Sunteți pe pagina 1din 18

C A P I T O L U L 2 

Genomul uman –
noțiuni introductive

Cunoașterea organizării, variației și transmiterii genomului ANALIZA CROMOZOMIALĂ ȘI GENOMICĂ


uman este esențială pentru aprecierea rolului geneticii în ÎN MEDICINA CLINICĂ
medicină, precum și a principiilor emergente medicinii geno­
mice și personalizate. În prezent, accesul la secvența geno­ Analiza cromozomială și genomică au devenit o procedură
mului uman și recunoașterea rolului variației genomice în importantă de diagnostic în medicina clinică. Aceste aplicații,
descrise detaliat în capitolele următoare, includ următoarele
cazul unei boli permit utilizarea pe scară largă a influenței aspecte:
acestei variații asupra sănătății umane. Analiza comparativă • Diagnosticul clinic. Numeroase afecțiuni medicale, inclu­
a genomurilor individuale evidențiază primul mesaj major al zând și unele boli comune, sunt asociate cu modificări
acestui volum – fiecare individ are propria sa constituție cromozomiale de număr sau de structură și, în vederea
genetică, o combinație unică și caracteristică de produși genici diagnosticării și consultului genetic, necesită o analiza
cromozomială sau genomică (a se vedea Capitolele 5 și 6).
realizată în urma interacțiunii reciproce între secvența • Identificarea genei. Un obiectiv major al geneticii și geno­
genomică și setul particular de factori de mediu în care se micii medicale actuale este acela de a identifica gene speci­
dezvoltă acel individ. După cum s-a precizat în capitolul fice și de a elucida contribuțiile lor asupra stării de sănătate
precedent, această constituție genetică unică reflectă ceea ce sau boală. Asupra acestui subiect se face referire adesea, dar
Garrod denumea cu mai mult de un secol în urmă individu- va fi prezentat în detaliu în Capitolul 10.
• Genomica bolii canceroase. Modificările genomice și cro­
alitate chimică oferind o fundamentare conceptuală pentru mozomiale care se produc în celulele somatice sunt impli­
practica medicinii genomice și personalizate. cate în inițierea și dezvoltarea multor forme de cancer (a
Prin urmare, progresele tehnologiei genomice și explozia se vedea Capitolul 15).
de cunoștințe și informații derivate din Proiectul Genomul • Tratamentul bolilor genetice. Evaluarea integrității, consti­
Uman joacă astfel un rol transformator în integrarea și apli­ tuției și stadiului de diferențiere a genomului este importantă
pentru dezvoltarea celulelor stem pluripotente specifice pa­­
carea conceptelor și descoperirilor din domeniul geneticii în cientului, utilizate în scop terapeutic (a se vedea Capitolul 13).
practica medicală. • Diagnosticul prenatal. Analiza cromozomială și genomică
este o etapă esențială în diagnosticul prenatal (a se vedea
Capitolul 17).
GENOMUL UMAN ȘI BAZELE CROMOZOMIALE
ALE EREDITĂȚII
Aprecierea importanței geneticii în medicină presupune
cunoașterea naturii materialului ereditar, a modului cum unor bastonașe numite cromozomi, localizate în nucleul
este organizat acesta în genomul uman, cum se transmite fiecărei celule. Influența genelor și a geneticii asupra stării de
celulelor fiice în timpul diviziunii celulare și în succesiunea sănătate și boală este profundă, iar originea ei se găsește în
generațiilor prin reproducere. Genomul uman este format informația codificată în ADN-ul care formează genomul
dintr-o mare cantitate de acid dezoxiribonucleic (ADN) care uman.
conține în cadrul structurii sale informația genetică necesară Fiecare specie are un complement cromozomial caracte­
pentru direcționarea tuturor stadiilor embriogenezei, dezvol­ ristic (cariotip) prin număr, morfologie și informația genetică
tării, metabolismului și reproducerii – în esență, toate cromozomială care formează genomul. Genele sunt localizate
aspectele care contribuie ca un individ uman să fie un organ­ într-o succesiune liniară în cromozomi, fiecare genă având o
ism funcțional. Fiecare celulă nucleată din corp conține poziție precisă denumită locus. O hartă genică reprezintă
propria sa copie a genomului uman, care, depinzând de cum harta localizării genomice a genelor și este caracteristică
se definește termenul, poate avea între 20.000 și 50.000 de fiecărei specii și indivizilor din cadrul unei specii.
gene (a se vedea Cadranul următor). Genele, pe care în acest Studiul cromozomilor, al structurii lor și al rolului lor în
moment le considerăm simplu și în sens general drept unități ereditate se numește citogenetică. Citogenetica umană s-a
funcționale ale informației genetice, sunt înscrise în ADN-ul născut ca știință abia în 1956, când s-a demonstrat pentru
genomic și organizate sub forma unor organite asemănătoare prima oară că numărul normal de cromozomi umani este
3
4 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

46. De atunci, s-au acumulat multe cunoștințe despre cro­ locus specific, omologii pot avea secvențe identice sau dife­
mozomii umani, structura și compoziția lor normală, iden­ rite; aceste forme diferite ale unei gene poartă numele de
titatea genelor pe care le conțin, precum și despre numeroasele alele. Unul dintre cei doi cromozomi omologi ai unei perechi
și variatele anomalii cromozomiale. se moștenește de la tată iar celălalt de la mamă. În general,
Cu excepția celulelor care se transformă în gameți cei doi cromozomi ai unei perechi de autozomi nu se deoseb­
(celulele liniei germinale), toate celulele care contribuie la esc între ei microscopic. La femei, cromozomii de sex, cei
formarea structurilor corpului sunt denumite celule soma­ doi cromozomi X, nu se deosebesc între ei. La bărbați, însă,
tice (soma, corp). Genomul prezent în nucleul celulelor cromozomii de sex diferă între ei. Un cromozom al perechii
somatice umane conține 46 de cromozomi, are 24 de tipuri este X, identic morfologic celor doi cromozomi de la femeie,
de cromozomi diferite morfologic și este organizat în 23 de pe care bărbatul îl moștenește de la mama sa și îl transmite
perechi (Fig.2-1). Dintre cele 23 de perechi de cromozomi, fiicelor sale; celălalt cromozom al perechii, cromozomul Y,
22 sunt deopotrivă la bărbați și la femei fiind numiți auto­ este moștenit de la tată și este transmis numai fiilor săi. În
zomi și numerotați în ordinea descrescătoare a mărimii lor, Capitolul 6, în care vom explora bazele cromozomiale și
de la cei mai mari către cei mai mici. Perechea 23 include doi genomice ale bolilor umane, vom expune câteva excepții de
cromozomi de sex diferiți: cromozomul X și cromozomul Y la regula simplă și aproape universală că femeile au cromo­
la bărbați și doi cromozomi X la femei. Un aspect fundamen­ zomii de sex XX și bărbații XY.
tal al genomului uman este acela că fiecare cromozom poartă Pe lângă genomul nuclear, o mică dar importantă parte
un set diferit de gene dispuse într-o succesiune liniară de-a a genomului uman se găsește în mitocondria din cito­
lungul moleculei sale de ADN. Cromozomii unei perechi plasma celulei (vezi Fig.2-1). Cromozomul mitocondrial,
(denumiți cromozomi omologi sau omologi) conțin ce va fi descris mai jos în acest capitol, prezintă un număr
informație genetică echivalentă între ei; astfel că, ei au carac­ de particularități care-l deosebesc de restul genomului
teristic aceleași gene în aceeași ordine. Totuși, la nivelul unui uman.

Celula somatică

Cromozomi Cromozomi nucleari


mitocondriali

CAGGTCTTAGCCATTCGAATCGTACGCTAGCA CAGGTCTTAGCCATTCGAATCGTACGCTAGCA CAGGTCTTAGCCATTCGAATCGTACGCTAGCA CAGGTCTTAGCCATTCGAATCGTACGCTAGCA


