Sunteți pe pagina 1din 633

U n iv e r s ita te a d e S ta t d e M e d ic in

i F a r m a c i e N. T e s t e m i a n u

L. LSI

BIOCHIMIE
MEDICAL

Chiinu 2007
Universitatea de Stat de Medicin i Farmacie
N. Testemitanu
9

L. L S ll

BIOCHIMIE
MEDICALA
..... 665146
I UNIVERSITATEA OB STAT
I DE MEDICINA l FARMACIE
NICOLAE TESTEMIEANU"
'B IB L IO T EC A

C h i in u 2007
Aprobat de Consiliul metodic central al U.S.M.F. Nicolae Testem ianu

Recenzeni:
I.Vaintraub, ef al laboratorului Biochimia proteinelor de la U.S.M., profesor
universitar, doctor habilitat n biologie
V.Gudumac, ef al laboratorului Biochimie n L..C. de la U.S.M.F. Nicolae
Testemianu, profesor universitar, doctor habilitat n medicin
V.Hotineanu, profesor universitar, doctor habilitat n medicin, Laureat al Premiului
de Stat al RM n domeniul tiinei i Tehnicii, Om Emerit
CUPRINS

Cuprins IV-IX
Cuvnt in a in te..................................................................................................... X

Prefa
- Noiuni generale................................................................................................ 1
-Particularitilemateriei v ii................................................................................... 3

Cap.I. Proteinele.Enzimele
- Structura i funcia biologic a proteinelor.......................................................12
- Structura prim ar............................................................................................. 20
- Structura secundar.......................................................................................... 27
- Structura tridimensional...................................................................................31
- Foldingul. Problema mpachetriispecifice a lanului polipeptidic................... 35
- Peptidele active................................................................................................ 40
- Clasificarea proteinelor.................................................................................... 44
- Holoproteinele..................................................................................................45
- Heteroproteinele.............................................................................................. 48
- Proprietile generale ale proteinelor...............................................................49
- Solubilitatea......................................................................................................49
- Proprietile electrochimice.............................................................................. 50
- Precipitarea i denaturarea proteinelor........................................................... 52
- Metodele de identificare a proteinelor.............................................................54
- Enzimele...........................................................................................................58
- Structura enzimelor........................................................................................... 59
- Specifitatea enzimelor....................................................................................... 61
- Exprimarea activitii enzimatice...................................................................... 6 8
- Enzimele alosterice........................................................................................... 70
- Inhibiia activitii enzimelor.............................................................................. 75
- l7X)cnzimele.............................................................................................................. 81
- Clasificarea enzimelor.......................................................................................83
- Coenzimele....................................................................................................... 87
- Metaloproteinazele..........................................................................................94
Cap.II. Acizii nucleici
- Structura chimic................................................................................................95
- Proprietile fizico-chimice.................................................................................96
- Rolul nucleotidelor..............................................................................................98
- DNA. Structura prim ar....................................................................................98
- Structura secundar.......................................................................................... 100
- Structura teriar.............................................................................................. 102
- Structura R N A ................................................................................................ 107
- Replicarea (biosinteza D N A )......................................................................... 111
- Repararea DNA................................................................................................115
- Particularitile biosintezei DNA la eucariote................................................... 117
- Telomeraza....................................................................................................... 118
- Transcrierea (biosinteza RNA) .....................................................................130
- Particularitile transcrierii la eucariote.............................................................136
- Sinteza DNA pe matricea de R N A ................................................................. 137
- Codul genetic.....................................................................................................139
- Mutaiile............................................................................................................. 142
- Recombinarea genetic (ingineria genetic)..................................................... 145
- Biosinteza proteinelor..................................................................................... 152
- Particularitile biosintezei proteice la eucariote................................................ 161
- Inhibitorii sintezei proteinelor............................................................................. 161
- Reglarea biosintezei proteinelor........................................................................ 163

Cap.III. Bioenergetica
- Aspecte generale............................................................. .................................. 171
- Metabolismul.....................................................................................................174
- Ciclul ..........................................................................................................176
- Mecanismele de reglare ale metabolismului......................................................179
- Decarboxilarea oxidativ a piruvatului.............................................................. 181
- Ciclul Krebs.......................................................................................................185
- Reacii anaplerotice...........................................................................................189
- Reglarea ciclului Krebs..................................................................................... 190
- Patologiile medicale...........................................................................................190
- Oxidarea biologic-respiraia tisular.......................................................... 192
- Lanul respirator................................................................................................ 193
- Caracteristica complexelor lanului respirator................................................ 196
- Inhibitorii lanului respirator.............................................................................. 200
- Generarea radicalilior liberi............................................................................... 201
- Mecanismele fosforilrii oxidative(cuplarea oxidrii cu fosforilarea)...............202
- Decuplanii fosforilrii oxidative........................................................................208
- Bolile mitocondriale...........................................................................................209
- Citopatiile mitocondriale...................................................................................210
- Sistemele-navet de transport al echivalenilor de reducere........................... 211
- Reglarea fosforilrii oxidative......................................... ..................................212
- Oxigenazele. Citocromul P4 5 0 i reaciile de oxido-reducere...........................213

Cap.IV. Glucidele i metabolismul lor


- Structura, proprietile, funciile........................................................................ 214
- Oligozaharidele................................................................................................. 220
- Polizaharidele.................................................................................................... 220
- Homozide..........................................................................................................220
- Heterozide.........................................................................................................222
- Digestia i absorbia glucidelor.....................................................................224
- Transferul intracelular al glucozei......................................................................226
- Reglarea exprimrii i afinitii trasportatorilor pentru glucoz........................ 227
- Patologiile medicale...........................................................................................227
- Glicogenoliza......................................................................................................228
- Glicogenogeneza............................................................................................... 231
- Reglarea proceselor de liz i sintez ale glicogenului......................................231
-i G licoliza........................................................................................................... 235
- Reglarea glicolizei..............................................................................................240
- Patologiile medicale...........................................................................................242
- Cile alternative de degradare a glucozei....................................................244
- HMS i celulele roii ale sngelui....................................................................... 247
- Sinteza acidului glucuronic................................................................................249
- Metabolismul fructozei.......................................................................................251
- Patologiile medicale........................................................................................... 251
- Metabolismul galactozei.................................................................................... 253
- Patologiile medicale...........................................................................................253
- M anoza............................................................................................................. 255
\ Gluconeogeneza.............................................................................................. 255
- Principalele substraturi ale gluconeogenezei.................................................... 257
- Reglarea gluconeogenezei.................................................................................257
- Reglarea nivelului de glucoz n snge..........................................................260
- Insulina.............................................................................................................. 260
- Reglarea secreiei insulinei................................................................................. 262
- Efectul insulinei.................................................................................................. 262
- Patologiile medicale...........................................................................................267
- Glucagonul.........................................................................................................268
- Studiul metabolismului glucidic......................................................................... 268
Cap. V. Lipidele i metabolismul lor
- Structura, proprietile, funciile.......................................................................270
- Acizii grai........................................................................................................ 271
- Proprietile..................................................................................................... 272
- Lipidele sapomfiabile....................................................................................... 273
- Lipidele nesaponifiabile....................................................................................277
- Acizii biliari...................................................................................................... 279
- Membranele biologice..................................................................................... 281
- Sistemele transport.......................................................................................... 292
- Digestia i absorbia lipidelor.......................................................................298
- Lipidelesngelui................................................................................................302
- Lipidele organismului um an............................................................................. 308
- Degradarea oxidativ a acizilor grai......................................................... 311
- Transportul acizilor grai n mitocondrii. Camitina......................................... 312
- Oxidarea acizilor grai n mitocondrii..............................................................314
- Oxidarea acizilor grai cu numr impar de atomi de carbon.......................... 316
- Oxidarea acizilor grai n peroxizomi.............................................................. 318
- Cetogeneza...................................................................................................... 319
- Biosinteza lipidelor........................................................................................322
- Biosintezatriacilglicerolilor.............................................................................. 328
- Biosinteza lipidelor membranare......................................................................329
- Metabolismul colesterolului............................................................................. 336
- Ateroscleroza....................................................................................................341
- Patologia lipidelor.............................................................................................343
- Reglarea metabolismului lipidic........................................................................345
- Eicosanoizii - prostaglandinele........................................................................346

Cap. VI. M etabolismul proteinelor i al aminoacizilor.


M etabolismul nucleotidelor, cromoproteidelor
- Digestia proteinelor alimentare....................................................................351
- Absorbia aminoacizilor...................................................................................356
- Fondul metabolic comun al aminoacizilor. Valoarea biologic a proteinelor ..358
- Asimilarea aminoacizilor..................................................................................360
- Metabolizarea NH 2 -grupelor. Dezaminarea................................................... 362
- Decarboxilareaaminoacizilor..........................................................................366
- Soarta amoniacului.......................................................................................... 368
- Utilizarea scheletului de carbon al aminoacizilor..................................... 373
- Familia aminoacizilor cu C3 ............................................................................. 376
- Metabolismul aminoacizilor ce conin s u lf.......................................................378
- Familia aminoacizilor cu C4 ............................................................................. 383
- Familia aminoacizilor cu C5 ............................................................................. 385
- Metabolismul aminoacizilor ramificai............................................................. 388
- Metabolizarea fenilalaninei i tirozinei............................................................. 389
- Metabolismul triptofanului................................................................................394
- Metabolismul lizinei......................................................................................... 396
- Sinteza creatinei............................................................................................... 397
- Biosinteza aminoacizilor................................................................................399
- Reglarea sintezei aminoacizilor........................................................................ 404
- Metabolismul nucleotidelor..........................................................................
- Digestia i absorbia nucleotidelor...................................................................406
- Biosinteza nucleotidelor purinice.....................................................................406
- Reutilizarea purinelor....................................................................................... 410
- Reglarea biosintezei......................................................................................... 410
- Catabolismul purinelor..................................................................................... 410
- Patologia metabolismului purinelor..................................................................413
- Metabolismul nucleotidelor pirimidinice.......................................................... 415
- Biosinteza nucleotidelor pirimidinice............................................................... 415
- Reglarea metabolismului pirimidinic................................................................ 419
- Reutilizarea i catabolismul nucleotidelor pirimidinice.................................... 419
- Metabolismul cromoproteidelor. Structura hemoglobinei.........................421
- Hemoglobina. Funciile....................................................................................424
- Patologia molecular a hemoglobinei.............................................................. 42 8
- Sinteza hemului................................................................................................. 430
- Degradarea hemului..........................................................................................431
- Rolulficatului n metabolism........................................................................ 433
- Patologia biochimic a ficatului........................................................................ 438

