
recunoscut de subunitatea 40S i are loc translaia => sinteza feritinei => depozitarea surplusului de fier
intracelular. Totodat, situsul de clivare din regiunea 3 netranslat a ARNm-ului receptorului transferinei menionat
anterior i notat cu (X) n imagine este recunoscut de endonucleaze => clivarea ARNm-ului n 2 fragmente. Ambele
fragmente vor fi digerate (proteinele vor recunoate absena CAP-ului la un fragment i absena cozii poli-A la
cellalt). Astfel, acest mecanism asigur concentraia fierului intracelular ntr-o anumit limit de valori.

13

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

Alte mecanisme de reglare translaional implic miARN-uri necodante. Implicarea


acestor molecule n expresia genelor i n alte procese moleculare nu se credea relevant ceva
timp n urm. ns, odat cu mbuntirea tehnologiilor s-a determinat valoarea lor. Inafar de
ARNm, ARNt, ARNr exist multe alte tipuri de ARN care indeplinesc o varietate mare de functii
importante (ex:ARNsn din spliceozom, ARN Xist, miARN, siARN, etc.).

miARN (micro ARN) reprezint un ARN scurt necodant implicat n reglarea translaiei.
miARN este sintetizat de ARN-polimeraza II. La fel ca preARNm, pre-miARN se supune CAParii i poliadenilarii, dupa care trece printr-un mod specific de maturizare: este clivat n mai
multe fragmente de catre o enzim specific DICER, devenind astfel un adevarat microARN.
Ulterior, miARN-urile interactioneaz cu diferite proteine formnd un RNP: RISC (RNA-induced
silencing complex). Odat asamblat, complexul RISC caut un ARNm cu o secvena
complementara secvenei miARN. Complexul RISC are o secvena scurt liber din cadrul
miARN cu ajutorul cruia caut ARNm-ul int. Odat gsit, miARN va forma un hibrid
bicatenar dac secvena sa este complementar cu cea a ARNm. De obicei, secvena
complementar a ARNm-ului se afl n regiunea 3 netranslat. Ulterior, RISC va cliva ARNm,
nlaturnd un fragment din regiunea 3 netranslat mpreun cu coada poli-A => ARNm este
expus la exonucleaze => ARNm este degradat. Un singur complex RISC poate cauza degradarea
a sute de ARNm, cci are nevoie de un singur miARN n calitate de ghid. n cazul n care
secvenele miARN i ARNm nu sunt perfect complementare (ex: din 7 nucleotide se cupleaz 56), Complexul RISC destabilizeaz ARNm-ul prin scurtarea cozii poli-A i transportarea ARNm
la corpuri-P (P-bodies sau processing bodies). Corpurile P sunt poriuni de citoplasm cu o
14

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

concentratie mare de enzime implicate n degradarea ARNm. Odat transportate aici, ARNmurile sunt degradate. Astfel, un singur tip de miARN poate inhiba translaia diferitor tipuri de
ARNm, precum regiunea 3 netranslat poate fi similar la diferite ARNm-uri. miARN i factorii
de transcripie reprezint cele mai importante elemente reglatoare a genelor de dezvoltare la
eucariote. Procesul dat de inhibare a translaiei prin asemenea aciune a unui miARN poart
denumirea de interferena ARN (iARN).
Interferena ARN este, mai intii de toate, un mecanism de aparare a celulei mpotriva ARN-ului exogen
(strain) bicatenar si, ntr-o masura mai mic, monocatenar. Unii virui au n calitate de elemente genetice molecule
de ARN bicatenar. Viruii ce folosesc asemenea elemente introduc ARN bicatenar n celula gazd, dar acest ARN
nu se afla liber n citoplasma, el este plasat ntr-un complex membranar. Pe baza acestui ARN bicatenar, n interiorul
complexului membranar, se sintetizeaz ARNm-uri specifice virusului care vor fi translate de ribozomii celuleigazd i vor produce proteinele capsidei virusului i alte enzime, cum ar fi diverse polimeraze. Pe lang asta, pe
baza ARN bicatenar, se sintetizeaz ARNm monocatenar care ulterior se replic, devenind bicatenar datorit
polimerazelor i se introduce n capsida format din celelalte proteine sintetizate de celula-gazd pentru virus. Altfel
spus, virusul se replic. Mecanismul de iARN depisteaz acel ARN bicatenar i l utilizeaz pentru depistarea
ARNm-urilor exogene:

1) ARN bicatenar este recunoscut de un complex proteic care contine un DICER (nucleaza implicata n
procesarea prin clivare a miARN).
2) Acest complex cliveaz ARN-ul bicatenar n mai multe fragmente bicatenare de aproximativ 20 pb
numite ARNsi (de la small interfering RNA).
3) ARNsi este fixat de un complex RISC, iar ulterior, catena-sens (codant) se inlatur, fapt ce rezult n
crearea unui complex RISC cu un ARNsi monocatenar atasat.
4) ARNsi ghideaz complexul RISC spre molecule de ARNm complementare produse de celula-gazd
conform secvenei introduse de virus.
5) Odat identificate, ca i n mecanismul precedent, RISC va determina degradarea imediat a ARN-ului
viral, cci complementaritatea secvenelor va fi perfect.
Interferenta ARN este utilizat n cercetari i experimente i este vazut ca o metod de perspectiv a
ingineriei genice de tratare a unor maladii. Conceptual, este simplu de introdus ARNsi n celul i de indus formarea
complexului RISC care va cauza inhibarea expresiei genei inta. O astfel de strategie se propune pentru tratarea
bolilor cauzate de o gen cu o expresie exagerata (oncogena hipermorf).

15

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

5. Reglarea posttranslaional
Reglarea posttranslaional reprezint controlul modificrilor posttranslaionale ale
peptidului. Ele contribuie la mrirea nr. de proteine care pot fi obinute dintr-o singur gen.
Reglarea la acest nivel se realizeaza prin modificari reversibile i ireversibile. Din modificarile
reversibile fac parte: acetilarea, glicozilarea, fosforilarea, metilarea, etc. Adaugarea diferitor
grupe ine de funcia proteinei i localizarea ei, ex: adugarea lipidelor este un semn c proteina
este destinat membranei celulare. Un exemplu relevant este adugarea ubiquitinei (o protein),
fapt ce induce degradarea peptidului dat de ctre un complex proteozom. Modificrile
ireversibile in de scurtarea peptidului prin hidroliza, care poate fi o etapa n procesul de
maturizare i cptare a conformaiei (folding).
Modificri chimice ale proteinelor cu elevan medical:
Modificarea
Acetilarea

Proteina int
Histone

Acilare

RAS(p21)

ADP ribozilare

Rho (o protein GTP


de dimensiuni mici)

Carboxilare

Factorii de coagulare

Formarea
punilor
disulfidice
Glicarea

Anticopri

Glicozilarea

Proteinele eritrocitelor

Glicozil
fosfatidil
inozitol (GPI)

Proteinele reglatoare a
complementului

Fosforilare

Receptorii factorilor de
cretere

Ubiquitinarea

Proteinele direcionate
spre degradare

Hemoglobina

Consecina
Implicare n interaciunea ADN-proteine datorit faptului c
proteinele histone sunt frecvent acetilate
RAS este ancorat la suprafaa intern a membranei
citoplasmatice prin famesil (un fragment acyl gras). Au fost
sintetizai inhibitorii acestei modificri care inhib
oncogenitatea RAS
Toxina Clostridium botulinum a crei Rho ADP- ribozilare
duce la inhibarea eliberrii acetilcolinei care la rndul su
duce la paralizie flasc.
Carboxilarea factorilor VII, IX, X, fibrinogen i protenelor
C i S este necesar pentru coagulare. Acest proces este
inhibat de ctre warfarin
Anticorpii sunt molecule complexe funcia crora necesit
multiple puni disulfidice intra i intermoleculare
Hemoglobina glicozilat HbA1c este utilizat pentru
monitorizarea pacienilor cu diabet zaharat.
Adugarea resturilor glucidice la proteinele eritrocitelor
determin grupele sangvine, corespondena acestora fiind
cardinal pentru transfuziile i transplanturile de succes.
Bolnavii cu Hemoglobinurie paroxismal nocturn, pierd
capacitatea legturile GPI. Aceti bolnavi nu pot produce
proteinele reglatoare a complementului de pe suprafaa
celular, ceea ce cauzeaz distrugerea eritrocitelor i
anemie.
Fosforilarea proteinelor de regul duce la semnale de
promovare a creterii. Unele din medicamentele contra
cancerului blocheaz fosforilarea
Ubiquitinarea necorespunztoare i degradarea a diferitor
proteine poate duce la conformarea anormal a proteinelor.
Conformarea anormal poate duce la o serie de boli printre
care i boala Alzheimer.

16

Biologia molecular

Reglarea expresiei genice la eucariote

E.Ursu S.Capcelea

n concluzie, expresia unei gene este efectul sumar al tuturor factorilor de reglare care
acioneaz la diferite niveluri. n rezultat, se obine o expresie dependent de esut, perioada
ontogenetic, sex i condiii de mediu. Expresia dependent de esut are drept consecin
diferenierea i specializarea celulelor n anumite funcii. Expresia dependent de perioada
ontogenetic are rolul de a asigura dezvoltarea normal a noului organism prin reglarea fina a
produselor genice. Expresia dependenta de sex ine de diferene n expresia genelor la femei i
barbai. Expresia dependenta de conditiile de mediu are loc n genele plastice (ex: alcooldehidrogenaza e activa doar atunci cand este prezent alcoolul). Evaluarea expresiei genice este o
perspectiv ce a schimbat radical dogmele biologiei moleculare i ale geneticii.

17