ATTCTTATAATCGTACGCTAGCAATTCTTATGGA ATTCTTATAATCGTACGCTAGCAATTCTTATGGA ATTCTTATAATCGTACGCTAGCAATTCTTATGGA ATTCTTATAATCGTACGCTAGCAATTCTTATGGA
AACTGTGAATAGGCTTATAACAGGTCAGGTCT AACTGTGAATAGGCTTATAACAGGTCAGGTCT AACTGTGAATAGGCTTATAACAGGTCAGGTCT AACTGTGAATAGGCTTATAACAGGTCAGGTCT
TAGCCATTCGAATCGTACGCTAGCAATTCTTAT TAGCCATTCGAATCGTACGCTAGCAATTCTTAT TAGCCATTCGAATCGTACGCTAGCAATTCTTAT TAGCCATTCGAATCGTACGCTAGCAATTCTTAT
AATCGTACGCTAGCAATTCTTATGGAAACTGTG AATCGTACGCTAGCAATTCTTATGGAAACTGTG AATCGTACGCTAGCAATTCTTATGGAAACTGTG AATCGTACGCTAGCAATTCTTATGGAAACTGTG
AATAGGCTTATAACAGGTCAGGTCTTAGCCATT AATAGGCTTATAACAGGTCAGGTCTTAGCCATT AATAGGCTTATAACAGGTCAGGTCTTAGCCATT AATAGGCTTATAACAGGTCAGGTCTTAGCCATT
CGAATCGTACGCTAGCAATTCTTATAATCGTAC CGAATCGTACGCTAGCAATTCTTATAATCGTAC CGAATCGTACGCTAGCAATTCTTATAATCGTAC CGAATCGTACGCTAGCAATTCTTATAATCGTAC
GCTAGCAATTCTTATGGAAACTGTGAATAGGCT GCTAGCAATTCTTATGGAAACTGTGAATAGGCT GCTAGCAATTCTTATGGAAACTGTGAATAGGCT GCTAGCAATTCTTATGGAAACTGTGAATAGGCT
TATAACAGGTCAGGTCTTAGCCATTCGAATCGT TATAACAGGTCAGGTCTTAGCCATTCGAATCGT TATAACAGGTCAGGTCTTAGCCATTCGAATCGT TATAACAGGTCAGGTCTTAGCCATTCGAATCGT
ACGCTAGCAATTCTTATAATCGTACGCTAGCAA ACGCTAGCAATTCTTATAATCGTACGCTAGCAA ACGCTAGCAATTCTTATAATCGTACGCTAGCAA ACGCTAGCAATTCTTATAATCGTACGCTAGCAA
TTCTTATGGAAACTGTGAATAGGCTTATAACAG TTCTTATGGAAACTGTGAATAGGCTTATAACAG TTCTTATGGAAACTGTGAATAGGCTTATAACAG TTCTTATGGAAACTGTGAATAGGCTTATAACAG
GTCAGGTCTTAGCCATTCGAATCGTACGCTAGC GTCAGGTCTTAGCCATTCGAATCGTACGCTAGC GTCAGGTCTTAGCCATTCGAATCGTACGCTAGC GTCAGGTCTTAGCCATTCGAATCGTACGCTAGC
AATTCTTATAATCGTACGCTAGCAATTCTTATGG AATTCTTATAATCGTACGCTAGCAATTCTTATGG AATTCTTATAATCGTACGCTAGCAATTCTTATGG AATTCTTATAATCGTACGCTAGCAATTCTTATGG
AAACTGTGAATAGGCTTATAACAGGTCAGGTCT AAACTGTGAATAGGCTTATAACAGGTCAGGTCT AAACTGTGAATAGGCTTATAACAGGTCAGGTCT AAACTGTGAATAGGCTTATAACAGGTCAGGTCT
TAGCCATTCGAATCGTACGCTAGCAATTCTTATA TAGCCATTCGAATCGTACGCTAGCAATTCTTATA TAGCCATTCGAATCGTACGCTAGCAATTCTTATA TAGCCATTCGAATCGTACGCTAGCAATTCTTATA
ATCGTACGCTAGCAATTCTTATGGAAACTGTAA ATCGTACGCTAGCAATTCTTATGGAAACTGTAA ATCGTACGCTAGCAATTCTTATGGAAACTGTAA ATCGTACGCTAGCAATTCTTATGGAAACTGTAA
TAGGCTTATAACAGGTCAGGTCTTAGCCATTCG TAGGCTTATAACAGGTCAGGTCTTAGCCATTCG TAGGCTTATAACAGGTCAGGTCTTAGCCATTCG TAGGCTTATAACAGGTCAGGTCTTAGCCATTCG
AATCGTACGCTAGCAATTCTTATAATCGTACGCT AATCGTACGCTAGCAATTCTTATAATCGTACGCT AATCGTACGCTAGCAATTCTTATAATCGTACGCT AATCGTACGCTAGCAATTCTTATAATCGTACGCT
AGCAATTCTTATGGAAACTGTGAATAGGCTTATA AGCAATTCTTATGGAAACTGTGAATAGGCTTATA AGCAATTCTTATGGAAACTGTGAATAGGCTTATA AGCAATTCTTATGGAAACTGTGAATAGGCTTATA
ACAGGTCAGGTCTTAGCCATTCGAATCGTACG ACAGGTCAGGTCTTAGCCATTCGAATCGTACG ACAGGTCAGGTCTTAGCCATTCGAATCGTACG ACAGGTCAGGTCTTAGCCATTCGAATCGTACG
CTAGCAATTCTTATAATCGTACGCTAGCAATTCT CTAGCAATTCTTATAATCGTACGCTAGCAATTCT CTAGCAATTCTTATAATCGTACGCTAGCAATTCT CTAGCAATTCTTATAATCGTACGCTAGCAATTCT
TATGGAAACTGTGAATAGGCTTATAACAGGTCA TATGGAAACTGTGAATAGGCTTATAACAGGTCA TATGGAAACTGTGAATAGGCTTATAACAGGTCA TATGGAAACTGTGAATAGGCTTATAACAGGTCA
GGTCTTAGCCATTCGAATCGTACGCTAGCAATT GGTCTTAGCCATTCGAATCGTACGCTAGCAATT GGTCTTAGCCATTCGAATCGTACGCTAGCAATT GGTCTTAGCCATTCGAATCGTACGCTAGCAATT
CTTATAATCGTACGCTAGCAATTCTTATGGAAAC CTTATAATCGTACGCTAGCAATTCTTATGGAAAC CTTATAATCGTACGCTAGCAATTCTTATGGAAAC CTTATAATCGTACGCTAGCAATTCTTATGGAAAC
TGTGAATAGGCTTATAACAGGTCAGGTCTTAGC TGTGAATAGGCTTATAACAGGTCAGGTCTTAGC TGTGAATAGGCTTATAACAGGTCAGGTCTTAGC TGTGAATAGGCTTATAACAGGTCAGGTCTTAGC
CATTCGAATCGTACGCTAGCAATTCTTATAATCG CATTCGAATCGTACGCTAGCAATTCTTATAATCG CATTCGAATCGTACGCTAGCAATTCTTATAATCG CATTCGAATCGTACGCTAGCAATTCTTATAATCG

...CTAGCAATTCTTATAATCGTACGCTAG
TCTTATGGAAACTGTGAATAGGCTTATAACAGGAG
GTCTTAGCCATTCGAATCGTACGCTAGC...
Secvență a genomului uman
Figura 2-1 Genomul uman, înscris atât în cromozomii nucleari cât și cei mitocondriali. Vezi Surse și
mulțumiri..
CAPITOLUL 2 — Genomul uman – noțiuni introductive 5

Purine Pirimidine

NH2 O

C C
N CH3
N C HN C
CH
HC C C CH
N O N
N
H H O
Adenină (A) Timină (T) _ 5' Bază
O P O CH2 O
_
O C C
H H
H H
O NH2 3' C C
OH H
C N C
HN C N CH Fosfat Dezoxiriboză
CH
C C C CH
H2N N O N
N
H H
Guanină (G) Citozină (C)

Figura 2-2  Cele 4 baze azotate ale ADN și structura generală a unui nucleotid ADN. Fiecare dintre cele
4 baze se leagă cu dezoxiriboza (prin legături de hidrogen indicate prin culoarea magenta) și cu un grup
fosfat pentru a forma nucleotidul corespunzător.

GENELE DIN GENOMUL UMAN Deși catalogul definitiv al genelor umane rămâne un obiectiv
dificil de realizat, se recunosc două tipuri generale de gene, acelea
Ce este gena? Câte gene avem? Aceste întrebări au răspunsuri al căror produs de sinteză este o proteină și acelea al căror produs
mult mai dificil de găsit decât pare. este un ARN funcțional.
Termenul genă, introdus pentru prima dată în 1908, a fost • Numărul de gene codificatoare de proteine – recunoscut
utilizat în multe contexte diferite de la prima descriere a carac­ ca o caracteristică a genomului va fi prezentat în Capitolul
teristicilor esențiale ale „unităților ereditare“ făcută de Mendel 3 – este estimat între 20.000 și 25.000. În această carte, se
cu peste 150 de ani în urmă. Pentru medici (și, de asemenea, folosește un număr aproximativ de 20.000 de gene, dar
pentru Mendel și alți geneticieni din vremea sa), o genă poate fi cititorul ar trebui să știe că această cifră este imprecisă și
definită prin efectul vizibil asupra unui organism și funcția de posibil subestimată.
transmitere în succesiunea generațiilor determinată statistic. • În plus, de câteva decenii se știa clar că produsul final al
Pentru medicii geneticieni, o genă este recunoscută clinic în unor gene nu este o proteină ci un ARN transcris folosind
contextul unei variante observabile care determină o tulburare ca matriță secvența ADN. Există numeroase tipuri diferite
clinică distinctă. În prezent sunt recunoscute aproximativ 5.000 de astfel de gene ARN (denumite, de obicei, gene neco­
de tulburări de acest tip (vezi Capitolul 7). dificatoare pentru a le deosebi de genele codificatoare de
Proiectul Genomul Uman oferă o bază mult mai sistematică proteine) și, în prezent, se estimează că mai există încă cel
pentru descrierea genelor umane, susținută mai degrabă pe puțin alte 20.000-25.000 de gene ARN necodificatoare în
analiza secvenței ADN decât pe criteriul clinic și studii familiale; genomul uman.
de fapt, acesta a fost unul dintre motivele pentru care a fost inițiat Prin urmare – în funcție de ceea ce înțelege fiecare prin
proiectul la sfârșitul anilor ’80. Cu toate acestea, deși secvențierea această noțiune – numărul de gene din genomul uman este
era completă în 2003, era evident că abilitatea noastră de a estimat între 20.000 și 50.000 de gene. Totuși, cititorul va aprecia
recunoaște caracteristicile unei secvențe care sugerează existența că acestă cifră se poate schimba, în funcție de evoluția definițiilor,
sau identitatea unei gene era limitată. Interpretarea secvenței posibilitățile tehnologice și precizia analitică, progresul infor­
genomice umane și corelația variației ei cu biologia umană, atât matic și medicina digitală, precum și adnotarea mai completă a
în starea de sănătate cât și cea de boală, este o provocare constantă genomului.
a cercetării biomedicale.

Structura ADN: scurtă recenzie distincte: un glucid cu 5 atomi de carbon, dezoxiriboza; o


Înaintea unui studiu detaliat al organizării genomului uman bază azotată; și un grup fosfat (Fig.2-2). Bazele azotate pot fi
și a cromozomilor săi, este necesară o analiză a naturii ADN de două tipuri: purinice și pirimidinice. În ADN cele două
care formează genomul. ADN este o macromoleculă de acid tipuri de baze purinice sunt adenina (A) și guanina (G), iar
nucleic cu structură polimerică formată din trei elemente cele două tipuri de baze pirimidinice sunt timina (T) și
6 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

A B
_
capătul 5’ O Legături 3.4 Å
_ 5' de hidrogen
O P O 3'
O C
Baza 1 G
H2C 5'
O
C C
H H
H H
3' C C
C
O H G
34 Å
_
O P O

O
Baza 2 T
H2C 5'
O A
C C
H H
H H
3' C C
O H C
_ G
O P O

O 3'
Baza 3
H2C 5' 5'
O
C C
H H
H H
3' C C
capătul 3’
OH H 20 Å

Figura 2-3  Structura moleculei ADN. A, O regiune a secvenței nucleotidice a unei catene ADN în care
se observă legăturile fosfodiester 3’-5’ asigurând continuitatea nucleotidelor învecinate. B, Modelul dublei
elice ADN conform propunerii lui Watson și Crick. „Treptele“ orizontale reprezintă legăturile dintre bazele
azotate pereche. Se crede că elicea este răsucită spre dreapta deoarece catena care merge de jos-stânga în
sus-dreapta înfășoară catena opusă. Secțiunea detaliată a figurii ilustrează cele două catene complementare
ADN, arătând perechile de baze AT și GC. Rețineți că orientarea celor două catene este antiparalelă. Vezi
Surse și mulțumiri.