Cap. VII. Sistem ul horm onal Vitaminele


- Noiuni generale.............................................................................................. 441
- Proprietile comune ale hormonilor............................................................... 444
- Metabolismul molecular al aciunii hormonilor. Mesagerii secunzi..................449
- Sistemul neuroendocrin.................................................................................... 462
- Neurohipofiza.................................................................................................. 464
- Adenohipofiza.................................................................................................. 465
- Glandele paratiroide........................................................................................ 470
- Hormonii tiroidieni............................................................................................ 471
- Hormonii corticosuprarenalieni........................................................................ 475
- Hormonii medulosuprarenalieni....................................................................... 482
- Honnonii sexuali-testiculari............................................................................. 486
- Hormonii ovarieni............................................................................................ 487
- Controlul endocrin al foliculogenezei.............................................................. 488
- Vitaminele. Generaliti.................................................................................... 491
- Vitaminele hidrosolubile...................................................................................495
- Vitaminele liposolubile.......................... ,......................................................... 510
Cap. VIII. Biochimici sngelui i a unor esuturi
- Sngele............................................................................................................. 523
- Funciile. Proprietii le fizico-chimice.............................................................. 524
- Proteinele plasmatice....................................................................................... 526
- Elementele figurate - particularitile compoziiei i ale metabolismului
- Particularitile compoziiei chimice i ale metabolismului eritrocitului..........529
- Particularitile compoziiei i ale metabolismului leucocitelor....................... 535
- Caracteristica biochimic a monocitului..........................................................540
- Caracteristica biochimic a limfocitelor........................................................... 541
- Particularitile compoziiei chimice a trombocitului.......................................541
- Constituenii minerali ai plasm ei.................................................................
- Cationii............................................................................................................. 544
- Anionii.............................................................................................................. 546
- Oligoelementele................................................................................................547
- Componentele organice...................................................................................549
- Substane organice neazotate...........................................................................551
- Enzimele plasmatice......................................................................................... 553
- Sistemele tampon sanguine............................................................................. 554
- Hemostazai fibrinoliza. C oagularea....................................................... 557
- Caracteristicile principalilor factori ai coagulrii..............................................558
- Proprietiile structurale i funcionale ale factorilor sistemului de contact...561
- Fibrinoliza.........................................................................................................566
- Reglareahemostazei........................................................................................ 567
- Biochitnia esutului conjunctiv
- Colagenul.........................................................................................................571
- Biosinteza colagenului...................................................................................... 575
- Elastina.............................................................................................................577
- Proteoglicanii................................................................................................... 578
- Modificrile constituenilor proteoglicanilor.................................................... 583
- Biochimia rspunsului im u n .........................................................................584
- Structura anticorpilor....................................................................................... 592
- Sistemul complement....................................................................................... 594
- T-Iimfocitele i imunitatea celular.................................................................. 596
- Reaciile la transplant....................................................................................... 598
- Rspunsul imun la infecia viral......................................................................560

- Bibliografie selectiv.....................................................................................605
- Index................................................................................................................ 606
Publicarea manualului Biochimie medical costituie o iniiativ meritorie a
profesorului universitar Leonid Lsi, ef catedr biochimie i biochimie clinic, USMF
N.Testemianu, care a extins coninutul cu date relevante n aspect teoretic i aplicativ.
O reediie a manualului precedent, primul manual consacrat biochimiei, e destul de
bine venit pentru coala naional. Biochimia, ca produs al gndirii laborioase i al ateniei
permanente a majoritii savanilor, are n ultimii anii un succes deosebit.
Materialul redat e compact aranjat i ilustreaz esena contemporan a tiinei date.
Progresul n medicin nu poate fi conceput fr o argumentare tiinific, de natur
biochimic, la diferite niveluri. Implicareabiochimici n specificul medical att n explicarea
strilor normale, ct i patologice reclama imperios cunoaterea reaciilor moleculare,
enzimelor specifice, ciclurilor tipice ale metabolismului, care au loc n toate celulele umane,
n fiecare capitol sunt ilustrate compartmentele de baz ale biochimiei modeme, cu adaosul
concis al realizrilor din ultimii ani. Coninutului e mult apropiat de medicina practica -
sunt expuse valorile normale ale majoritii indicilor biochimici ce se utilizeaz n
diagnosticul i pronosticul maladiilor. O importan deosebit are redarea mecanismelor
fine de reglare a metabolismului de ctre diferii factori (hormoni, ioni, vitamine,
medicamente) la diverse niveluri de organizare a materiei vii.
Autorul i-a asumat o responsabilitate distins de a prezenta acest material vast,
profund tiinific, ntr-un volum modest, strict necesar pentru nelegerea i dezvoltarea
capacitilor intelectuale ale viitorului medic.
Manualul prezint o baz tiinific pentru viitorii savani i/sau medici practicieni,
care doresc s ating culmile tiinei moderne, s-i consolideze i s-i completeze
nivelul cunotinelor n domeniul medicinii.

leremia ZOTA
d.h.m., profesor universitar,
Laureat al Premiului de Stat al RM
n domeniul tiinei i Tehnicii,
Om Emerit, membru corespondent a AM
CUVNT NAINTE

Prezentarea manual de biochimie este o ncercare deosebit de dificil la momentul


actual, cauzat de avalanele de infomiaie ce se succed rapid n acest domeniu. Biochimia
nu mai reprezint o enumerare simpl a proceselor biologice i reaciilor fermentative ce
decurg cu participarea unui numr enorm de compui organici.
Evaluarea accelerat a cunotinelor n biochimie, mai ales n ultimul deceniu, precum
i importana tiinei date pentru nelegerea bazelor moleculare ale fenomenelor fiziologice,
patologice i terapeutice impune ca aceast disciplin s ia o poziie privilegiat n cadrul
nvmntului medical, farmaceutic, biologic etc.
Aplicaiile practice ale biochimiei sunt att de imediate n genetic, medicin,
nutriie i n alte domenii de activitate, nct progresul lor nu poate fi conceput far
o argumentaie tiinific de natur biochimic. Aspectul practic farmaceutic este
imprimat de faptul c sunt prezentate substanele biologic active, iar medicamente
le valoroase de origine biologic fac parte din categoria enzimelor, vitaminelor,
hormonilor, aminoacizilor, acizilor grai eseniali etc.
Conform prevederilor programei analitice sunt abordate problemele cardinale
ale cursului disciplinar tratat n opt capitole. Materialul e destinat s contribuie la nelegerea
de ctre studenii n medicin a bazelor moleculare, care asigur funcia i structura
morfologic a organelor i esuturilor din organismul uman. Implicaiile biochimiei n toate
specialitile medicale la explicarea strii normale i patologice, reclam cunoaterea
reaciilor moleculare din ciclurile stereotipe ale metabolismului care se desfoar n
toate celulele din organism.
Voi accepta toate sugestiile i observaiile referitoare la coninutul acestei lucrri.
Am avut ocazia deosebit s fac studiile n Universitatea de Stat de Medicin i
Farmacie N. Testemianu, s fiu discipolul acelor dascli care au stat la temelia ei. Sunt
recunosctor colegilor cu care permanent colaborez n activitatea pedagogic i tiinific
pentru ajutorul acordat, susinere i conlucrare benefic.
nchin aceast carte studenilor care sunt sperana acestui popor, fundamentul spiritual
al neamului, devenind dup o munc enorm, savani ce vor proslvi acest pmnt.

Autorul
PREFA
9

Editarea crii Biochimie medical aflat la a doua ediie are o conotaie deosebit.
Progresele acestei tiine sunt uimitoare, capabile s explice, prin modificri la nivel
molecular i atomar, cele mai dificile comportri ale materiei vii.
La dispoziia studenilor medici se pune un vast volum de cunotine ce corespund
cerinelor actuale, demne de atenia celor ce studiaz viaa. Sunt redate detalii tiinifice
de interes biochimic i medical, sunt expuse diverse aspecte de genetic medical.
Studenilor le sunt oferite aceste date tiinifice pentru -i ajuta s-i pun un fundament
puternic n studiul medicinii contemporane.
Manualul de biochimie medical utilizat de studeni trebuie s asigure realizarea
urmtoarelor deziderate:
a) asimilarea cunotinelor tiinifice despre fenomenele studiate n disciplinile inrudite
preclinice (fiziologie, fiziopatologie, farmacologie);
b) stimularea interesului pentru studierea i nelegerea proceselor fiziologice i
patologice predate n cursul clinic medical;
c) integrarea tiinific n variata cazuistic medical ntlnit n studiul disciplinelor
clinice care poate fi neleas numai dac se va realiza n baza noiunilor i cunotinilor
acumulate n anii precedeni.
Cunoaterea proceselor biochimice fundamentale i bazate pe elucidarea acestor
mecanisme, utilizarea unor teste de diagnostic - acesta e viitorul apropiat pentru diferitele
domenii ale medicinii practice.
Cele reprezentate pot fi i un imbold pentru viitorii savani, care i vor nchina viaa
studiului fascinantelor compartimente ale biochimiei modeme i medicinii.
Exprim cordiale mulumiri tuturor celor care au favorizat realizarea acestui volum, i
ndeosebi colaboratorilor pentru amabilitate i receptivitate.
i m gndesc la studenii care, studiind acest material i descoperind tainele vieii,
vor contientiza c s-a depus un efort considerabil pentru viitorul. M ncred n tinerii, de
azi specialiti redutabili de mine, care vor fauri un viitor demn de naintaii notri.