citozina (C). Nucleotidele, fiecare dintre ele fiind compusă catenei complementare, iar G cu C. Natura specifică a
din bază azotată, grup fosfat și pentoză, polimerizează în informației genetice codificată în genomul uman corespunde
catene lungi polinucleotidice prin legături 5’-3’ fosfodiester secvenței de baze azotate C, A, G și T prezente în cele două
formate între dezoxiribozele adiacente (Fig. 2-3A). În catene ale dublului helix dispuse în fiecare dintre cromo­
genomul uman, aceste lanțuri polinucleotidice există sub zomi, atât în nucleu cât și în mitocondrie (vezi Fig. 2-1).
forma dublului helix (Fig.2-3B) având lungimi mari de sute Având în vedere complementaritatea celor două catene
de milioane de nucleotide ca în cazul celui mai mare cromo­ ADN, cunoașterea secvenței de baze nucleotidice a unei
zom uman. catene permite automatic determinarea secvenței de baze
Structura anatomică a ADN poartă informația genetică nucleotidice a catenei pereche. Structura dublu-catenară a
înscrisă chimic, ceea ce permite transmiterea fidelă a moleculei ADN îi permite să se replice fidel prin separarea
informației genetice de la celula mamă la celulele fiice și de celor două catene, urmată de sinteza noilor catene comple­
la o generație la alta. În același timp, structura primară a mentare în concordanță cu secvența originală a catenelor
ADN specifică secvența de aminoacizi din lanțurile polipep­ matriță (Fig. 2-4). De asemenea, ori de câte ori este necesar,
tidice ale proteinelor, așa cum se va descrie în capitolul complementaritatea bazelor permite o reparare eficientă și
următor. ADN prezintă caracteristici adecvate funcțiilor corectă a moleculei ADN cu erori de replicare.
sale. Modelul structurii originale a ADN, elucidat de James
Watson și Francis Crick în 1953, arată similar unei duble
elice (vezi Fig.2-3B). Structura elicoidală este asemănătoare Structura cromozomilor umani
unei scări în spirală răsucite spre dreapta în care cele două Structura genelor din genomul uman, precum și factorii
catene polinucleotidice orientate în direcții opuse sunt legate determinanți ai expresiei genice sunt specificați în ADN-ul
între ele prin punți de hidrogen între perechile de baze celor 46 de cromozomi umani din nucleul celulei somatice
azotate complementare: T unei catene se împerechează cu A plus ADN-ul cromozomului mitocondrial. Fiecare
CAPITOLUL 2 — Genomul uman – noțiuni introductive 7

cromozom uman este alcătuit dintr-o singură moleculă ADN proteine specializate din clase diferite. Exceptând perioada
dublu catenară, continuă; fiecărui cromozom îi corespunde diviziunii celulare, cromatina este distribuită în tot spațiul
o moleculă dublu-catenară, lungă, astfel că genomul nuclear nuclear prezentând un aspect relativ omogen la microscop.
are 46 molecule ADN liniare totalizând peste 6 miliarde de Atunci când celula se divide, genomul său condensat este
perechi de nucleotide (vezi Fig. 2-1). vizibil microscopic sub forma cromozomilor. Prin urmare,
Cromozomii nu sunt formați numai din ADN-ul dublu cromozomii sunt vizibili ca structuri distincte doar în timpul
catenar. În interiorul fiecărei celule, genomul este organizat diviziunii celulare, dar își păstrează integritatea și între
în cromatină, în care ADN-ul genomic se asociază cu diviziunile celulare.
În cromatină, molecula ADN cromozomială se asociază
5'
cu o familie de proteine cromozomiale numite histone. Acest
3'
G C complex interacționează cu un grup heterogen de proteine
G C
C G nonhistonice, proteine implicate în stabilirea unei structuri
A T spațiale și funcționale adecvate care să asigure comporta­
G
A
C
T
mentul normal al cromozomilor și expresia corespunzătoare
T A
a genelor.
G
A
C
T
Se cunosc cinci clase majore de histone care joacă un rol
C
T
G
A
fundamental în împachetarea (compactarea) cromatinei.
Există câte două copii ale fiecărei histone H2A, H2B, H3 și
G
A T
C
H4 dispuse în miezul nucleozomului formând octamerul
T A T A
histonic în jurul căruia se înfășoară un segment de ADN
C 3' 5' G
G C G C dublu-catenar similar unui fir pe o bobină (Fig. 2-5). ADN-ul
asociat octamerului histonic are circa 140 de perechi de baze
A T A T
T A T A

T A T A (pb) și formează două ture în jurul acestuia. După un scurt


G C G C
G C G C (între 20 și 60 pb) segment ADN „spacer“ se formează
următorul complex ADN-octamer histonic și, în continuare,
C G C G

A
G
T
C
A
G
T
C
se adaugă succesiv noi complexe ADN-octamer histonic
A
T
T
A
A
T
T
A
conferind cromatinei un aspect asemănător unui șirag de
T A T A
mărgele pe o ață. Fiecare complex ADN-octamer histonic
5' 3' 5' 3' este numit nucleozom (vezi Fig. 2-5) și reprezintă unitatea
Figura 2-4 Replicarea dublului helix ADN are ca rezultat formarea structurală de bază a cromatinei. Fiecare dintre cei 46 de
celor două molecule fiice, fiecare fiind formată dintr-o catenă veche și cromozomi umani conține între câteva sute de mii și mai mult
una nou sintetizată. de un milion de nucleozomi. Cea de a cincea histonă, H1, se

~30 nm ~10 nm 2 nm

Fiecare buclă
Celula în interfaza conține
timpurie ~100-200 kb
ADN

~140 pb
ADN

Regiune a
cromozomului Octamer
interfazic histonic
Nucleu Solenoid Fibra de cromatină Dublul helix
interfazic („șirag de mărgele pe o ață“)

Figura 2-5  Nivelurile de organizare a cromatinei în cromozomul uman.


8 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

fixează la ADN-ul „spacer“ și ADN-ul nucleozomului doar 37 de gene. Deși produșii acestor gene sunt activi în
formând legătura internucleozomală care conectează doi mitocondrie, majoritatea proteinelor din mitocondrie sunt,
nucleozomi succesivi. Cantitatea de ADN asociat miezului în realitate, produși ai genelor nucleare. S-au descris mutații
nucleozomic împreună cu ADN-ul „spacer“ conține aproxi­ mitocondriale în afecțiuni transmise exclusiv pe linie
mativ 200 pb. Pe lângă principalele tipuri de histone mai maternă dar și în cazul unor tulburări sporadice       (Cazul 33)     
există și un număr de histone specializate care pot înlocui (vezi Capitolele 7 și 12).
histonele H3 sau H2A conferind ADN-ului genomic carac­
teristici specifice în regiunile cromozomiale respective. De
asemenea, histonele pot suferi modificări chimice producând Secvența genomului uman
schimbarea proprietăților nucleozomilor care le conțin. Așa Plecând de la cunoștințele generale despre structura și semni­
cum se va prezenta mai detaliat în Capitolul 3, modelul tipu­ ficația clinică a cromozomilor și genelor pe care le poartă,
rilor principale de histone specializate și modificările lor oamenii de știință și-au concentrat atenția asupra identificării
poate varia de la o celulă la alta considerându-se a fi și localizării unor gene specifice din genomul uman. Din
răspunzător de împachetarea ADN și conformația accesibilă acest efort comun a fost inițiat Proiectul Geno­mul Uman
moleculelor reglatoare care determină expresia genică sau care a reunit sute de laboratoare din întreaga lume într-un
alte funcții genomice. consorțiu internațional pentru a determina secvența
Pe parcursul ciclului celular, după cum se va detalia mai completă a celor 3 × 109 pb (3.300 milioane de pb ale unui
jos în acest capitol, cromozomii trec prin faze succesive de set haploid de cromozomi) din ADN nuclear distribuită în
condensare și decondensare. Totuși, chiar și atunci când cele 24 tipuri diferite de cromozomi umani (22 de autozomi,
cromozomii sunt mai lacși, decondensați, în interfaza ciclu­ plus cromozomii X și Y).
lui celular, ADN-ul împachetat în cromatină este mai com­ Timp de un deceniu și jumătate, susținute de progresele
pactat decât ar fi în forma sa nativă de dublă elice, neasociat majore ale tehnologiei de secvențiere a ADN, marile centre
cu proteine. Mai mult, filamentele lungi cu nucleozomi sunt de secvențiere au colaborat pentru stabilirea ordinii liniare a
ele însele condensate într-o structură elicală secundară, nucleotidelor ADN ale fiecărui cromozom prin secvențierea
fibra de cromatină, rezultată prin înfășurarea filamentelor unor segmente mici asamblate, ulterior, în secvențe con­
în jurul unui „solenoid“ (din grecescul solenoeides, tub în tinue. În anul 2003, la finalizarea Proiectului Genomul
formă de cilindru) și considerată unitatea fundamentală de Uman, s-a publicat o secvență consens de „referință“ obținută
organizare a cromatinei (vezi Fig. 2-5). La rândul lor, sole­ prin secvențierea unor genomuri provenite de la mai multe
noizii se pliază în bucle și domenii atașate la intervale de persoane diferite și utilizată ca bază în analize comparative
aproximativ 100.000 pb (echivalentul a 100 kilobaze [kb], cu secvențele genomurilor individuale. Această secvență de
deoarece 1 kb = 1.000 pb) unui schelet proteic (matrice), referință se găsește în bazele de date accesibile public pentru
nonhistonic, din interiorul nucleului. S-a presupus că a facilita aplicarea în practica medicală a descoperirilor
aceste bucle sunt unități funcționale ale genomului, iar științifice. Secvența genomică este prezentată, de regulă, în
punctele de atașare la schelet ale fiecărei bucle sunt specifice direcția 5’-3’ doar pe una dintre cele două catene ADN
de-a lungul ADN-ului cromozomial. După cum se va pentru că secvența catenei complementare 3’-5’ poate fi
observa în continuare, unul dintre nivelurile de control al dedusă pe baza structurii complementare a moleculei ADN
expresiei genice depinde de modul cum ADN-ul și genele descrisă mai sus (Fig. 2-6).
se condensează în cromozomi și de interacțiunile acestora
cu proteinele cromatinei în procesul de organizare a ADN
în celulă. Organizarea genomului uman
Imensa cantitate de ADN poate fi observată după prelu­ Cromozomii nu sunt doar o colecție aleatorie de gene dife­
crarea cromozomilor cu scopul de a separa ADN-ul de rite și alte secvențe ADN. Regiuni genomice cu caracteristici
scheletul proteic (vezi Fig. 2-1). Prin eliberarea ADN-ului similare tind să se grupeze, iar organizarea funcțională a
în acest mod, pot fi vizualizate atât bucle lungi de ADN cât genomului reflectă secvența și structura sa. Unele regiuni
și scheletul proteic cu forma identică a unui cromozom cromozomiale sau chiar cromozomi întregi au o densitate
tipic. genică mare (regiuni „urbane“), în timp ce altele au o densi­
tate genică scăzută (regiuni „deșertice“) (Fig. 2-7). Conse­
Cromozomul mitocondrial cințele clinice ale anomaliilor structurale genomice reflectă
După cum s-a amintit deja, un grup mic, dar important de natura specifică a genelor și secvențelor implicate. Prin
gene ale genomului uman se găsesc în mitocondriile cito­ urmare, anomaliile cromozomilor sau regiunilor cromozo­
plasmei (vezi Fig. 2-1), Genele mitocondriale se transmit miale cu densitate genică mare tind să producă efecte clinice
exclusiv pe linie maternă (vezi Capitolul 7). Celulele umane mult mai severe decât defectele unor regiuni genomice simi­
au sute sau mii de mitocondrii, fiecare având mai multe copii lare ca mărime, dar cu densitate genică mică.
ale unei molecule mici, circulare reprezentată de cromozo­ Ca urmare a cunoștințelor furnizate de Proiectul Genomul
mul mitocondrial. ADN-ul mitocondrial are o lungime de Uman, rezultă clar că organizarea ADN în genomul uman
numai 16 kb (reprezentând un segment minuscul compara­ este mult mai variată și complexă decât se credea anterior.
tiv cu lungimea celui mai mic cromozom nuclear) și conține Din miile de milioane pb ADN ale oricărui genom, mai
CAPITOLUL 2 — Genomul uman – noțiuni introductive 9

5´ ... G G A T T T C T A G G T A A C T C A G T C G A ... 3´
Dublu helix
3´ ... C C T A A A G A T C C A T T G A G T C A G C T ... 5´

Secvența ... G G AT T T C T A G G T A A C T C A G T C G A ...


de referință

Individul 1 ... G G A T T T C T A G G T A A C T C A G T C G A ...


Individul 2 ... G G A T T T C C A G G T A A C T C A G T C G A ...
Individul 3 ... G G A T T T C C A G G T A A C T C A G T C G A ...
Individul 4 ... G G A T T T C T A G G T A A C T C A G T A G A ...
Individul 5 ... G G A T - - C T A G G T A A C T C A G T C G A ...
Figura 2-6  Un segment din secvența de referință a genomului uman. Prin convenție, sunt prezentate
numai secvențele unei catene de ADN, deoarece secvența catenei complementare poate fi dedusă pe baza
structurii dublu catenare a ADN-ului (prezentată mai sus secvența de referință). Secvența ADN a unui
grup de indivizi este similară, dar nu identică cu cea de referință și se observă schimbarea unui singur
nucleotid la unii indivizi și o mică deleție a două baze la alții.

1
2000 Cromozomi „bogați”
în gene

Densitatea genică medie:


19 ~6.7 gene/Mb
1500
11 2
Numărul de gene

17
12 6 3
1000
16 14 7 5
9
X 4
10
20 8
15
500
22
13
21 18
Cromozomi
„săraci” în gene
Y
0
0 50 100 150 200 250
Mărimea cromozomului (Mb)

Figura 2-7  Mărimea și conținutul de gene al celor 24 de cromozomi umani. Linia diagonală punctată
corespunde densității medii a genelor din genom, aproximativ 6,7 gene codificatoare de proteine per
megabază (Mb). Cromozomii relativ bogați în gene sunt deasupra diagonalei și au tendința de a fi localizați
în partea stângă, superior. Cromozomii relativ săraci în gene sunt sub diagonală și au tendința de a fi
localizați în partea dreaptă, inferior. Vezi Surse și mulțumiri.
10 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

puțin de 1,5% din genom codifică, de fapt, proteine. Se ADN satelit deoarece multe dintre familiile de repetiții în
credea că elementele de reglare care influențează sau tandem au putut fi separate ca benzi („sateliți“) distincte față
determină modele de expresie genică în timpul dezvoltării de restul ADN genomic prin centrifugare.
sau țesuturi ar reprezenta încă aproximativ 5% din secvența Familiile ADN cu secvențe repetate în tandem variază
genomică dar, recent, studiile asupra caracteristicilor croma­ în funcție de localizarea lor în genom și caracteristicile
tinei sugerează că o cantitate mult mai mare din genom poate secven­țelor din care sunt formate. În general, astfel de
furniza semnale relevante pentru funcțiile genomice. Aproxi­ blocuri de secvențe repetate în tandem ating dimensiuni
mativ jumătate din lungimea totală a secvenței liniare mari de peste câteva milioane de pb și reprezintă un procent
genomice constă din așa-numita copie-simplă sau ADN cu semnificativ din cantitatea ADN a unui cromozom uman.
secvențe unice per genom, adică ADN a cărui ordine liniară Unele secvențe repetate în tandem sunt utilizate pentru
de nucleotide specifice este reprezentată doar o singură dată analiza citogenetică în clinică (vezi Capitolul 5). Blocurile
(sau cel mult un număr mic de copii) în genom. Această lungi de secvențe repetate formate din repetiții (cu unele
observație poate părea surprin­zătoare având în vedere că variații) ale unei secvențe scurte, cum ar fi un pentanucleo­
există doar patru tipuri diferite de nucleotide în ADN. Dar tid, se găsesc în regiunile genetic inerte ale cromozomilor
dacă luăm în considerare chiar și un segment genomic mic 1, 9 și 16 și reprezintă mai mult de jumătate din cromozo­
cu o lungime de numai 10 baze combinând cele patru tipuri mul Y (vezi Capitolul 6). Alte familii de secvențe repetate
de nucleotide se obțin peste un milion de secvențe de nucleo­ în tandem au repetiții ale unei secvențe ceva mai lungi. De
tide posibile. Și, deși ordinea bazelor în genom nu este exemplu, ADN-ul alfa-satelit conține secvențe (unități) de
complet aleatorie, orice secvență particulară de 16 nucleo­ 171 pb repetate în tandem și se află localizat în regiunea
tide se estimează că există doar o singură data în oricare centromerică a fiecărui cromozom fiind esențial pentru
genom analizat. atașarea cromozomilor de microtubulii fusului de diviziune
Restul genomului este format din mai multe clase de în timpul diviziunii celulare.
ADN repetitiv și include ADN ale cărui secvențe sunt Pe lângă ADN cu secvențe repetate în tandem, în
repetate de sute sau milioane de ori în genom, repetițiile genom mai există o altă clasă importantă de ADN repeti­
fiind identice sau cu mici variații. Deși majoritatea (dar nu tiv formată din secvențe asemănătoare, dar dispersate în
toate) celor 20.000 de gene din genom codifică proteine (vezi întregul genom și nicidecum grupate într-una sau mai
Cadranul prezentat anterior în acest capitol), ele fiind multe regiuni cromozomiale. Deși această descriere
reprezentate de ADN nerepetitiv, cu secvențe unice, secven­ generală se potrivește mai multor familii de ADN, există,
țele din clasele de ADN repetitiv contribuie la menținerea în special, două dintre acestea care merită o atenție
structurii cromozomului și sunt o sursă importantă de deosebită pentru că, împreună, repre­ zintă o parte
variație genetică între indivizi; unele din aceste variații pot semnificativă din genom și au fost implicate în boli gene­
predispune la procese patologice în cadrul genomului, după tice. Printre elementele repetitive dispersate cel mai bine
cum se va prezenta în Capitolele 5 și 6. studiate se numără așa-numita familie Alu. Membrii
acestei familii au repetiții de secvențe cu o lungime de 300
Secvențele ADN unice per genom pb fiecare și, deși asemănătoare, nu sunt identice. În total,
Chiar dacă ADN cu secvențe unice reprezintă cel puțin există în genom peste un milion de copii reprezentând cel
jumătate din genom, multe dintre funcțiile sale sunt necu­ puțin 10% din ADN-ul uman. A doua familie de ADN cu
noscute pentru că, așa cum s-a menționat anterior, secvențele repetiții dispersate este numită LINE (prescurtatea din lb.
care codifică efectiv proteinele (regiunea codificatoare a engleză – Long Interspersed Nuclear Element) sau familia
genei) reprezintă doar o mică parte din întregul ADN cu cu elemente nucleare intercalate lungi (numită, uneori,
secvențe unice. Cea mai mare parte a secvențelor ADN unice L1). LINEs au o lungime de până la 6 kb și în genom se
au dimensiuni reduse (câteva Kb sau mai puțin) și sunt inter­ găsesc circa 850.000 de copii reprezentând aproximativ
calate printre secvențele variatelor tipuri de ADN repetitiv. 20% din ADN-ul uman. Ambele familii au copii nume­
Organizarea genelor cu secvențe ADN unice este explicată roase în anumite zone ale genomului, iar în altele sunt
în Capitolul 3. foarte rare. Regiunile cu conținut bogat în GC tind să aibă
o abundență de elemente Alu fiind sărace în LINEs, iar
Secvențele ADN repetate multe dintre regiu­nile bogate în AT, din contră, tind să
Se cunosc mai multe clase de ADN cu secvențe repetate. aibă a abundență de LINEs și elemente rare Alu.
Pentru a determina tipul de secvențe repetate („repetiții“)
este util să se evidențieze dacă secvențele repetate sunt ADN-ul repetitiv și bolile genetice.  Atât secvențele Alu
grupate într-una sau câteva regiuni cromozomiale sau sunt cât și LINEs sunt considerate drept cauză a mutațiilor
dispersate, intercalate printre secvențele unice de-a lungul implicate în boli ereditare. Cel puțin câteva copii ale fami­
cromozomului. Se estimează că secvențele repetate grupat, liilor LINE și Alu produc copii ale propriilor secvențe care,
în bloc, reprezintă 10-15% din întregul genom și se ulterior, se pot integra oriunde în genom și inactiva prin
organizează în tandem prin aranjare una după alta, cap- inserție, ocazional, o genă cu semnificație medicală.
coadă, a secvențelor scurte cu număr variabil de nucleotide. Frecvența unor astfel de evenimente care determină boli
Diferitele tipuri de repetiții în tandem sunt numite generic genetice umane este necunoscută, dar poate reprezenta nu
CAPITOLUL 2 — Genomul uman – noțiuni introductive 11