A u to ru l
NOIUNI
5 GENERALE
Cluzit de relevrile spirituale i practice, omul a depus i depune ncontinuu eforturi
dea ptrunde sensul vieii. La diferite etape de dezvoltare a gndirii el a desprins cele
mai fine legiti ale existenei materiei vii. Anticii nu ncetau s se minuneze de frumuseea
i misterele naturii fiinelor vii, remarend noi i noi fenomene, exprimri ale perfeciunii
ei, dar nu erau n stare s explice esena i armonia lumii nconjurtoare. Marele
adevr era interpretat c Mntuitorul a creat aceast lume.
Calea de acumulare a cunotinelor a fost lung i complicat. Aspectul tiinific i
croia drumul prin scolastica i metafizica materialitilor din epoca timpurie. Descoperirea
lui C. Darwin a contribuit la desctuarea spiritului uman. In baza unor date modeste i
a analizei profunde n domeniul paleontologiei, el formuleaz cea mai vast i universal
concepie n biologie - evoluia biologic continu.
Studiile savanilor din jumtatea a doua a secolului XIX sunt inspirate de aceas
t concepie. Dezvoltarea impetuoas a chimiei organice, anorganice i fizice a
permis i cercetarea unor sisteme vii - crete i numrul compuilor extrai din
organismele vii.
Complexitatea obiectelor materiale a condus la diferenierea cercetrilor tiin
ifice. Emil Fisher a determinat structura multor glucide, a elaborat metode de
extragere a aminoacizilor din hidrolizate proteice, a stabilit configuraiile optice
ale aminoacizilor i glucidelor, a demonstrat specificitatea aciunii enzimelor. Aceste
studii au stat la baza biochimiei.
Termenul biochimie a fost aplicat pentru prima dat n 1903 de ctre Cari Neiberg.
Astfel, pornind de la pilonii chimiei organice i fiziologiei noua tiin s-a structurat n mai
multe aspecte: enzimologie, imunologie, genetic, etc - net astzi optica cercetrilor
eclipseaz oportuniti din cele mai strigente ale problemelor actuale.
Ce reprezint azi biochimia modern?
1. Savanii, n calitate de criteriu, n investigaiile lor iau n considerare mrimea
particulelor studiate. Biochimiei i corespunde aranjamentul atomilor n molecul, adic
la nivel molecular. Bios n limba greac nseamn via. Prin urmare, biochimia este
tiina care studiaz bazele molcculare ale vieii.
2. Compuii organici simpli, constituentele organismelor aparin doar lumii vii i
sunt produse ale activitii biologice. Aceti compui sunt numii biom olecule i
au rol funcional de a servi drept blocuri de construcii n formarea structurilor biologice.
Ele au fost selectate evolutiv datorit capacitii de a ndeplini funcii strict determinate n
celulele vii. n toate organismele vii aceti compui sunt similari, interdependeni, care
interacioneaz, particip la procesele de transfer al energiei i ale transformrilor de
substane. Prin unnare, aceste biomolecule pot fi caracterizate din dou puncte de vedere:
chimic i biologic, ceea ce denot c biochim ia este o superchimie a materiei
organizat perfect, fapt ce ofer largi posibiliti n studiul tainelor organismelor
vii, o chimic a celei mai perfect organizate materii.
Biochimia este una dintre sferele tiinifice cele mai atrgtoare n aplicarea raiunii
umane, a talentului i forelor creatoare ale tineretului. Ea nregistreaz succese
remarcabile i o evoluie continu.
n ce rezid succesul acestei tiine?
1. Biochimia a reuit s elucideze bazele chimice ale unui ir de probleme referitoare
la structurile biomoleculelor i proceselor metabolice ca: dublul helix al DNA, codul
genetic, structura tridimensional a unor proteine, cile generale ale metabolismului.
2. Datorit biochimiei au fost determinate cile generale de transformare a molecule
lor i a principiilor ce stau la baza diferitelor forme de exprimare a vieii. Omul i
bacteriile au mult n comun la nivel molecular - aceleai blocuri de construcii pentru
formarea macromoleculelor, identitatea transmiterii infomiaiei genetice de la DNA *-
RNA protein, iar ATP, valuta energetic, este folosit n ambele cazuri.
3. Biochimia are o influen tot mai surprinztoare asupra medicinei, mai ales n stabilirea
diagnosticului clinic n baza activitatii enzimelor. Coninutul (prezena) unor enzime n
serul sanguin poate servi drept criteriu determinant al diagnosticului infarctului miocardic,
hepatitelor etc. Anume biochimia este suportul medicaiei. O importan deosebit o
are elucidarea mecanismelor moleculare ce stau la baza unor afeciuni ereditare, a
anomaliilor metabolismului.
Biochimia are o vast aplicare, fiind destinat att studenilor, medicilor, biologilor,
chimitilor, ct i oricrui om inteligent. Puini contientizeaz c un termen, azi simplu
pn la banalitate, conine un revers - munca titanic a multor savani, unii dintre care au
fost distini cu premiul Nobel.
4. Evoluia rapid a biochimiei le-a permis savanilor s cerceteze probleme cmciale
n biologie, medicin, cum ar fi: diferenierea celulelor i reglarea creterii lor, determinarea
rolului celulelor la formarea organismului, la dezvoltarea mecanismului memoriei, n
determinarea cauzelor cancerului i schizofreniei etc. Deocamdat rspunsuri complete
la multe ntrebri nu avem, dar un lucru e cert - toate aceste probleme sunt determinate
de factorii moleculari ce se modific continuu.

C h a rles D arw in E m il F ish er


1809 - 1882 1852 - 1919
PARTICULARITILE MATERIEI VII
Constituenii materiei vii sunt compui din moleculele materiei moarte. Ele n parte, se
supun legilor ce caracterizeaz comportarea obiectelor inanimate, cu toate c ntrunesc
caliti neordinare. Cea mai concludent particularitate este complexitatea i gradul nalt
de organizare ce se caracterizeaz prin structura intern compus i diversitatea de
molecule. Organismele vii sunt reprezentate prin milioane de specii. O alt particularitate
const n faptul c orice parte component i are sensul su specific i ndeplinete
ofuncie strict determinat. Aceasta se refer nu numai la structurile macroscopice,
dar i la structurile intracelulare microscopice, cum ar fi nucleul. Structurile acestea sunt
nzestrate cu funcii speciale i compui ce se conin n celul - proteine, lipide. A treia
particularitate care ne apropie de sensul proceselor vitale const n faptul c organismele
vii sunt capabile s extrag, s transforme i s utilizeze energia mediului ambiant
fie sub form a compuilor organici nutritivi, fie sub form a energiei solare. Ultima
particularitate permite organismelor s-i generez sursa lor proprie de energie i s-i
asigure integritatea. Pe contul acestei energii se efectueaz lucrul mecanic, se realizeaz
transferul membranar al substanelor. Organismele vii niciodat nu se afl n stare de
echilibru n ceea ce privete procesele declanate de organismul propriu-zis, precum i
n interaciunea cu mediul ambiant. Dar cea mai surprinztoare particularitate a organismului
este capacitatea de a se reproduce, a se nmuli, a se procrea, nsuire ce poate f i
considerat drept chintesena lui.
Este evident c organismele vii sunt compuse din aceleai molecule, dar care ar fi
totui cauza c materia vie se deosebete radical de cea moart?
De ce organismul viu este ceva mai mult dect totalitatea componenilor
avitali? Anume aceasta este problema principal ce relev sensul biochimiei. Scopul
final al tiinei biochimia rezid n perceperea enigmelor vieii sub toate formele
ei. i, ca rezultat, avem nevoie de un student, viitor medic specialist care s nu fie doar
un dicionar al tennenilor biochimiei, dar i apt s aprecieze critic i constructiv datele
experimentale pe care se bazeaz cunotinele noastre despre procesele vitale.
n studiul disciplinei deosebim trei compartimente:
1. Biochimia static - studiaz n exclusivitate analiza, componena chimic a
organismelor.
2. Biochimia dinamic - elucideaz complexitatea modificrilor de substane n
organism.
3. Biochimia funcional - cerceteaz procesele chimice ce stau la baza diferite
lor manifestri ale vitalitii.
Biochimia este o tiin experimental, succesul creia e legat indispensabil de
capacitatea de a experimenta, bazat pe cunotinele modeme, utiliznd o
tehnic avansat de laborator, precum i de sinteza datelor nregistrate, o interpretare i
analiz veridic a explorrilor efectuate.
n ierarhia structural a milioanelor de proteine diferite, de exemplu, deosebim, mai
multe niveluri de organizare: atomar, molecular, celular. Pentru activitatea organului
respectiv e caracteristic nivelul corespunztor, iar pentru organismul integru - forma
superioar de organizare a materiei vii.
Cea mai important direcie n dezvoltarea biochimiei contemporane e studierea
proceselor biochimice la nivelul molecular. Viteza acestor procese e determinat de
diveri factori ca: concentraia ingredienilor, pH, bariera energetic, activitatea fermenilor
respectivi, prezena activatorilor i inhibitorilor. Interaciunea dintre aceti factori se
efectueaza n mod diferit, cu o reflecie indispensabil n procesele reglatoare la diferite
niveluri.
N ivelu l IV: N ivelu l III: N ivelul II: N ivelu l I:

Complexele
Celula i organitele supramoleculare Macromoleculele Uniti monomerice

Ierarhia structural n organizaia molecular a celulelor

Un alt important nivel de studiu este cel multienzimatic, viznd proteinele specifice
reglatoare, ce intr n componena endo- i exomembranelor.
Compartimentele intracelulare se caracterizeaz prin prezena unor procese bio
chimice dominante. Aceste structuri se deosebesc nu numai morfologic i citochimic, dar
i biochimic. Anume la acest nivel are loc compartimentalizarea i specificarea proceselor
biochimice. Ca obiect pentru studiul metabolismului energetic servesc mitocondriile, iar
procesele biosintetice sunt concentrate n ribozomi i fraciunile citoplasmatice.
La nivelul celular are loc o interaciune ntre procesele biochimice n diferite structuri
intracelulare, cu integrarea lor. La acelai nivel, datorit prezenei n celule a diferitelor
mecanisme reglatoare, se evideniaz o aciune specific evident a substanelor biologice
active: hormoni, mediatori, oligopeptide, stimuleni i inhibitori. Acionnd asupra sistemelor
polienzimatice, apariia mecanismelor reglatorii condiioneaz un echilibru dinamic al
proceselor biochimice i de aceea celula intact e n stare de homeostazie. W.Canon
propune acest termen n 1929 pentru detenninarea constantei mediului intern - condiie
indispensabil pentru existena organismelor vii. Acest echilibru e circumstana primordial
a proceselor de autoasamblare, autoorganizare i autoreglare, ce determin funciile
biologice cardinale: creterea, nmulirea, mitoza i diferenierea celulelor. Starea de ho-
meostazie se pstreaz nu numai n condiii normale, dar i la aciunea diferitor factori
nocivi asupra organismului i, de asemenea, n stri de stres. n aceste condiii
homeostazia e determinat de prezena n organism a sistemelor complexe reglatoare
coordonate de mecanisme adaptive.
Studierea profund i vast a proceselor biochimice ce determin meninerea
homeostaziei, graie mecanismelor de adaptaie, e o problem actual a biochimiei
funcionale. Aceste investigaii determin esena proceselor chimice ce stau la baza
funciilor fiziologice i pot preciza mecanismele reglatorii ce delimiteaz homeostazia n
stri extremale. Aceasta e o problem ce prezint att interes teoretic, ct i practic.
n ultimii 30-40 de ani n studiile biochimice au aprut modificri radicale datorit
utilizrii metodelor moderne de cercetare. A crescut considerabil sensibilitatea i
exactitatea aprecierilor cantitative ale diferitor metabolii n structurile biologice.
Datorit spectroscopiei infraroii se poate studia caracterul structural al molecu
lei, e posibil determinarea diferitor compui strini n microcantiti. Perfecionarea
metodei cromatografice - n straturi subiri - a permis extragerea metaboliilor
individuali din esut chiar i atunci, cnd ei sunt n cantiti minime. O caracteristic
deosebit o au metodele imunochimice care au favorizat i au justificat identificarea
proteinelor individuale, secvena aminoacizilor n lan.
Un rol deosebit aparine metodei de depistare radioactiv, metod care faciliteaz
studierea metabolismului plastic i energetic n condiii adecvate organismului intact.
O rspndire larg o are metoda de nregistrare a izotopilor (scintigrafia) ce ne
permite examinarea perfect a proceselor metabolice la toate nivelurile sistemelor vii. La
baza ei se afl procesul de transformare a energiei particulelor primare radioactive n
energia radiaiei electromagnetice cu lungimea de und 430 nm. Transformarea energiei
este efectuat de scintilator (lichid-pentru -particule i cristal - pentru Y-particule).
Absorbind energia particulelor radioactive, scintilatorul elimin fotoni ce se nregistreaz
pe amplificatorul fotoelectronic.
Incontestabil c succesul biochimiei depinde de realizrile vdite n tiinele nrudite
precum sunt: bioorganica, anorganica, chimia analitic, fizic i coloidal, biologia, fizica
i chiar matematica.
Rolul biochimiei pentru medicin e de netgduit, ca argument servesc doar cuvintele
lui M.V. Lomonosov: Medicul - fr cunotine suficiente n chimie - nu poate fi competent
n materie.
Foarte accelerat se dezvolt biochimia clinic, care studiaz modificrile procese
lor biochimice n organismul uman n diferite patologii i, concomitent, elaborndu-se
metodele depistrii anumitelor devieri cu scopul de a diagnostica i a pronostica evoluia
strilor morbide. n ultimii 1 0 ani, numrul analizelor chimice la un bolnav a crescut n
medie de 4 ori. E necesar de menionat c descrierea datelor de laborator este direct
dependent de gradul i nivelul de instruire a medicului.
Compuii chimici n organismele vii sunt compleci i variai dup structura lor i
sunt supui modificrilor permanente. Masa unor molecule e de milioane de Da (daltoni).
Modificrile conformaionale ale macromoleculelor biologice au loc foarte repede.
Pentru despletirea unei spirale de DNA, util pentru replicare i expresie, e necesar
numai o milisecund.Modificarea poziional a unui domen de protein fa de altul
e de o nanosecund, iar fenomenul de senzaie optic - modificri structurale ale
grupelor luminoabsorbante - are loc n cteva picosecunde.
Pentru a percepe mai profund structura i funciile proteinelor, e necesar s ne amintim
de unele proprieti ale biomoleculelor. Organisme le vii conin n cantiti mai mari 4
elemente: H, , si N. Dac excludem H ,0 , creia i revine 75% din greutate, apoi
90% din masa rezidual Ie revine acestor patru elemente. Din masa total uscat
carbonului i revin 50-60%, oxigenului - 25-30%, azotului - 8 -10% i hidrogenului - 3-
4% .
1. Particularitile chimice deosebite ale organismelor vii constau n prezena
carbonului. El, la fel ca i oxigenul, hidrogenul, azotul, poate fonna legturi covalente,
adic legturi determinate de perechi de electroni aparinnd ambilor atomi.