mai puțin de 1 la 500 de mutații. În plus, rearanjările între în orice încercare de a înțelege contribuția geneticii la
diferitele repetiții LINE sau Alu produse de recombinari sănătatea umană.
anormale pot fi cauza unor mutații detectate în anumite
boli genetice (vezi Capitolul 12).
Un alt tip important de ADN repetitiv observat în multe TRANSMITEREA GENOMULUI
regiuni diferite ale genomului este alcătuit din secvențe Bazele cromozomiale ale eredității constau în copierea geno­
duplicate, deseori, cu un grad de conservare foarte ridicat. mului și transmiterea sa de la celula mamă celulelor fiice în
Duplicațiile care afectează segmente cromozomiale impor­ timpul diviziunii celulare și de la o generație la alta în timpul
tante, numite duplicații segmentare, pot avea sute de kb și reproducerii, când copiile individuale ale fiecărui părinte se
reprezintă cel puțin 5% din genom. Atunci când regiunile întâlnesc la noul embrion.
cromozomiale duplicate conțin gene, rearanjările între sec­ Pentru realizarea acestor forme asemănătoare dar dis­
vențele genomice duplicate pot duce la deleția sau duplicația tincte de transmitere a genomului există două tipuri de divi­
unei regiuni ADN ( respectiv, a genelor) fiind cauza unor ziune, mitoza și meioza. Mitoza este diviziunea carac­teristică,
boli genomice (vezi Capitolele 5 și 6). obișnuită, a celulelor somatice prin care organismul crește,
diferențiază și asigură regenerearea tisulară. Prin diviziune
mitotică, din celula inițială, de obicei rezultă două celule
VARIABILITATEA fiice, fiecare având numărul de cromozomi și infor­mația
GENOMULUI UMAN genetică identice cu ale celulei inițiale (celula-mamă). Se pot
produce zeci sau chiar sute de mitoze succesive într-o linie
După finalizarea secvenței de referință a genomului uman, celulară somatică. Spre deosebire de mitoză, meioza se
atenția a fost îndreptată spre descoperirea și catalogarea produce numai în celulele germinale. Meioza are ca rezultat
variațiilor de secvență între indivizi diferiți (incluzând atât formarea celulelor reproducătoare (gameți) fiecare având
indivizi sănătoși cât și pe aceia cu boli diferite) și între doar 23 de cromozomi: câte unul din fiecare pereche de
populații diferite din întreaga lume. După cum se va autozomi și un gonozom, fie un X sau un Y. De aceea, în timp
prezenta în detaliu în Capitolul 4, există multe zeci de ce celulele somatice sunt diploide (diploos, dublu) sau 2n
mi­lioane de variații de secvență comune care sunt obser­ complementul cromozomial normal (46 de cromozomi),
vate cu o frecvență semnificativă în cadrul uneia sau mai gameții sunt haploizi (haploos, simplu) sau n (23 de cromo­
multor populații; orice persoană are cel puțin 5 milioane zomi). Erorile diviziunii celulare pot produce anomalii cro­
de astfel de variații de secvență. În plus, există nenumărate mozomiale de număr sau structură în celulele fiice, atât în
variante foarte rare, multe dintre acestea fiind observate celulele somatice cât și în cele ale liniei germinale, care, de
doar la una sau câteva persoane. De fapt, dacă luăm în regulă, au consecințe clinice importante.
considerare numărul de indivizi ai speciei noastre, practic
este de așteptat ca fiecare pereche de baze a genomului să fie
diferită la o anumită persoană într-un anumit loc din lume. Ciclul celular
Din acest motiv, secvența inițială a genomului uman este Ființa umană își începe dezvoltarea de la ovulul fecundat
considerată o secvență de „referință“ pentru specia noastră (celula ou sau zigot), o celulă diploidă care va produce prin
dar, în realitate, nu este identică cu secvența genomică a zeci sau chiar sute de mitoze succesive toate celulele corpului
niciunei persoane. (cifră estimată la circa 100 de miliarde). Evident, mitoza este
Conform estimărilor inițiale, două persoane selectate esențială pentru creștere și diferențiere, dar reprezintă doar
aleatoriu ar avea secvențe identice într-un procent de 99,9% o mică parte a ciclului celulei. Perioada dintre două mitoze
sau, cu alte cuvinte, un genom individual ar avea două succesive se numește interfază și este faza în care celula își
va­riante diferite (alele) ale secvenței genomice umane în petrece cea mai mare parte a ciclului său de viață.
aproximativ 3-5 milioane de poziții, cu baze diferite (ex. T După finalizarea mitozei, celula intră într-o fază numită
sau G) în copiile maternă și paternă moștenite pentru acea G1, în care nu are loc sinteza ADN (Fig. 2-8). Unele celule
poziție secvențială particulară (vezi Fig. 2-6). Deși multe trec prin această fază în câteva ore; altele pot rămâne timp
dintre aceste diferențe alelice implică doar o singură îndelungat în faza G1 zile sau chiar ani. De fapt, unele tipuri
nucleotidă, o mare parte a variației constă în inserții și deleții de celule, cum ar fi neuronii sau eritrocitele, nu se mai divid
(de regulă) ale unor secvențe nucleotidice scurte, variații ale deloc când sunt complet diferențiate și rămân permanent
numărului de copii ale elementelor repetate (inclusiv gene) într-o fază numită G0 („G zero“). Alte celule, cum ar fi hepa­
sau inversii în ordinea nucleotidelor unei secvențe dintr-un tocitele, pot intra în faza G0, dar dacă se produc leziuni
anumit locus din genom (vezi Capitolul 4). hepatice, celulele revin în faza G1 și își continuă ciclul celular.
În prezent se știe că proporția din genom implicată în Ciclul celular este monitorizat de o serie de puncte de
variația genomică este mult mai mare decât cea estimată control care determină cronologia (succesiunea) fiecărei
inițial și reprezintă circa 0,5% între două persoane selectate etape a mitozei. În plus, aceste puncte de control monitorizează
la întâmplare. După cum se va explica în următoarele capi­ și verifică acuratețea sintezei ADN, precum și asamblarea
tole, fiecare dintre aceste tipuri de variații poate influența minuțioasă a unei rețele de microtubuli care facilitează
funcția biologică și, prin urmare, trebuie luate în considerare deplasarea cromozomilor atașați de filamentele ei. Dacă sunt
12 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

determinate de defecte ale telomerelor, kinetocorilor sau


aparatului ciclului celular, precum și replica inexactă a
unor segmente mici din genom (vezi Cadranul). Unele
dintre aceste boli vor fi prezentate detaliat în capitolele
următoare.
G1 Telomer
(10-12 ore)
Centromer
M
G2 S CONSECINȚELE CLINICE ALE ANOMALIILOR
(2-4 ore) (6-8 ore) Telomer ȘI VARIAȚIEI STRUCTURII
ȘI MECANICII CROMOZOMILOR

Boli relevante din punct de vedere medical, determinate de


anomalii ale structurii sau funcției elementelor cromozomiale
produse în timpul diviziunii celulare anormale, includ
Cromatide surori următoarele:
• Un spectru larg de malformații congenitale la copii cauzate
Figura 2-8  Un ciclu tipic al mitozei, descris în text. Sunt indicate de defecte ereditare ale genelor care sintetizează compo­
telomerele, centromerele și cromatidele surori.
nentele esențiale ale punctului de control al fusului de
diviziune implicat în verificarea atașării kinetocorilor la
microtubulii fusului
• Multe malformații congenitale și tulburări de dezvoltare
determinate de segregarea (separarea) anormală a cromozo­
detectate leziuni genomice, punctele de control mitotic milor cu centromere multiple sau absente (vezi Capitoul 6)
opresc trecerea la faza următoare până când se repară sau, în • Variate forme de cancer asociate cu replicarea în exces
cazul detectării unor defecte majore, celula primește (amplificare) sau modificarea timpului de replicare a unor
instrucțiuni de inducere a morții celulare programate (proces regiuni specifice din genom în faza S (vezi Capitolul 15)
numit apoptoză). • Sindromul Roberts caracterizat prin retard al creșterii,
scurtarea membrelor și microcefalie la copiii cu defecte ale
În timpul fazei G1 fiecare celulă conține un genom unei gene a cărei funcție normală determină sinteza unei
diploid. Când începe procesul de diviziune celulară, celula proteine care asigură alinierea corectă și coeziunea croma­
trece în faza S când este programată sinteza ADN care tidelor surori în faza S
realizează replicarea fidelă a ADN-ului fiecărui cromozom. • Insuficiența ovariană prematură considerată una dintre
În timpul fazei S, fiecare cromozom, care în faza G1 era principalele cauze ale infertilității feminine produsă de
mutații ale unei gene cu funcție meiotică specifică de
reprezentat de o singură moleculă ADN, este duplicat menținere a coeziunii corecte a cromatidelor surori
(re­plicat) rezultând cromatida soră (vezi Fig. 2-8). Fiecare • Așa-numitele sindroame cu scurtarea telomerelor repre­
cromatidă soră este formată dintr-o copie identică a mole­ zentate de diferite tulburări degenerative care se produc de
culei ADN liniare, dublu catenare, inițiale. Cele două cro­ la naștere până la maturitate la pacienții care prezintă o
matide surori sunt atașate fizic una de cealaltă la nivelul scurtare anormală a telomerelor cauzată de defecte ale
componentelor telomerazei
centromerului, o regiune a ADN asociată unui complex
proteic specific pentru a forma kinetocorul. Această
structură complexă facilitează atașarea fiecărui cromozom
de microtubulii fusului de diviziune, dar asigură și con­
trolul deplasării cromozomilor în timpul mitozei. Sinteza La sfârșitul fazei S, cantitatea ADN a celulei s-a dublat,
ADN are loc în faza S și nu este sincronă nici între cromo­ iar celula conține acum două copii ale genomului diploid.
zomi, dar nici în cadrul aceluiași cromozom; așadar, de-a După faza S, celula traversează o etapă scurtă numită G2.
lungul fiecărui cromozom începe replicarea în numeroase Pe tot parcursul ciclului celular, celula crește, eventual,
puncte specifice numite origini ale replicării ADN. Seg­ până la dublarea masei sale totale, înaintea următoarei
mentele cromozomiale individuale au fiecare timpul său mitoze. Etapa G2 se termină atunci când celula intră în
caracteristic de replicare pe parcursul celor 6-8 ore ale fazei mitoză, moment în care cromozomii încep să se conden­
S. Capetele fiecărui cromozom (sau cromatidă) prezintă seze și să devină vizibili microscopic sub forma unor fila­
telomere formate din secvențe ADN repetitive specializate mente subțiri, extinse, proces care va fi prezentat în detaliu
care asigură menținerea integrității cromozomului în în secțiunea următoare.
timpul diviziunii celulare. Menținerea corectă a capetelor Fazele G1, S și G2 constituie, împreună, interfaza. În celule
cromozomilor necesită participarea unei enzime speciale, umane tipice, cele trei faze durează între 16 și 24 de ore, în
numită telomerază, care asigură replicarea completă a timp ce mitoza durează una sau două ore (vezi Fig. 2-8). Cu
capetelor fiecărui cromozom. toate acestea, există o mare variație a duratei ciclului celular,
Semnificația majoră a acestor elemente structurale ale de la câteva ore în celulele care se divid rapid, cum ar fi
cromozomilor dar și rolul lor în asigurarea integrității celulele epidermului pielii sau ale mucoasei intestinale, până
genomului sunt demonstrate printr-o serie de boli clinice la câteva luni în alte tipuri de celule.
CAPITOLUL 2 — Genomul uman – noțiuni introductive 13

• Telofaza. În această fază, cromozomii încep să se decon­


Mitoza denseze, se reface membrana nucleară în jurul fiecărui
În timpul fazei mitotice a ciclului celular, un aparat complex nucleu al viitoarei celule fiice, revenindu-se la aspectul
asigură repartizarea în fiecare celulă fiică a unui set complet interfazic. Diviziunea celulară se finalizează prin scin­
de informații genetice. Acest proces se realizează printr-un darea citoplasmei, proces numit citokineză.
mecanism care distribuie câte o cromatidă din fiecare cro­ S-a observat că între o celulă care intră în mitoză și una
mozom în fiecare celulă fiică (Figura 2-9). Procesul de dis­ care tocmai și-a finalizat diviziunea mitotică există diferențe
tribuire a unei copii a fiecărui cromozom în fiecare celulă importante. O celulă în G2 are un genom complet replicat
fiică se numește segregare cromozomială. Importanța aces­ (un complement 4n al ADN-ului) și fiecare cromozom este
tui proces pentru creșterea normală a celulelor este ilustrată format din două cromatide surori. În schimb, după mitoză,
prin observarea faptului că multe tumori sunt caracterizate cromozomii fiecărei celule fiice au numai o copie a genomu­
de o stare de dezechilibru genetic determinat de erorile mito­ lui diploid. Această copie nu este duplicată până când celula
tice ale distribuției cromozomilor în celulele fiice. ajunge în faza S a următorului său ciclu celular (vezi Fig.2-8).
Mitoza este un proces continuu, însă se disting cinci faze, Prin urmare, întregul proces al diviziunii mitotice asigură
prezentate în Figura 2-9: profază, prometafază, metafază, dublarea și distribuirea ordonată (corectă) a genomului în
anafază și telofază. diviziunile celulare succesive.
• Profaza. Această fază se caracterizează prin condensarea
treptată a cromozomilor, formarea fusului mitotic și a
perechii de centrozomi care produce microtubulii și, Cariotipul uman
eventual, se deplasează în direcții opuse marcând polii Cromozomii condensați ai unei celule umane aflate în divi­
fusului de diviziune. ziune celulară pot fi analizați mai bine în metafază sau
• Prometafaza. În această fază, membrana celulară se prometafază. În aceste faze, cromozomii sunt dispersați în
dezintegrează permițând cromozomilor să se disperseze placa metafazică și vizibili la microscopul optic; fiecare cro­
în cadrul celulei și prin kinetocorii lor să se atașeze micro­ mozom este alcătuit din cele două cromatide surori atașate
tubulilor fusului de diviziune. una de cealaltă la nivelul centromerului, deși în cele mai
• Metafaza. În această fază, cromozomii ating gradul lor multe preparate cromozomiale, fiind ferm unite, cromatidele
maxim de condensare și sunt aliniați în planul ecuatorial surori sunt rareori vizibile ca entități separate.
al celulei. După cum s-a menționat deja, există 24 de tipuri diferite
• Anafaza. Cromozomii se separă prin clivarea centro­ de cromozomi umani, fiecare dintre aceștia deosebindu-se
merelor, iar cromatidele surori ale fiecărui cromozom citogenetic prin lungimea totală, poziția centromerului și
devin cromozomi independenți care se deplasează spre secvența de nucleotide, particularitate evidențiată prin dife­
polii opuși ai celulei. rite metode de colorare. Centromerul este evidențiat la
Celula în G2

Inițierea mitozei
Faza S Centrozomi
Interfaza
Celule în G2

Cromatina
decondensată Profaza

Citokineza

Telofaza Prometafaza

Anafaza Metafaza

Microtubuli
Figura 2-9  Mitoza. Sunt reprezentate numai 2
perechi de cromozomi. Pentru detalii suplimen­
tare, consultați textul.
14 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

cromozomii celulelor vii sunt structuri flexibile și dinamice.


În timpul mitozei, cromatina fiecărui cromozom interfazic
este condensată considerabil (Fig. 2-12). Când cromozomii
ajung la condensarea lor maximă în metafază, ADN-ul cro­
mozomial reprezintă circa 1/10.000 din lungimea lui totală
în stare extinsă. Când cromozomii sunt prelucrați pentru
evidențierea benzilor cromozomiale (ca în Fig. 2-10 și
2-11), pot fi recunoscute până la 1.000 sau mai multe benzi
pe preparatele colorate ale tuturor cromozomilor. Fiecare
bandă citogenetică conține 50 sau mai multe gene, deși,
după cum s-a menționat deja, densitatea genelor în genom
este variabilă.

Meioza
Meioza, procesul prin care celulele diploide dau nastere
gameților haploizi, este un tip de diviziune celulară specifică
celulelor germinale. Spre deosebire de mitoză, meioza constă
într-o singură replicare a ADN urmată de două diviziuni
celulare succesive și segregare cromozomială (vezi meioza I
Figura 2-10  Preparat citogenetic obținut dintr-o cultură de limfocite și meioza II din Fig. 2-13). Așa cum se prezintă în această
și colorat cu tehnica de bandare Giemsa (benzi G). Nucleul întunecat carte și este ilustrat în Figura 2-14, desfășurarea globală a
adiacent cromozomilor etalați aparține unei alte celule aflată în
evenimentelor din meioza masculină și cea feminină este
interfază, atunci când materialul cromozomial este răspândit în întreg
nucleul. Vezi Surse și mulțumiri. aceeași; cu toate acestea, momentul de debut al gametogene­
zei diferă la cele două sexe și va fi descris detaliat mai târziu
în acest capitol.
Meioza I se mai numește și diviziune reducțională deoa­
rece numărul de cromozomi se reduce la jumătate prin
nivelul constricției primare, o zonă de îngustare a croma­ împerecherea omologilor în profază și segregarea lor în
tidelor cromozomului determinată de formarea kinetocoru­ celule diferite în anafaza meiozei I. Meioza I este, de aseme­
lui. Centromerul este recunoscut ca un reper citogenetic care nea, remarcabilă pentru că în această etapă se produce
divide cromozomul (cromatida) în două brațe: un braț scurt recombinarea genetică (numită și crossing over-ul meiotic).
numit p (de la petit) și un braț lung sau q. În acest proces, așa cum se arată pentru o pereche de cro­
Figura 2-10 prezintă o celulă în prometafază ai cărei cro­ mozomi în Figura 2-14, segmente omoloage ale ADN-ului
mozomi au fost colorați cu metoda de colorare Giemsa sunt schimbate între cromatidele non-surori ale fiecărei
(benzile G) (vezi și Capitolul 5). Fiecare pereche de cromo­ perechi de cromozomi omologi, asigurându-se că niciunul
zomi prin colorare evidențiază un model caracteristic de dintre gameții rezultați în urma meiozei nu vor fi identici
benzi alternative, luminoase și întunecate, (benzi G) care se între ei. Consecințele teoretice și practice ale recombinării
corelează, în mare măsură, cu caracteristicile secvenței ADN sunt considerabile pentru multe aspecte ale geneticii și gen­
subiacente, cum ar fi compoziția de baze (procentul perechi­ omicii umane și sunt rezumate în tabelul de la sfârșitul
lor de baze, GC sau AT) sau distribuția elementelor ADN acestei secțiuni.
repetitive. Prin aceste tehnici de bandare, toți cromozomii Profaza meiozei I diferă de profaza mitotică prin mai
pot fi individualizați și se determină natura multor anomalii multe aspecte care au consecințe genetice importante,
numerice și structurale, așa cum se prezintă detaliat în Capi­ deoarece cromozomii omologi trebuie să se asocieze și să
tolele 5 și 6. facă schimb de informație genetică. Unul dintre stadiile
Deși, deseori, experții pot analiza direct cromozomii timpurii, numit zigoten, are un rol esențial deoarece cro­
meta­fazici la microscop, procedura uzuală presupune sepa­ mozomii omologi încep să se asocieze pe toată lungimea
rarea (decuparea) cromozomiilor dintr-o imagine digitală lor. Procesul de împerechere meiotică, sau sinapsis, este
sau microfotografie ordonându-i apoi în perechi conform adesea corect și aliniază secvențele ADN omoloage în
unor criterii standard (Fig. 2-11). Setul complet de cromo­ perechea de cromozomi. Cromozomii omologi, denumiți
zomi este numit cariotip. Acest termen este, de asemenea, acum cromozomi bivalenți, sunt menținuți împreună de
folosit pentru a se face referire la setul cromozomial standard o structură proteică cu aspectul unei panglici, numită
al unui individ („un cariotip normal de bărbat“) sau la o complex sinaptonemal, care este esențial pentru procesul
specie („cariotip uman“). Astfel, „cariotiparea“ este procesul de recombinare. Odată ce sinapsa este formată complet,
de obținere a cariotipului standard. recombinarea meiotică se produce în timpul stadiului de
Spre deosebire de cromozomii colorați observați la micro­ pahiten, după care complexul sinaptonemal se
scop folosind preparate cromozomiale sau în fotografii, dezintegrează.
CROMOZOMII DE SEX

Figura 2-11  Cariotipul unei persoane de sex masculin, colorat cu tehnica Giemsa (benzi G). Cromozo­
mii corespund prometafazei și sunt aranjați într-o ordine standard în care apar numerotați de la 1 la 22 în
ordinea mărimii, cu cromozomii X și Y aranjați separat. Vezi Surse și mulțumiri.