I I - -- I
: - >

: N : N - : -
I I ' I

Atomii participani la formarea acestor legturi covalente pretind s-i asigure


complexitatea cercurilor externe de electroni. Fiecare pereche de electroni corespunde
unei legturi ordinare.
n biologie o importan prim ordiala o are capacitatea carbonului (C) de a
diviza perechile electronice, acestea adernd la ali atomi de C, fapt ce duce la
formarea unor legturi ordinare foarte stabile. n plus, 2 atomi de se pot mbina
ntre ei, conjugnd 2 perechi de electroni. Astfel se formeaz o legtur dubl.

::
I c ::0 : C = 0
C :
'N: -C=N -
I
Varietatea substanelor are ca schelet atomi de carbon, ce formeaz legturi covalente,
practic infinite: liniare, ciclice, ramurale, structuri combinate etc.
Cele 4 legturi covalente ordinare ale carbonului n spaiu se configureaz n tetraedru,
iar mrimea unghiului dintre 2 legturi indiferente e de 109,5. n moleculele unor substane
acest unghi poate s se modifice puin. Datorit acestei proprieti, com puii
carbonului formeaz diferite structuri tridimensionale. Nici un alt element chimic
nu poate forma molecule att de diferite dup mrime i form, dup complexitatea
lanului periferic i a grupelor funcionale.
2. A doua proprietate de baz a compuilor organici const n faptul c particulele
moleculare sunt capabile, absolut liber, s se roteasc n jurul legturilor C-C ordinare,
'-""-Na V>
Unghiul dintre dou legturi Legtur ordinar Legtur dubl
(a> <b) (c)
Geometria legturilor carbonului
numai dac la atomii de carbon, care iau parte la formarea acestei legturi, nu sunt
ataate grupe foarte mari sau au o sarcin electric mare. n ultimele cazuri rotaia poate
fi limitat. Aadar, moleculele organice cu un numr mare de legturi ordinare pot avea
diferite forme numite conformaii, ce depind de unghiul de rotaie al acestei legturi.
3. A treia proprietate a legturilor covalente fonnate de carbon const n faptul c ele
au o anumit lungime. n medie, lungimea legturilor ordinare e de 0,154 nm; cele
duble sunt mai scurte i, respectiv, egale cu 0,124 nm. Ultimele au o duritate mai mare i
nu permit rotaia liber. Datorit acestei legturi din molecul unghiurile ntre moleculele
ordinare se mresc.
Structura tridimensional (conformaia) a biomoleculelor organice joac un rol
important n multe procese biochimice, dar mai ales n interaciunea centrului catalitic al
enzimelor cu substraturile. Pentru efectuarea funciilor biologice normale molecula
enzimelor i a substraturilor trebuie s fie complementar, adic trebuie neaprat s
coincid. Astfel de complementare strict e necesar pentru fixarea moleculei de hormon
la receptorul su pe suprafaa celulei, pentru procesul de replicare a DNA .a.
Poziia legturilor ordinare n tetraedru atribuie unor compui organici nc o
proprietate deosebit, cu o repercusiune primordial n biologie. S ne amintim c unul
sau mai muli atomi de hidrogen pot fi nlocuii cu diferite grupe funcionale, care
sunt reactibile i pot modifica repartizarea electronilor i poziia electronilor nvecinai,
modificnd astfel i reactibilitatea ntregii molecule. Majoritatea biomoleculelor conin
grupe funcionale de diferite tipuri i de aceea posed diferite insuiri polifuncionale,
determinnd i activitatea biologic.
R -C H 3
M etilic R -C ( R N H C N H 2 R j -R2
II
Carboxil^^ GuanidinicNH O
R NH2 C arbonilic
A min R C O R, R C _ C H R , S R2
R SH O Estcric
I I
HN -N
Tio
* 0
O
T ioesteric
R -O H R -C Im idazolic
\H OH
H idroxil A ldchidic I
R C NH2
R O P = 0
R - O - R , R_ s _ s R, II
O I
E teric D isulfidic A m idic F osforic O H
Unele grupe funcionale n biomolecule
ntotdeauna, cnd n molecula compuilor organici atomul de carbon e legat cu 4
atomi sau grupe funcionale diferite, se spune c acest atom e asimetric, deoarece el
poate funciona n dou forme izomerice, dcosebindu-se printr-o configuraie spaial
proprie - enantiomerii (stereoizomeri sau izomeri optici). n reaciile chimice izomerii
se comport n acelai mod, dar se deosebesc dup o proprietate fizic, i anume - dup
capacitatea de a roti planul luminii polarizate n stnga sau n dreapta.
Deoarece astfel de compui cu atomi de carbon se atest n dou forme, au fost
numii compui chiralici (chiros-din greac - mn).
Atomul central asimetric din aceti compui e numit atom chiralic sau centru chiralic.
n organismele vii moleculele chiralice se afl numai n una din cele dou forme posibile,
cauza fiind structura hiralic a moleculelor enzimelor.

lai Molecul chiral <> Molecul achiral


Imaginea }
n oglind A

n sistemele biologice e foarte rspndit i un alt tip de legtur - cea de hidrogen,


care uor se formeaz ntre atomul electronegativ (O i N) i atomul de hidrogen (H)
legat covalent cu un alt atom electronegativ n aceeai sau alt molecul. Atomii de
hidrogen n asemenea condiii comport ncrcturi parial pozitive, apropiindu-se de
interaciunea electrostatic. Legturile acestea sunt mai slabe dect cele covalente. Una
din particularitile lor este duritatea maxim n condiiile ncarc orientarea reciproc a
moleculelor legate determin o energie maxim a interaciunii electrostatice. Legtura
dat este determinat de o anumit direcie i datorit ei e apt s rein ambele
molecule sau grupe ntr-o orientare reciproc, determinnd complementaritatea
suprafeelor moleculelor activate. Aceste legturi servesc drept orientare, ce creeaz un
contact perfect dintre suprafeele moleculare.

O H 0=C< O H 0=
o H.. N = = N H....... N =
Legturi de hidrogen
La distane reduse acioneaz forele lui Van der Waals ce sunt determinate de
atracia electrostatic a electronilor cu sarcin negativa de ctre un atom de nucleu ncrcat
pozitiv al altui atom.
Atracia ntre grupele electrizate detenninforele electrostatice i apare ntre sarcinile
de for mare care se afl n apropiere, modificnd conformaia moleculelor (COO i
NH,+), (COO i CaTT). Acest tip de legtur dipol-dipol este caracteristic moleculelor
polare care, ajunse n contact, se influeneaz reciproc datorit efectelor electrostatice.
Moleculele polare sub raport structural pot fi identice sau diferite. Dispunerea acestor
molecule n spaiu se face ordonat cu polii de semn contrar proximitate reciproc.

Interaciuni dipol-dipol

Datorit forelor de atracie electrostatice la substanele cu molecule polare tempera


turile de topire i fierbere sunt mai ridicate comparativ cu substanele cu molecule ana-
loage, dar nepolare. Hidratarea ionilor influeneaz simitor interaciunea electrostatic,
fiindc fiecare ion n ap e nconjurat cu un strat de molecule de ap, orientat ntr-un fel
anumit i determinat de atracia dipolilor de ap la ionul ncrcat. Legturile ion-dipol
se afl n sisitemele n care mediul este format din molecule polare. n aceste sisteme se
produce orientarea dipolilor moleculelor polare n jurul ionilor.

Interaciuni ion-dipol

Fenomenul acesta este denumit solvatare, iar n cazul n care moleculele polare aparin
apei este numit hidratare.
Distingem ifore (legturi) hidrofobe, ceea ce denot agregaia grupelor nepolare.
Procesul poate fi explicat ca un transfer al particulelor nepolare ale moleculei de ap n
poriunea hidrofob.Un rol deosebit l joac n acest proces capacitatea pronunat a
moleculelor de ap de a se lega ntre ele.Un efect incontestabil al aciunii acestor fore se
manifest prin creterea vdit a structurii apei-limitarea fluiditii moleculelor de ap.
De interaciunea hidrofob depinde i aa-numita interaciune Stacking (fore de
instivuire), care apare ntre perechile de baze azotate aranjate n stive la distana razelor
Van der Waals. Acestc fore stabilizeaz dublul helix de DNA.
Un caz particular al legturii covalente este legtura coordinativ. n cazul acestei
legturi dubletul de electroni pui n comun aparine doar unuia din atomi, denumit donator
sau atom nucleofil, iar cellalt atom (legat prin acest dublet) se numete acceptor sau
atom electrofil.
Astfel de legturi pot da atomii donatori de azot, oxigen, fosfor i sulf. n cazul azotului,
acesta particip la formarea amoniacului cu trei din cei cinci electroni de valen:
H
3H + -N: : n *.
h

H
rmnnd o pereche de electroni care nu particip la formarea legturii, pereche denumit
dublet neparticipant.
n cazul tratrii unei soluii de acid clorhidric (care este disociat n H+i Cl') cu
amoniac, ionul de H+, neavnd o configuraie stabil, se ataeaz dubletului neparticipant,
formnd ionul de amoniu. Sarcina acestuia se echilibreaz prin anionul Cl':

H H
H * N + H ++ C r ^ h; n jh ci

H L H J
sau

Similar, n cazul interaciunii dintre o amin (RNH,) i un acid oarecare (AH):

o *H
r ! n ; + h ++ a
*
H

sau, n redare curent:


R - NH 2 + H+ + A' [R -N +H 3 ]A-

n astfel de compui ntlnii i ca biomolecule exist: legturi covalente (n radicalul


R, ntre acesta i atomul de azot, ntre atomul de azot i doi atomi de hidrogen); o
legtur coordinativ (ntre atomul de azot i atomul de hidrogen); o legtur ionic (ntre
cationul aminic i anionul acid A).
Legtura coordinativ astfel format se mai numete legtura donator-acceptor.
Ionul fonnat se numete ion complex, iar combinaia astfel rezultat se numete combinaie
coordinativ.
La notarea curent legtura coordinativ sc simbolizeaz printr-o sgeat orientat
cu vrful nspre atomul acceptor.
Exemplu:
H,N NH,