Metafaza
Decondensarea
înaintea următoarei
interfaze

Interfaza
nucleară Cromatină Profaza
decondensată

Condensarea la
începutul mitozei

Figura 2-12  Condensarea și decondensarea unui


cromozom pe parcursul unui ciclu celular.
16 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

Replicarea cromozomilor
Interfaza
Profaza I

Meioza I

Meioza I
Meioza II

Metafaza I

Patru gameți haploizi


Figura 2-13 Reprezentarea simplificată a principalelor etape ale Anafaza I
meiozei, cu un ciclu de replicare a ADN urmat de două cicluri de
se­gregare cromozomială, meioza I și meioza II.

La fel ca în mitoză, metafaza I începe când membrana


nucleară dispare. Se formează fusul de diviziune, iar cromo­
zomii împerecheați sunt aliniați în planul ecuatorial, centro­
merele orientate bipolar spre polii opuși ai celulei (vezi Fig.
2-14). Interfaza
Anafaza meiozei I diferă considerabil față de faza
corespunzătoare a mitozei. În acest caz, cei doi cromozomi
ai fiecărui bivalent sunt separați și nicidecum cromatidele
surori (comparați Fig. 2-14 cu Fig. 2-9). Centromerele omo­
loage (cu cromatidele lor surori atașate) sunt îndreptate spre
polii opuși ai celulei, proces numit disjuncție cromozomială.
Astfel, numărul de cromozomi este redus la jumătate și
fiecare celulă rezultată în urma meiozei I are un număr
Meioza II

haploid de cromozomi. Cele 23 de perechi de cromozomi

Metafaza II

Figura 2-14  Meioza și consecințele ei. Se prezintă o singură pereche


de cromozomi și un singur crossing-over având ca rezultat formarea a
patru gameți diferiți. Cromozomii se replică în timpul interfazei și
încep să se condenseze în momentul în care celula intră în profaza
meiozei I. În meioza I, cromozomii omologi se asociază ca bivalenți și
se recombină. În metafaza I omologii se dispun în placa metafazică cu Anafaza II
centromerele orientate spre polii opuși ai celulei și se poate observa
crossing-overul. În anafază I este evident schimbul de ADN între
omologi, în timp ce cromozomii se deplasează spre polii opuși ai fusului
de diviziune. Atunci când meioza I și citokineza se finalizează, începe
meioza II, ca o diviziune similară unei mitoze. Kinetocorii cromatidelor
surori se separă și se deplasează spre polii opuși în anafază II, pro­ Gameți
ducând patru celule haploide.
CAPITOLUL 2 — Genomul uman – noțiuni introductive 17

omologi se asortează independent (recombină) una față de Secvențe ADN Secvențe ADN
alta, astfel încât seturile de cromozomi originali paterni și de la bunic de la bunică
materni se distribuie în combinații cromozomiale aleatorii.
Numărul de combinații posibile dintre cele 23 de perechi de
cromozomi care pot fi prezenți în gameți este de 223 (mai
mult de 8 milioane). Cu toate acestea, datorită procesului de
recombinare, variația materialului genetic transmisă de la
Cromozomi
părinți la copil este de fapt mult mai mare decât această cifră. paterni
Ca rezultat, fiecare cromatidă conține, de obicei, segmente
derivate din ambii cromozomi ai fiecărei perechi de

CONSECINȚELE GENETICE ȘI RELEVANȚA MEDICALĂ


A RECOMBINĂRII OMOLOAGE

Lecția practică a acestei părți a capitolului este simplă:


conținutul genetic al fiecărui gamet este unic datorită
asortării independente (aleatorii) a cromozomilor parentali
care amestecă combinațiile de secvențe diferite între cromo­
zomi și recombinării omoloage (crossing-over) care amestecă
combinațiile de secvențe diferite în cadrul fiecărui cromozom.
Aceste mecanisme au implicații semnificative pentru modelele
de variație genomică dintr-o populație și între populații dife­
rite din întreaga lume, precum și pentru diagnostic și consi­
liere în cazul multor boli comune cu modele complexe de
transmitere (vezi Capitolele 8 și 10).
Cuantumul și modele de recombinare meiotică sunt
determinate de variantele genice specifice din secvențele ADN
implicate și „punctele fierbinți“ caracteristice, care sunt dife­
rite printre indivizi, între sexe, între familii și între populații Cromozom patern Cromozom patern
(vezi Capitolul 10). moștenit de Copilul 1 moștenit de Copilul 2
Deoarece procesul de recombinare implică interconectarea Figura 2-15   Efectul recombinării omoloage din timpul meiozei. În
fizică între cromozomi omologi până la momentul potrivit în acest exemplu, reprezentând moștenirea secvențelor unui cromozom
timpul meiozei I, este esențial să se asigure și separarea (se­gre­ tipic, mare, un individ are omologi diferiți, unul conținând secvențe
garea) corespunzătoare a cromozomilor în timpul meiozei. moștenite de la tatăl său (albastru) și unul cu secvențe omoloage de la
Erorile de recombinare pot duce la erori de distribuție mama sa (purpuriu). După meioză, în spermatogeneză, această
(nondisjuncție) a cromozomilor în meioza I fiind o cauză persoană transmite o singură copie completă a acelui cromozom la cei
frecventă a avortului și a anomaliilor cromozomiale, cum ar fi doi copii ai săi. Cu toate acestea, ca urmare a procesului de crossing-
sindromul Down (vezi Capitolele 5 și 6) . over (săgeți), copia transmisă fiecărui copil constă în segmente alter­
Eforturile majore, continue, de identificare a genelor și a nante provenite de la cei doi bunici. Copilul 1 moștenește o copie
variantelor lor responsabile pentru diverse afecțiuni medi­ rezultată în urma a două procese crossing over, în timp ce Copilul 2
cale se bazează pe urmărirea modului de moștenire a milioane moștenește o copie rezultată în urma a trei procese crossing over.
de diferențe de secvență în cadrul familiilor sau prezența
varian­ telor comune în cadrul grupurilor de indivizi chiar
neînrudiți dar afectați de o anumită boală. Utilitatea acestei
abordări, care a condus, până în prezent, la descoperirea
multor asocieri genă-boală depinde de modelele de recombi­ cromozomi parentali, așa cum este prezentat schematic în
nare omoloagă în meioză (vezi Capitolul 10). Figura 2-14. De exemplu, în acestă fază, un cromozom uman
Deși recombinarea omoloagă este adesea corectă, zonele de
ADN genomic repetitiv și genele cu număr variabil de copii în
caracteristic, de dimensiuni mari, ar putea avea trei până la
populație sunt predispuse, ocazional, la un crossing-over cinci segmente de origine paternă și maternă alternativ, așa
inegal în timpul meiozei, producând variații ale unor carac­ cum reiese din variantele de secvență ADN care diferențiază
tere clinic relevante (cum ar fi răspunsul la medicamente), în genomurile parentale respective (Fig. 2-15).
boli frecvente (cum ar fi talasemia sau autismul) sau în anoma­ După telofaza meiozei I, cele două celule fiice haploide
lii ale diferențierii sexuale (vezi Capitolele 6, 8 și 11).
Deși recombinarea omoloagă este un proces normal și
intră în interfaza meiotică. Contrar a ceea ce se întâmplă în
esențial al meiozei, ea se produce, mai rar, și în celulele mitoză, această interfază este scurtă și începe curând meioza
somatice. Anomaliile de recombinare genetică somatică II. Cel mai important aspect care deosebește interfaza
reprezintă una dintre cauzele instabilității genomice în meiotică de cea mitotică este acela că nu mai are loc faza S
cancer (vezi Capitolul 15). (nicio sinteză ADN sau duplicare a genomului) între prima
și a doua diviziune meiotică.
18 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

Meioza II este similară unei mitoze obișnuite, cu excepția


faptului că numărul de cromozomi este 23 în loc de 46; cro­
matidele fiecăruia dintre cei 23 de cromozomi sunt separate
și câte o cromatidă din fiecare cromozom este transferată
celulei fiice (vezi Fig. 2-14). Totuși, așa cum s-a menționat
mai sus, datorită recombinării produse în meioza I, cromo­
zomii gameților rezultați în urma diviziunii meiotice nu sunt Testicul
identici (vezi Fig. 2-15).

GAMETOGENEZA ȘI Spermatogonie
46,XY
FECUNDAREA LA OM
Celulele germinale care suferă meioze (spermatocite primare
și ovocite primare) provin din zigot printr-o serie lungă de
mitoze succesive produse anterior inițierii meiozei. Gameții
masculini și feminini au istorii diferite, caracterizate prin Spermatocit
primar
modele distincte ale expresiei genice care reflectă originea 46,XY
dezvoltării lor ca embrion XY sau XX. Celulele germinale
umane primordiale pot fi recunoscute în a patra săptămână
de dezvoltare în afara embrionului propriu-zis, în endoder­
mul sacului vitelin. De acolo migrează în timpul săptămânii Meioza I
a șasea până la creasta genitală și se asociază cu celule soma­
tice pentru a forma gonadele primitive, care se diferențiază Spermatocite
secundare
ulterior în testicule sau ovare, în funcție de constituția cro­
mozomilor sexuali ai celulelor (XY sau XX), după cum se 23,X 23,Y
prezintă în detaliu în Capitolul 6. Meioza este prezentă atât
în spermatogeneză cât și ovogeneză, dar există diferențe de
Meioza II

detaliu și cronologie care pot avea consecințe clinice și gene­


tice pentru descendenți. Meioza feminină este inițiată doar
o dată, în timpul vieții fetale, într-un număr limitat de celule.
Dimpotrivă, meioza masculină este inițiată continuu, în
numeroase celule provenite dintr-o populație celulară cu
capacitate de diviziune mare, pe tot parcursul vieții adulte a 23,X 23,X 23,Y 23,Y
unui bărbat. Spermatide
Stadiile succesive ale meiozei la femeie se desfășoară în
decurs de câteva decenii – în ovarul fetal chiar înainte de
nașterea femeii respective, în ovocit, când ovulația se apropie
la femeia matură sexual și după fecundarea din oul care
poate deveni descendentul acelei femei. Deși etapele post-
fertilizare pot fi studiate in vitro, accesul la stadiile incipiente
este limitat. Materialul testicular pentru studiul meiozei
masculine este mai ușor de obținut, deoarece evaluarea
multor bărbați care vizitează clinicile de infertilitate include
biopsia testiculară. Rămân multe de învățat despre mecanis­
mele citogenetice, biochimice și moleculare implicate în
23,X 23,X 23,Y 23,Y
meioza normală, precum și despre cauzele și consecințele
erorilor meiotice.

Spermatogeneza Figura 2-16  Spermatogeneza umană și cele două diviziuni meiotice.