0 - < - P - O H [ n H 3 A g-** N H 3I SO 4

H ,N
NH
in n :3
A cid fosforic C lorura arg en tic S ulfat tetraam in o cu p ric

Dintre acetia, ultimii doi compui sunt combinaii complexe,


n accepia teoriei combinaiillor complexe n aceti compui, se distinge un ion
complex nscris ntre paranteze i unul sau mai muli ioni externi nscrii n afara parantezei.
Ionul complex este format dintr-un atom sau ion central, n jurul cruia se grupeaz mai
muli atomi, molecule neutre sau ioni (de sarcin contrar ionului central). Numml acestora
este denumit numr de coordinaie.
Numrul de coordinaie este independent de valena atomului sau ionului central. Mai
frecvent se ntlnesc numerele de coordinaie 6 (Fe, Co, Cr) i 4 (Cu, Ni), iar mai rar
numerele 2 (Ag) i 8 . Combinaiile complexe sunt ntlnite i n natur n cazul unor
bioconstitueni care conin O, P sau S.
n cazul compuilor organometalici prezeni n sistemele biologice este ntlnit legtura
chelatic. n astfel de legturi ionii metalici (Mn+) stabilesc legturi cu diveri atomi din
biomolecule, legtura fiind caracteristic ndeosebi proteidelor. Dintre ionii metalici, n
legturile chelatice se ntlnesc mai des ionii divaleni (Fe2+, Cu2+, Mn2+, Zn2+, Co2+.a)
Ionul metalic formeaz o legtur chelatic (gr.c/ie/a-clete) n form de complex
intern, spre exemplu, cu un aminoacid sau o caten polipeptidic (considerai liganzi).
Legtura chelatic se stabilete de fapt ntre ionul metalic i atomi de N i O ai
v-v^-v^-v'-y-v' ligand u lu i, fiind o legtur
0 0 u 0 0 0 Lan P0liPcPtidic coordinativ. Ionul metalic poate
stabili legturi coordinative i cu liganzi
Metaloproteid \ i 2+ /
(structur general) M (L) formai din molecule mici. Alturi
de legturile coordinative (menionate
/ tv.
o i n r T Lan'P0 iirePtidic mai sus), n chelai apar legturi
covalente. Astfel de chelai se ntlnesc
n cazul metaloproteidelor, a cror structur general evideniaz prezena acestor legturi.
Un compus chelatic, mai simplu, se formeaz prin
R
legarea unui aminoacid de ionul cupric Cu2+, ca
rezultat al interaciunii dintre aminoacid i hidroxidul H - C nh2 '-=
sau fosfatul cupric. n compusul astfel format apar \ Cu +/
legturi covalente i coordinative (reprezentate prin 4
sgei). \
Se poate conchide c n materia vie pot s apar o=co- NH, Hc-
2+
legturi de natur chimic (covalente, ionice, de Chelatizare Cu - aminoacizi k
hidrogen) i legturi de natur fizic (legturi
dipol-dipol, ion-dipol, Van der Waals etc.), precum i unele interaciuni complexe,
care cuprind mai multe tipuri de legturi. n acest mod se fonneaz asociaiile moleculare
numite cenapse, viznd grupe de substane cum ar fi: proteide-lipide, proteide-glucide,
glucide-lipide sau chiar proteide-glucide-lipide.
c a p i t o l u l 1 . PROTEINELE.ENZIM ELE
STRUCTURA I FUNCIA BIOLOGIC A PROTEINELOR
Majoritatea covritoare a modificrilor biochimice n organismele vii sunt determinate
de proteine: Viaa e nemij locit legat de procesul de rennoire a proteinelor i reprezint
modul de existen a corpului proteic (F. Enghels). Anume proteinele sunt constituentele
chimice cu cel mai nalt grad de complexitate, varietate molecular, care reprezint
specificitate de specie, de organ.
Denumirea de protein provine de la cuvntul grec proteios, care nseamn de
prim rang, pentru via, folosit ca termen pentru prima dat n 1838 de ctre
savantul german Miilder.
Proteinele formeaz clasa de substane dintre cele mai rspndite i de o varietate
funcional excepional.
Proteinele ndeplinesc urmtoarelefuncii fundamentale iminente organismelor vii:
1. Au un pronunat i important rol structural, constituind baza structurilor celulare,
membranare, precum i a organitelor celulare, materialul intercelular al esuturilor i
organelor. Proteinele structurale sunt: colagenul, elastina, keratina,fibroina. Ele
asigur diversitatea i specificitatea de fonn a tuturor fiinelor vii.
2. Exercit cataliza fermentativ. Toate varietile de reacii biochimice i tot
specificul transformrilor din organismele vii sunt determinate de enzime care sunt,
de fapt, proteine. Actualmente, sunt depistate mii de fenneni, muli dintre care separai
n forma cristalic.
3. Funciile contractil i locomotoare (dinamic) sunt asigurate de proteinele
respective: actina, miozina, tubulina - proteina microfilamentelor ce determin
procesele de baz n celul. Micarea coordonat la nivel microscopic (procesul
mitozei) la fel e determinat de aceste proteine.
4. Funcia de transport i de depozitare a unor compui chimici ca: ionii meta
lici, vitamine etc. Hemoglobina aprovizioneaz cu oxigen esuturile, iar o protein
nrudit, mioglobina, l depoziteaz n muchi.Transferina iferitina asigur transportul
i depozitarea fierului n snge, ficat. Lipoproteinele plasmei transport lipidele. Un grup
specific de proteine se afl n membrane, transfernd prin membran n celul diferii
ingredieni.
5. Funcia de protejare fa de corpi strini, virusuri, bacterii, macromolecule e asigurat
de proteinele specifice eliminate, n majoritate, de limfocite. Reaciile imunologice sunt
determinate de imunoglobuline (proteine efectiv specificc). Astfel de proteine ca
fibrinogenul, trombina . a. iau parte la procesul de coagulare a sngelui, protejnd
organismul de impactul lezrii vaselor sanguine.
6 . Funcia reglatoare contribuie la reglementarea creterii i diferenierii celule

lor. ntr-un anumit interval de timp n viaa organismului se produce expresia numai la o
parte mic din genomul celulei. Funcia dat o ndeplinesc aa-numiteleproteine-represor,
care inhib poriuni specifice n DNA celular. Aici pot fi ataate i proteinele ce regleaz
activitatea fiziologic celular.
7. O grup specific de proteine poate stoca, transmite i genera diverse mesaje
chimice, impulsuri nervoase, servind drept receptori (rodopsina - proteina fotore-
ceptorie n retina ochiului) sau transmitori ai impulsului nervos n sinapse etc.
8 . Funcia fizico-chimic a proteinelor e capabil s menin constantele snge-

lui- homeostazia (albuminele determin presiunea oncotic-cantitatea, volumul lichidului


n vasele sanguine).
9. Proteinele ndeplinesc i funcii insolite. De exemplu, sngele petilor antarctici
conine proteine cu proprieti de antigel, protejnd petii de nghe. Locul de fixare
a aripilor la unele insecte conine rizelin - protein purtatoare a unei elasticiti ideale.
Din plantele africane s-a extras o protein foarte dulce - monelina, ce nu favorizeaz
obezitatea, fiind folosit pe larg n raia alimentar.
1 0 . 0 grup interesant i important o alctuiesc proteinele alimentare i de rezerv:

proteinele laptelui, ovalbumina, seminele unor plante (soe, gru etc.), remarcndu-
se prin deosebitul lor rol energetic.
n momentul actual se studiaz mii de proteine, structura i funcia sutelor dintre care
sunt cunoscute. Astzi deseori putem auzi despre obinerea unor proteine noi cu fuAcii
excepionale. Dup zeci de ani de investigaii, un grup de savani de la Universitatea
HARVARD (America) au obinut (1985) o protein pur, susceptibil de formarea
vaselor sanguine Ia om - angiogenina, compus din 123 de aminoacizi ce constitue
un singur lan. Folosind metodele ingineriei genetice, a fost reconstituit gena care
regleaz n organismul uman producerea angiogeninei. Investigaiile prognozeaz sinteza
unor preparate care vor ameliora circulaia sanguin n muchiul cardiac, contracarnd
infarctul, insultul, vor contribui la cicatrizarea leziunilor, ulcerului etc. Blocada angiogeninei,
ns, poate fi util n tratamentul cancerului, bolilor n care apar vase mici nedorite -
psoriazis, rinopatie diabetic, artrit reumatoid; la supravegherea natalitii, preparatele
contraceptive fiind inhibitori ai acestei proteine.
E uimitor faptul c toate proteinele cu diversele lor proprieti i funcii, sunt
constituite din aceiai 2 0 aminoacizi fundamentali, ncepnd cu cea mai simpl bacterie
i pna la om. Se tie c separat fiecare aminoacid nu are nici o funcie biologic. Care
e cauza c o protein are proprietate catalitic, alta honnonal, cealalt - anticorp? Prin
ce se deosebesc ele din punct de vedere chimic?
Rspunsul e foarte simplu: proteinele se deosebesc prin faptul c pentru fiecare
n parte e caracteristic numai o singur secven de aminoacizi. Aminoacizii
sunt alfabetul structurii proteice.
Prin legarea n lanuri polipeptidice, variate ca lungime i succesiune a unitilor,
se poate obine un numr infinit de mbinri de compui. Fiecare specie conine mii
de proteine, dar specii exist circa 10 milioane. Putem oare asigura aceste proteine
numai cu 2 0 aminoacizi? O analiz matematic simpl arat c pentru un polipeptid
din 2 0 aminoacizi diferii, nici unul dintre care nu se repet mcar de 2 ori, numrul
de variaii este de 20x19x18 .a.m.d., ~ 2x1018. Masa moleculei e de 2600 Da.
Dar dac lum o protein cu masa de 34000 Da, unde 12 aminoacizi sunt reprezentai
n acelai raport, atunci cptm 10 30 0 de combinaii. Dac n componena lor vor fi
inclui 20 aminoacizi n acelai raport, numrul va crete enorm. Dac ar exista numai
cte o molecul din fiecare protein posibil, apoi greutatea lor ar fi mai mare dect
a planetei noastre. Variaii din aceti 20 aminoacizi pot fi att de multe, nct ar fi suficiente
nu numai pentru proteinele existente azi, dar i pentru cele care vor apare n viitor.
Potrivit calculelor specialitilor, azi pe pmnt exist 0,001 de specii dintre cele
cunoscute cndva.
Unitatea structural de baz a proteinelor sunt aminoacizii.
Primul aminoacid descris n 1806 a fost asparagina, iar ultimul - treonina - a fost
identificat de abia n 1936. Fiecare aminoacid are denumirea sa tradiional (conform
originii lui), raional (chimic), abreviere din trei litere i simbol de o liter. Aminoacizii
sunt derivaii acizilor grai saturai-aminoderivai. Au o structur n care, cu acelai atom
de carbon este legat grupa carboxilic i aminic.
Aminoacizii se deosebesc ntre ei prin natura acestui radical R _ p j_ c o O H
(R). I
Anume radicalul R la diferii aminoacizi difer dup structur, N H2
sarcin electric, solubilitate n ap.
Dup proprietatea de a interaciona cu H;0 la un pH = 7,0, deosebim 4 grupe de
aminoacizi (tab. 1 . 1 ):
1. Aminoacizi cu radicali hidrofobi, nepolari - hidrocarburi. Reprezentani: alanina,
valina, leucina, izoleucina, prolina, metionina,fenilalanina, triptofanul.
2. Aminoacizii cu radicali polari, dar far sarcin electric. Ei formeaz legturi de
hidrogen cu molecule de H ,0. Reprezentani: serina, tirozina, treonina - polaritatea
e determinat de grupa OH'; asparagina i glutamina - de grupa NH,; cisteina - de
SH, iar la glicin - radicalul (H) ce nu compenseaz polaritatea grupelor NH, i COOH.
3. Aminoacizii cu radicali ncrcai negativ {acidul aspartic i glutamic).
4. Aminoacizii cu radicali ncrcai pozitiv (,Uzina, arginina - grupa guanidinic
i histidina - grupa imidazolic).
n structura unor proteine se remarc i aminoacizi nefundamentali n compo
nena colagenului: 4-hidroxiprolin, 5-hidroxilizin] n miozin - metillizin; n
protrombin - acidul carboxiglutamic; n elastin - desmozin format din 4 molecule
de lizin. Aceti aminoacizi se mai numesc aminoacizi minori (tab. 1.2).
Se mai ntlnesc aminoacizi cu alte funcii ca: ornitina, citrulina, -alanina, etc.
(tab. 1 .2 ).
Solubilitatea aminoacizilor n ap este influienat de prezena srurilor. Cea
mai mic solubilitate n ap o au cistina i tirozina (0,04 g/100 g a.d.), mult mai mare -
prolina i oxiprolina (154 g/l 00 g a.d.). Foarte solubili sunt arginina, lizina i cisteina la
pl n ap distilat i 20C (tab. 1.3). Prolina este singurul aminoacid cu o solubilitate bun
n alcool, ceilali aminoacizi se dizolv foarte greu. Toi aminoacizii sunt uor solubili n
soluii slab acide sau alcaline. De remarcat c triptofanul pur n soluii acide este stabil, n
timp ce n amestecuri sau n hidrolizate proteice uor se oxideaz.
Toi aminoacizii fundamentali, cu excepia glicinei, posed un carbon asimetric
(centru chiralic) care este C a (excepie prezint izoleucina i treonina care au 2 centre
chiraliceC ( 2 x 2 - 4)).
Formulele de configuraie ale enantiomerilor unui aminoacid oarecare, repre-
.Grupa acizilor hidrofobi nepolari.

A lanina (A la) A V alina (Val) V Lcucina (Leu) L


A cid a-am inopropionic A cid a-am inoizovalerianic A cid a-am inoizocapronic

H3 N - C H - C O O ' H 3 N CHCOO' H3 N - C H - C O O '


I I
CH 3 C H -C H 3 CH 2
I
CH 3 H 3 CCHCH 3
Izoleucina (Ile) I M etionina (M et) M Prolina (Pro) P
A cid a-am ino--m etilvalerianic A cid a-am ino-S-m etiltiobutiricA cid pirolidin-a-carboxilic

H 3 N CHCOO' H 3 N CH COO' H2N -C H -C O O '


CHCH 3 CH 2
I
CH 2 CH 3 CH 2
I
S -C H 3

Fcnilalanina (Phe) F Triptofan (Trp) W


Acid a-am ino--fenilpropionic Acid a-am ino--indolilpropionic

H 3 N - C H COO' H3 N - C H - C O O '
2 2

2 .Grupa acizilor cu sarcin negativ.

Acid aspartic (A sp) D A cid glutam ic (Glu)


Acid am inosuccinic A cid a-am inoglutaric
+
H 3 N CHCOO' H 3 N CHCOO'
1
CH 2 CH 2

c=o CH 2

O' c=o
O'

3. Grupa acizilor hidro fiii

A sparagina (Asn) N G lutam ina (G in) Q T reonina (Thr) T


A cid a-am in o - A cid a -am ino- A cid a-am in o -
-am idosuccinic Y -am idoglutaric -hidroxibutiric

+
H3N CH "COO' H3N CH-COO' H 3 NCH COO'
I I I
CH 2 CH2 C H -C H 3
i I
c -n h 2 CH2 OH
II I
o c nh2
I!
0
Serina (Ser) S C isteina (Cys) T irozina (Tyr) Y
A cid a-am ino- A cid a-am in o - A cid p-hidroxifenil-
-hidroxipropionic -tiopropionic alaninic

H3N CH COO' H3N CH COO' H 3 N C H -C O O '


I
1
CH2 CH2
I SH
OH
G licina (Gly) G
A cid am inoacetic

H3N-CH COO'
H

4.Grupa acizilor cu sarcin pozitiv.

Lizina (Lys) A rginina (A rg) R H istidina (His) H


A cid a,e.-diam inocapronic A cid a-a m in o -5 -g u a n id in o A cid a-a m in o - -im id a z o lil
valerianic propionic

H 3 N~ -C H -C O O ' H3N -C H -C O O ' H3N CH- COO'


I
CHo
!
CH 2
I
CH2
CH, CH 2 +
i I NH NH
CH 2 CH 2 n h 2
! .' 1 +
c h 2- - n h 3 NH C = N H ,
H om oserina
acid a - am ino- N orvalina O rnitina
Y -hidroxibutiric acid a-am inovalcrianic acid a , 8 -diam inovalerianic

h2n-ch-cooh h2n-ch-cooh h2n-ch-cooh


j I
CH2 ^H2 CH2
I i H2 CH2
c h 2 OH
I I
CH3 ch2-nh2

C itrulina H idroxilizina
acid a - am ino- N orleucina acid a ,e - diam ino-
5 -carbam ilovalerianic acid a-am inocapronic 5 -hidroxicapronic

H2N CH-COOH H2N - CH-COOH H2N-CH-COOH


I
CH2 :h2 CH2
I I
CH2 CH2
CH2 nh2 I
ch2-nh-c CH2 CH-OH
\> I
CH3 ch2-nh2
A cid Y-carboxiglutamic A cid p - am inobenzoic H idroxiprolina
acid pirolidin-Y - hidroxi-
H2N - CH-COOH COOH a - carboxilic

CH2 HN--CH-COOH
I
CH
HOOC COOH
nh2
W
C am itina
-A lan in a
acid -am inopropionic
HO CH 2- N(CH3)3
CH2 COO' h2n ch2 CH2- COOH
665H G
u n iv e r s it a t e a s t a t
OE MEDICINA l FARMACIE
NICOLAE TESTEMIEANU"
S IB L ilQ T E C A
Selenocisteina A cid 8 - aminolevulinic

H2 NC H -C O O H 0= - 2-2- COOH
I I
CH 2 CH 2
I
SeH NH 2

Ilom ocisteina
Metillizina
acid a - amino-
H 2 N C fb -C O O H Y - tiobutiric

H 2 N C H -C O O H
lzu2 " I
CH 2
1
CH 2
I I
CH 2 NHCH 3 SH

Desmozina
nh2
I
C H -C O O H
I
h 2n (CH 2 ) 3 NH 2
I I
HOOC CH (CH 2 ) 2 -(CH 2 )2 C H -C O O H

(CH 2 ) 4
C H -C O O H
I
NHo

Acid Y - am inobutiric, GABA

CH2 CH2 CH2 COOH


\
NH,
Solubilitate Solubilitate
Aminoacid ( g / 1 0 0 ga.d.) Aminoacid ( g / 1 0 0 ga.d.)

Alanina 22,50 Leucina 3,60

Arginina f solubil Lizina f solubil

Asparagina 2,40 Metionina 3,00


Acid aspartic 0,40 Prolina 154,50
Cisteina f solubil Serina 4,30

Fenilalanina 2,70 Treonina 1,60

Glicina 4,00 Trip to fon 1, 10

Glutamina 3,60 Tirozina 0,04

Acid glutamic 3,70 Valina 6,80

Histidina 4,00

zentate n sistemul D-L, n care substana de referin este aldehidaglicericdextrogir,


sunt redate n felul unntor.

COO- C O ir

Literele se refer numai la configuraia absolut: n cazul D-izomerului gruparea NH,


se afl n dreapta, iar a L-izomerului - n stnga. n structura proteinelor se ntlnesc numai
L - aminoacizi, doar pentru ei exist sisteme enzimatice, care prezint specificitate de
substrat, graie creia se asigur metabolizarea lor.
La valori de pH neutre aminoacizii n soluie se afl n form de ioni bipolari
(Zwitterion). Grupa amin e protoionizat (NH3+), iar cea carboxilic (COO ) -
disociat.
R R
Forma neutr Forma de ion bipolar (amfiion)

Ionizaia aminoacizilor depinde de valorile pH. n soluii acide grupa COOH este
neionizat, iar cea amin - ionizat (NH3+).
H H
I I
RC COO + H - R - C COOH
1+ 1+
NH 3 NFI3

n soluii bazice situaia e contrar, ionizat e grupa carboxilic (COO').

H H
I
R - C - C O O + OH R - C COO + H ,0
!+
NH, NH,

In arhitectonica moleculei proteice deosebim patru niveluri structurale.

STRUCTURA PRIM AR
Cum se leag aminoacizii n proteine? Procesul decurge n felul urmtor: a-grupa
carboxilic a unui aminoacid se unete cu a -aminogrupa altui aminoacid, fonnnd legtura
peptidic, cu eliberarea unei molecule de ap.

O H
II "I-
H 2 N CH + N C H -C O O H
I -I I I -H20
R, OH H R2 o
II
w H2N CH N CHCOOH
I I I
Ri H r 2

Echilibrul acestei reacii nclin mai mult spre procesul de hidroliz, dar nu de sintez.
De aceea procesul de sintez necesit energie, pe cnd hidroliza decurge cu degajarea ei.
La unirea multor aminoacizi cu legturile peptidice se formeaz un lan (caten)
polipeptidic, avnd o structur liniar.
Lanul are o anumit direcie. S-a stabilit condiional c el ncepe cu captul purttor
de aminogrup, captul N. Descrierea unei sccvene de aminoacizi n lan ncepe
anume dc la acest capt terminal. Aminoacidul, care n legtura peptidic particip cu
grupa sa COOH, capt sfritul - il; aminoacidul final, care conine grupa COOH
liber, nu-i schimb denumirea, fonnnd captul -terminal.
Aadar, lanul polipeptidic are un schelet cu o structur strict, repetat i
catene laterale diferite.