Succesiunea evenimentelor începe la pubertate și durează aproximativ
Etapele spermatogenezei sunt prezentate în Figura 2-16. 64 de zile. Sunt prezentate numărul de cromozomi (46 sau 23) și
Tubii seminiferi ai testiculului sunt căptușiți cu celule ce au constituția cromozomilor de sex (X sau Y) ale fiecărei celule. Vezi Surse
rol de spermatogonii, care se dezvoltă din celulele germinale și mulțumiri.
primordiale printr-o lungă serie de mitoze și se află în dife­
rite stadii de diferențiere. Spermatozoidul se formează
CAPITOLUL 2 — Genomul uman – noțiuni introductive 19

numai după ce a ajuns la maturitatea sexuală. Ultimul tip de


celulă din secvența de dezvoltare este spermatocitul primar,
o celulă germinală diploidă care este supusă meiozei I pentru
a forma două spermatocite secundare haploide. Spermato­ Ovar
citele secundare intră rapid în meioza II și fiecare formează
câte două spermatide, care se diferențiază în spermatozoizi
fără diviziuni ulterioare. La om, întregul proces durează
aproximativ 64 de zile. Numărul mare de spermatozoizi
formați, aproximativ 200 de milioane pe ejaculare și, estima­
tiv, 1012 pe toată durata vieții, necesită câteva sute de mitoze
succesive. Ovocitul primar
După cum s-a menționat deja, meioza normală necesită în folicul
asocierea cromozomilor omologi și recombinarea lor

Meioza I
ulterioară. Autozomii și cromozomii X de la femeie nu
Oprit în profaza I
prezintă, de obicei, dificultăți în acest sens; dar ce se întâmplă până la maturitate
cu cromozomii X și Y în timpul spermatogenezei? Deși cro­ sexuală
mozomii X și Y sunt diferiți și nu sunt omologi în sens strict,
ei au segmente identice, relativ scurte, la capetele brațelor
scurte (Xp și Yp) și, respectiv, brațelor lungi (Xq și Yq) (vezi
Capitolul 6). Împerecherea și crossing-over-ul se produc în Ovocitul secundar
ambele regiuni în timpul meiozei I. Aceste segmente omo­
Fusul de
loa­ge sunt denumite regiuni pseudoautozomale pentru a diviziune meiotic
reda comportamentul lor de împerechere și recombinare
Primul globul polar
similar cu cel al autozomilor, în ciuda faptului că sunt pe
cromozomi sexuali diferiți.

Ovulație
Ovogeneza
Meioza II

În timp ce spermatogeneza nu începe până la pubertate,


ovogeneza începe în timpul dezvoltării fetale feminine
(vezi Fig. 2-17). Ovulele se dezvoltă din ovogonii, celule
ale cortexului ovarian care au provenit din celulele germi­
nale primordiale printr-o serie de aproximativ 20 de mitoze.
Fiecare ovogonie ocupă centrul unui folicul în curs de dez­
voltare. Până în cea de-a treia lună de dezvoltare intrauterină,
ovogoniile embrionilor încep să se dezvolte ca ovocite
primare, cele mai multe dintre ele aflându-se deja în Fecundare
profaza meiozei I. Procesul de ovogeneză nu este sincroni­
zat, astfel încât în ovarul fetal stadiile incipiente și cele târzii
coexistă. Deși la momentul nașterii există mai multe Al doilea globul
mi­lioane de ovocite, cele mai multe dintre ele degenerează; polar
restul rămâne în profaza I (vezi Figura 2-14) timp de
decenii. În cele din urmă, doar aproximativ 400 se Spermatozoid
maturează fiind expulzate la ovulație, în timpul ciclului
menstrual feminin.
După ce o femeie ajunge la maturitate sexuală, fiecare
folicul crește și se maturează, iar câteva ovocite sunt expul­
zate la ovulație (în medie, una în fiecare lună). Fiecare Ovulul matur
ovocit completează meioza I cu rapiditate, înainte de
ovulație, divizându-se astfel încât o celulă devine ovocitul Figura 2-17  Ovogeneza și fecundarea umană în raport cu cele două
secundar, care conține cea mai mare parte a citoplasmei diviziuni meiotice. Ovocitele primare se formează înainte de naștere
inclusiv organitele sale celulare; cealaltă celulă devine și se opresc în profaza meiozei I timp de decenii, până la începerea
primul corpuscul polar (vezi Fig. 2-17). Meioza II începe pubertății. Un ovocit își completează meioza I când foliculul se
maturează, producând un ovocit secundar și primul globul polar. După
imediat și trece în metafază în timpul ovulației, unde se ovulație, fiecare ovocit își continuă diviziunea cu metafaza meiozei II.
oprește din nou, și este completă numai dacă are loc Meioza II se completează numai dacă are loc fecundarea, rezultând un
fecundarea. ovul maturat fecundat și cel de-al doilea globul polar.
20 THOMPSON & THOMPSON GENETICĂ MEDICALĂ

mutagen observat la specia umană, responsabilă pentru pro­


Fertilizarea
ducerea anomaliilor cromozomiale înregistrate la câteva
În general, fecundarea ovulului se produce în tubul falopian procente de fetuși din totalul sarcinilor recunoscute clinic.
(uterin) în 24 de ore după ovulație. Deși mulți spermatozoizi În cazul sarcinilor care ajung la termen, anomaliile cromo­
pot fi prezenți, penetrarea unică a ovulului declanșează o zomiale sunt una dintre cauzele principale ale defectelor de
serie de evenimente biochimice care, de obicei, împiedică dezvoltare, limitare a creșterii neonatale și a dizabilității
pătrunderea unui alt spermatozoid. Fertilizarea este urmată intelectuale.
de finalizarea meiozei II, cu formarea celui de-al doilea Non-disjuncția mitotică în celulele somatice poate pro­
globul polar (vezi Fig. 2-17). Cromozomii ovulului fecundat duce, de asemenea, boli genetice. Non-disjuncția observată
și ai spermatozoidului formează pronuclei, fiecare dintre cei în stadiile timpurii post-zigotice, fie în embrion, fie în
doi pronuclei fiind înconjurat de o membrană nucleară țesuturile extra-embrionare, cum ar fi placenta, generează un
proprie. Numai după replicarea genomurilor parentale, după mozaicism cromozomial care poate cauza unele patologii,
fecundare, cele două genomuri haploide devin un genom cum ar fi pacienți cu sindrom Down. În plus, segregarea
diploid într-un nucleu comun. Zigotul diploid se divide anormală a cromozomilor în țesuturile cu diviziune rapidă,
mitotic și formează două celule fiice diploide, aceasta fiind cum ar fi celulele colonului, este, adesea, un pas în dez­
prima dintr-o serie de diviziuni celulare care inițiază proce­ voltarea tumorilor anormale cromozomial și, prin urmare,
sul de dezvoltare embrionară (vezi Capitolul 14). evaluarea echilibrului cromozomial și genomic este un test
Deși dezvoltarea începe în momentul concepției, cu for­ important de diagnostic și de prognostic în multe tipuri de
marea zigotului, în medicina clinică stadiul și durata gestației cancer.
sunt în general măsurate prin „vârsta menstruală“, numărând
de la începutul ultimei perioade menstruale a femeii, de BIBLIOGRAFIE GENERALĂ
obicei, aproximativ 14 zile înainte de concepție.
Green ED, Guyer MS, National Human Genome Research Institute: Chart­
ing a course for genomic medicine from base pairs to bedside, Nature
SEMNIFICAȚIA MEDICALĂ A 470:204–213, 2011.
Lander ES: Initial impact of the sequencing of the human genome, Nature
MITOZEI ȘI MEIOZEI 470:187–197, 2011.
Moore KL, Presaud TVN, Torchia MG: The developing human: clinically
Din punct de vedere biologic, mitoza și meioza sunt impor­ oriented embryology, ed 9, Philadelphia, 2013, WB Saunders.
tante deoarece garantează conservarea numărului de cromo­
zomi – și, în acest mod, integritatea genomului – ai unei BIBLIOGRAFIE PENTRU TEME SPECIFICE
celule în succesiunea generațiilor celulare dar și de la o
generație la alta. Importanța medicală a acestor procese are Deininger P: Alu elements: know the SINES, Genome Biol 12:236, 2011.
Frazer KA: Decoding the human genome, Genome Res 22:1599–1601,
la bază erorile de diviziune celulară care pot determina for­ 2012.
marea unui individ sau a unei linii celulare cu un număr International Human Genome Sequencing Consortium: Initial sequencing
anormal de cromozomi și, prin urmare, cu o cantitate and analysis of the human genome, Nature 409:860–921, 2001.
International Human Genome Sequencing Consortium: Finishing the
anormală de material genomic. euchromatic sequence of the human genome, Nature 431:931–945, 2004.
Așa cum vom detalia în Capitolul 5, non-disjuncția meio­ Venter J, Adams M, Myers E, et al: The sequence of the human genome,
tică, în special, în ovogeneză, este cel mai frecvent mecanism Science 291:1304–1351, 2001.

PROBLEME
1. Pentru un anumit locus, o persoană poate avea două alele, A și a. a. La specia umană, la sfârșitul meiozei I, câți cromozomi are
a. Ce alele vor fi prezente în gameții acestei persoane? o celulă? Câte cromatide?
b. Când segregă A și a (1) presupunând că între locus și cen­ b. La sfârșitul meiozei II, câți cromozomi are o celulă? Câte
tromerul cromozomului nu are loc crossing-over-ul? (2) dar cromatide?
dacă între locus și centromer se produce un crossing-over? c. Când se va reface numărul diploid de cromozomi? Când
2. Care este principala cauză a anomaliilor cromozomiale se va reface structura tipică bicromatidică a cromozomului
numerice observate la om? metafazic?
3. Ignorând crossing-over-ul, știut fiind rolul său în creșterea 5. Analizați Figura 2-7 și estimați numărul de gene la un milion
variabilității genetice, calculează probabilitatea ca toți cromo­ de perechi de baze pentru fiecare din cromozomii 1, 13, 18,
zomii tăi să fie transmiși de la bunicul matern sau bunica 19, 21 și 22. Dacă cromozomii 18 și 19 suferă câte o anomalie
maternă. Ai putea fi bărbat sau femeie? cromozomială de dimensiuni egale care dintre acestea ar putea
4. Un cromozom care intră în meioză este alcătuit din două avea un impact clinic mai sever? Dar dacă ne referim la cro­
cromatide surori fiecare dintre acestea fiind formată din câte mozomii 21 și 22?
o singură moleculă ADN.