Succesiunea aminoacizilor determin structura primar a proteinelor, fiind baza


informaiei genetice. In unele proteine catenele laterale se unesc ntre ele cu legturi
disulfidice, care se formeaz la oxidarea resturilor de cistein. Alte legturi covalente n
structura proteinelor nu se ntlnesc. Astfel de tip de legtur ntre aminoacizi n molecula
proteic l-a stabilit, n 1888, savantul rus A. Danilevschi; dar numai n 1902E.Fischera
naintat teoriapolipeptidic. Azi tiina posed argumente convingtoare ale prezenei
acestei stmcturi:
1. A naliza ro en tg en o stru ctu ral a perm is N NH NH
detenninarea tabloului repartiiei resturilor de aminoacizi
n lanul polipeptidic i conformaia lui. O O
2. Argumentarea de baz este posibilitatea de Biuretul
sintez a proteinelor purificate, precum i a
polipeptidelor cu structur cunoscut, care posed activitate biologic, la fel ca i
proteinele native.
3. Proteinele, ca i compusul biuret, dau o coloraie albastr-violet n prezena
C uS04, n mediu alcalin, ceea ce e o dovad a prezenei legturii peptidice.
Ficcare protein are o structur unic, o succesiune precis de aminoacizi. n 1953,
Frederic Sanger descifreaz aminoacizii n lanurile polipeptidice ale hormonului - insulin.
Prima dat a fost determinat succesiunea aminoacizilor, stabilindu-se c aceasta e
determinat genetic. Sinteza tuturor proteinelor din aminoacizi are mecanism similar.
Care este necesitatea determinrii acestor succesiuni n proteine?
Avem posibilitatea de a stabili:
1. Baza molecular a activitii biologice a proteinelor.
2. Principiile ce stau la baza formrii lanului polipeptidic - la aciunea biologic
activ alctuesc structuri specifice bazale.
3. Modificrile n succesiunea aminoacizilor pot conduce la tulburri ale funciei pro
teinelor i, n consecin, la apariia maladiilor. De menionat c modificarea unui singur
aminoacid provoac tulburri grave n metabolism. Evolueaz o direcie nou n medici
n - patologia molecular.
4. Succesiunea resturilor de aminoacizi furnizeaz informaii sugestive despre evoluia
procesului la nivel molecular.
Care sunt principiile de descifrare a succesiunii aminoacizilor?
1. Proteina trebuie s fie hidrolizat pn la aminoacizi, nclzind-o la 110C
timp de 24 ore n 6 N HC1. Hidrolizatul e separat prin metoda cromatografiei ionice
cu polistcrol sulfonizat. Aminoacizii fracionai se determin prin reacia cu ninhidrin:
a-aminoacizii confer o culoare albastr intensiv, prolina (iminoacid) - galben.

+ + H o N -C H COOH
COH I
R

, C om pui + C 0 ,+ R C H 0 + H20
interm ediari

Purpura Ruhcm ann'

Metoda aplicat este deosebit de efectiv. Cantitatea de aminoacizi e proporional


densitii optice a soluiei dup nclzire cu ninhidrin.
Dac cantitatea de aminoacizi este minim, se folosetefluorescamina. Comparnd
rezultatele obinute cu amestecul standard, determinm compoziia aminoacidic a
proteinei i anume: compoziia, nu ns succesiunea aminoacizilor.
2. Procedeul de identificare a terminalelor N i a fost utilizat de F. Sanger
pentru stabilirea grupei N H , de ctre dinitrofluorbenzen, cc reacioneaz cu
NH2, formnd compui (de culoare galben) ai acestei substane. Legtura e stabil
i se pstreaz la hidroliza legturii peptidice; compusul e determinat cromatografic.
nh2
I
+ R CH HF
I
0=C m
Dinitrofluorbenzcn
I
R CH
I
0 =C
2,4-dinitrofenil - derivat
al polipcptidului
+ Gly A sp Qy
Phe Arg

I
H3c CHCOO
2,4-dinitrofenil - derivat
al restului aminotemiinal

Atunci cnd aminoacizii constituie cantiti mici, e folosit un alt reagent - clorura de
dabsil, care, reacionnd cu grupa NH,, confer compusului sulfamidic o culoare intensiv,
fluorescent.

N- -SO9CI + h2n CH-C^


H3 C ' \ = I II
CH3 o
Clorura de dabsil J.-HC1
H,C
3Vv 7 V n=n^ A - S O ? N H C H - C - w
/ I II
H ,C CH 3 o
Hidroliza
t

4 N- / V _ n = n / \ - S 0 2NHCH C O ' +
H .C 7 \ = / 1 1 Gly Asp Gly
Dabsil-alanina 3 e Arg

Determinarea captului N-termina!prin marcarea cu clorura de dabsil


Resturile -terminale ale catenelorpolipeptidice se identific n felul urmtor:
polipeptida se incubeaz cu carboxipeptidaza (COP), care hidrolizeaz legtura
peptidic la captul -term inal, compusul fiind determ inat cromatografic.
Carboxipeptidaza-A este inactiv la COOH ale argininei, lizinei iprolinei. Carboxi-
peptidaza-B scindeaz COOH ce aparine lizinei i argininei.
Metoda chimic: proteina se incubeaz cu hidrazin la 100(IC, n lipsa apei, rezult
hidrazide ale aminoacizilor, excluzndCOOH-tenninal, care ramne liber. Acest aminoacid
este identificat cromatografic.
Un alt principiu const n scindarea lanului polipeptidic n fragmente, explornd
diferite metode:
a) hidroliza catalitic limitat sub aciunea enzimelor specifice - tripsina (scindeaz
legturile peptidice formate de grupa COOH a Lys i Arg, indiferent de lungimea i
succesiunea aminoacizilor n lan);
b) metode chimice specifice, de exemplu, bromura cianidic (CNBr) scindeaz
legtura peptidic format de COOH a metioninei. Aceast metod e prea dificil.
Peri Edman propune metoda de determ inare a succesiunii fragm entelor
peptidice sau aminoacizilor. n metoda elaborat de F.Sanger hidrolizatul nu poate fi
folosit dublu din cauza c peptida se hidrolizeaz complet.
Peri Edman a reuit s marcheze captul N-terminal i scindarea lui de la peptid,
produendu-se far scindarea altor legturi peptidice. Metoda const n scindarea
fiecrui rest de aminoacid din captul N-terminal. n acest caz se folosete
fenilizotiocianatul care reacioneaz cu NH,, rezultnd formarea feniltiohidantoina
compusului:

N=C=S
+ H 2 N CH G ly -A sp - P h e A rg -G ly COO

Fenilizotiocianatul CH 3

H s 1 PH=9
I II Y
N C NHCH C O GlyA s p -P h e A rg -G ly COO

ii
IrN _c + H2 N GlyAspPheArgGlyCOO

t
C H -C H 3 Degradarea dup Edman
n mediu slab acid are loc disocierea compusului ciclic, iar peptida rmas e mai mic
cu un rest de aminoacid. Produsul este identificat cromatografic. Degradarea dup Edman
este repetat.
n fine, se ajunge la etapa in care succesiunea n fragmente de peptide e clar, dar nu
e identificat succesiunea peptidelor nsei. Ultimele se determin dup suprapunerea
diferitelor segmente de peptide, stabilindu-sc astfel segmentele de coinciden. Se folosesc
i ali fermeni ca: chimotripsina (scindeaz legtura peptidic format de COOH a
Phe, Tyr i Trp\p ep sin a etc.
Metodele descrise mai sus se refer la proteinele compuse dintr-un singur lan
polipeptidic, far prezena legturilor disulfidice. n caz contrar, sunt necesare metode
suplimentare. Disociaia a mai multor catene polipeptidice e posibil sub aciunea
detergenilor ca: ureea, hidroclorura de guanidin, care scindeaz legturile
necovalente, distrugmd structura teriar i cuatemar.
/N H 2
H 2 Nc N H , HN=C -HC1
II " nn h 2
o
Ureea Hidroclorura d e guanidin

Legturile disulfidice se rup la oxidarea n acid performic, cu formarea resturilor de


acid cisteinic.

NH NH
1 : 1 O
CH-CH 2-S-5-S CH,-CH + HC^
c= o : c= o
^ C istin a I A cid perform ic

i
NH NH
I I
C H - C H 2 SO 3 II + HO 3 S CH 2 CH
I ' I
c=o c=o
I A cid ciste in ic I

Analiza structural a proteinei poate fi accelerat prin utilizarea secveniatorului


- aparat ce permite determinarea automat a succesiunii de aminoacizi.
Proprietile funcionale ale proteinelor sunt detenninate de conformaie, aranjamentul
spaial al atomilor, esenial fiind succesiunea de aminoacizi, care, de fapt, i stabilete
conformaia proteinei.
La sfritul anilor 1930 L.Pauling i R.Corey au nceput explorarea structurii
aminoacizilor iapeptidelorcurazeXi au determinat lungimea i unghiul standard ale
legturilor, ca apoi s prevesteasc conformaia proteinei. S-a constatat un fapt
important, i anume: unitatea peptidic posed o structur planic rigid. Atomul de
hidrogen al grupei NH, ocup o poziie trans n raport cu O, a grupei carbonilice
(fig. 1 . 1 ).

(I = 0,1 nm)

- terminal

/V - termi nal

F igura 1.1. Grupa peptidic cu lungimea legturilor

Legtura dintre carbonul


grupei carbonilice i azotul o o 0-
grupei NH din legtura v ----- - x v
p e p tid ic p o se d un a | c< N ca
caracter parial de legtur
dubl. <a)
i, deci, rotirea n jurul
acestei legturi este ngreuiat. Lungimea ei este de 1,32A, media lungimii dintre
legturile ordinare C-N i legtura dubl C=N. Spre deosebire de cazul examinat,
legtura dintre atomul de i atomul de al grupei carbonilice este ordinar. Prin
urmare, n ambele pri ale legturii peptidice rigide gradul rotirii libere este foarte
mare. Fiecare aminoacid e caracterizat prin unghiurile sale de rotire. Rotirea fa
de aceste legturi se noteaz prin unghiurile \j/ i (fig. 1 .2 ).
n concluzie, structura primar nu este
altceva dect succesiunea de aminoacizi n
protein i localizarea punilor disulfidice.
Ea reprezint o caracteristic complet a
legturilor covalente din protein.

Figura 1.2. Determinarea unghiurilor iff i


/ - caracterizeaz rotirea fa de legtura ordinar Ca-C;
tj>- caracterizeaz rotirea fa de legtura ordinar Ca-N
STRUCTURA SECUNDAR se obine n rezultatul interaciunii sterice a
resturilor de aminoacizi localizai alturi n succesiunea liniar.
Unele dintre aceste interaciuni au un caracter reglementat, genernd astfel o anumit
periodicitate. Drept exemplu ne servete oc-elicea, structura sau structura n foaie
plisat i spiral de colagen. E posibil oare ca lanul polipeptidic s obin o structur
din poriuni repetabile?
L.Pauling i R.Corey, studiind un ir de conformaii poteniale, au elaborat modele
moleculare exacte - una din structurile secundare mai des ntlnite i dintre cele mai
avantajoase, lund n considerare rigiditatea geometric a legturii peptidice i variaiile
de unghi admisibile, se dovedete a fi a-elicea (fig. 1.3).

F igu ra 1.3. Modelul a -elice orientat spre dreapta


A - sunt prezentai in elice numai atomii Ca;
- sunt atomii de azot (N) ce formeaz scheletul moleculei; atomii Ca i carbonul carhonilic - C;
- spirala complet, prin puncte sunt reprezentate legturile de hidrogen ntre N H i
grupe, ce stabilizeaz spirala

Spirala are forma unui cilindru, rsucit tensionat, lanul de baz formeaz partea
intern a cilindrului, iar radicalii (lan exterior) sunt orientai spre exterior, miendu-se
conform spiralei. Spirala este stabilizat de legturile de hidrogen dintre N11 i ,
grupe ale lanului de baz. Grupa a fiecrui aminoacid se reunete prin legmra de
hidrogen cu NH, grupa aminoacidului situat n succesiune liniar cu patru resturi n
avans. Deci, toate grupele i NH ale lanului de baz sunt unite ntre ele prin legturi
de hidrogen. Pasul elicei conine 3,6 resturi de aminoacizi, adic aminoacizi separai
n succesiuni liniare de 3 - 4 resturi de aminoacizi, fiind amplasai foarte aproape n
structura spiralei. Dimpotriv, aminoacizii aflai la dou resturi diferen unul de altul,
spaial sunt plasai opus unul fa de altul i, deci, interaciunea reciproc devine imposibil.
Pasul spiralei este de 5,4 (angstrom, unitate de lungime echivalent cu 0,1 nm, denumit
astfel n cinstea savantului spectroscopist A. Angstrom). La ficcarercst, aminoacidul
avanseaz pe vertical cu 1,5. Diametrul acesii bastona n care se afl atomul C -a
estedelO. Sensul rsucirii lanului polipeptidic poate fiatt de la stnga la dreapta, ct
i viceversa. Toate cercetrile a-elicei proteinelor se refer la primul tip.
Cota a-elicei n proteinele studiate pn acum este imens de variabil. n unele
proteine, de exemplu mioglobina i hemoglobina, a-elicea st la baza acestor structuri,
ns proteina chimotripsina e lipsit de ea complet. Elicele formeaz unele elemente
proteice lungi, ajungnd la mai mult de 1000. Dou i mai bine spirale pot s se rsu
ceasc ca firele n fringhie groas. Astfel de structur se numete superspiral i o gsim
n diferite proteine ca: miozina, keratina, tropomiozina, fibrina i n alte proteine sanguine
etc. Asemenea structuri ndeplinesc un rol mecanic, fonnnd fibre, i sunt caracteristice
pentru proteinele fibrilare. L.Pauling cu R.Corey au prezis aceast structur cu 6 ani
nainte de a fi experimental depistat prin metoda analizei R-structurale. A fost descoperit
o er nou n biologia molecular, favoriznd posibiliti de a prezice confonnaia lanului
polipeptidic, n cazul n care sunt explorate proprietile ingredientelor.
ns nu toate polipeptidele sunt capabile s formeze spirale. Exist aminoacizi
dezorganizatori ai elicei n structura primar. Aceste resturi de aminoacizi mpiedic sau
diminueaz tendina de rsucire elicoidal a unui lan polipeptidic. S-a stabilit c:
1. Prezena pralinei ntrerupe rsucirea elicoidal a lanului polipeptidic. Atomul de
azot se include n componena inelului rigid din structura aminoacidului, ce exclude
orice rotire ct de mic n jurul legturii N-C. Atomul de azot care formeaz legtura
peptidic n-are atom de hidrogen i de aceea el nu-i capabil s formeze legturi de
hidrogen intracatenare. n consecin, structura spiralic se deregleaz ntotdeauna acolo
unde e prezent acest aminoacid, formndu-se un cot, o ndoire, o ncovoiere n lan.
2. Dac n succesiunea aminoacizilor sunt alturate multe resturi de acid glutamic,
apoi la pH = 7 apare o for de respingere ntre grupele carboxilice ncrcate negativ,
fora crora e mult mai mare dect forele stabilizatoare ale punii de H a spiralei. Din
aceeai cauz segmentul de caten, cu un numr mare alturat dc resturi ale aminoacizi
lor ca lizina sau arginina, cu o sarcin pozitiv, nu va avea form elicoidal.
3. Resturile unor aminoacizi (valina, serina, treonina, izoleucina, asparagina), avnd
radicali voluminoi la -a, confer o oarecare strngere steric a elicei, servind drept
factori destabilizatori (grupa OH a serinei, treoninei pot forma puni de H). La fel vor
reaciona i resturile de cistein, care formeaz puni disulfidice covalente. Ele vor lega
rigid poziiile lanurilor polipeptidice i n vecintatea acestor regiuni rsucirea elicoloidal
nu mai poate avea loc.
Rezult c avem 4 tipuri de limitri care influeneaz asupra conformaiei catenei
polipeptidice:
1 . rigiditatea legturii peptidice;
2 . forele electrostatice de respingere sau atragere, dac aminoacizii le au n
apropiere;
3. prezena radicalilor voluminoi;
4. prezena iminoacidului - prolina.
S-a stabilit c structura primar const n succesiunea aminoacizilor n lan, legturile
covalente pcptidice aparinnd catenelor. Structura secundar se caracterizeaz prin
conformaia n spaiu a resturilor de aminoacizi n lanul polipeptidic. Exemplu clasic de
a - spiral e a -spirala keratinei ce conine mult cistein. Dup cantitatea de Cys se
evideniaz keratina diferitelor surse. La broasca estoas, de exemplu, coninutul de
Cys este egal cu 18%. Carapacea ei nu numai c are o duritate excelent, dar n
condiii fiziologice e insolubil n ap. Globulinele i mai ales albuminele datorit solubilitii
lor n ap, permit formarea unei soluii de 60%.
Care-i cauza acestei deosebiri? a-keratinele conin aminoacizi care au grupe
hidrofobe localizate pe suprafaa exterioar a elicei, ce ocup o poziie fixat i sunt
orientate spre faza apoas. n proteinele globulare de asemenea avem grupe hidrofobe,
dar ele sunt camuflate, n-au contact cu apa, iar pe suprafaa exterioar sunt ataate
grupe hidrofile sau polare.
In acelai an L. Pauling i R. Corey au descris o alt variant de structur periodic
- aa-numita -structur sau structura n foaie plisat (fig. 1.4).

F igura 1.4. - structur


Ea se deosebete de a -spiral prin:
1. Form plat, dar nu de bastona, n fibroin, de exemplu, catencle polipeptidice
sunt localizate paralel una fa de alta, formnd plise i de aceea astfel de structur se
numete foaie plisat sau de straturi. Fibroina conine 1 0 0 %, iar alte proteine - proporii
variate de asemenea structuri.
2. Distana ntre dou resturi de aminoacizi e de 3,5E (nu de 1,5 ca la oc-spiral).
Structura- e stabilizat prin puni de hidrogen intercatenare, dar nu intracatenare ca la
a-spiral. Radicalii de aminoacizi ies n ambele pri ale structurii-.
Exist a i -keratinele. n nu se fonneaz puni disulfidice ntre catcnc, lanurile
fiind direcionate diferit -antiparalel. Structura , la rndul ei, e determinat de secvena
de aminoacizi n lanul polipeptidic. O condiie obligatorie e ca resturile de aminoacizi s
posede grupe mici. Aadar, n fibrinoina mtasei majoritatea acestor resturi revine glicinei
i alaninei. Fiecare al doilea aminoacid e glicin, -keratinclc aparin tot proteinelor
fibrilare insolubile n ap, dar sunt mai flexibile i mai greu se extind. Periodicitatea
structurii se repet peste 7A.
Aceste concluzionri rezult din unnatoarele experimentri:
Dac a-keratina prului este prelucrat cu unele substane i apoi supus aciunii
aburilor, ca se extinde aproape de 2 ori fa de lungimea iniial. Radiograma acestei
stri e caracteristic fibroinei, adic i pierde a-elicea i capt -structura, ca
rezultat al ruperii legturilor de hidrogen, ce stabilizau a-spirala. Dac a-keratina se
rcete i se ia greutatea respectiv, apoi automat se rentoarce la conformaia de a -
spiral. Procesul e cauzat de faptul c n a-elice radicalul grupelor este mai mare dect
n -structur i de accea ultima conformaie n astfel de compui e mai puin stabil.
Aceast proprietate a a -keratinei se datoreaz i prezenei vdite a legturilor
transversale disulfidice care stau la
baza elasticittii firelor de pr (fig.
f i /
1.5).
Unii aminoacizi destabilizeaz i f/
A
511HS1 Aa* 5 4 A* 1
structura plisat, printre ei: Glu, Pro, is S * SH H $ J b sif ~ -
Lys, Ser, Asp. Ali aminoacizi \j - S - S - \ \ H s~
HS I .~Sff
T
_ l~SH :
favorizeaz formarea structurii
plisate ca: Met, Val, Ile.
-S H HS- fi J 118
I j
/L e8 - - , gI
La6 : g V8 5 ! &
V *"9 1
A l treilea tip de structu r ISSi . > & --
i \ - H s f .= \ ^ \\ \
periodic e spirala de colagen. N =2 \
A ceast stru c tu r sp ec ific / / V V D
determin elasticitatea colagenului - F igura 1.5. Fazele ondulaiei permanente a prului:
component de baz a pielii, oaselor. - a-elicea keratinei e stabilizat de legturi disulfidice;
- agentul reductor transform cistina in cistein;
Ca protein fibrilar el se gsete, - modificrile mecanice schimb poziia gr. S H n catene;
n condiii diverse, aproape n toate I) - oxidarea grupa S H formeaz legturi transversale noi.
organele, determinnd formarea unor
uniti structurale. Fiind insolubil, s-a studiat dificil i numai dup ce s-a observat c
colagenul din esuturile animalelor tinere poate fi extras n stare solubil, deoarece n el
lipsesc legturile transversale, s-a putut stabili unitatea structural de baz - tropocolagenul.
Ultimul e alctuit din trei catene de aceeai lungime i structur, care pot fi similare la
unele tipuri de colagen. 1/3 din aminoacizi i revine glicinei, cantiti deosebite constituind
prolina, rar ntlnit n alte proteine. Conine hidroxiprolin i hidroxilizin. Colagenul arc
o regularitate mare n succesiunea aminoacizilor - al treilea rest aparine glicinei. Foarte
des se repet secvene ca Gly-Pro-Hidroxipro. Spirala de colagen se caracterizeaz
printr-un grad de stabilitate a lungimii, detemiinat de interaciunile cooperative, adic de
fonnarca lanurilor multiple care se amplific reciproc (fig. 1 .6 ).
Christian Anfinsen, studiind ribonucleaza, enzim ce scindeaz RNA, a stabilit un
principiu universal, fudamental n biologia molccular i anume: succesiunea aminoacizi
lor determin i conformaia.
STRUCTURA TRIDIM ENSIONAL
Aceast structur rezult din inter
aciunea strict a resturilor de aminoa
cizi care n succesiunea liniar se loca
lizeaz departe unul de altul, acesta fiind
modul de mpachetare a lanului poli
peptidic ntr-un volum anumit.
Fora motrice la apariia acestei
structuri e interaciunea radicalilor ami
noacizilor cu moleculele de ap. Cu alte
cuvinte, structura e determinat de
mrimea, forma, polaritatea acestor ra
dicali. Anume structura tridimensional
conine informaia funcional, ce sta-
bilete proprietile biologice i
infonnaia nativ a proteinelor.
Un lan polipcptidic adopt, n
msura n care-i permite structura sa
primar, configuraii de tt-elice, de
-structur; mpachetarea lanului caut F i ura i .6. Spirala de colagen
s satisfac i afinitile radicalilor, ccca A - spirala tripl, sim t prezentai atomii Ca;
- .- a - conformaia unei caten
ce fixeaza conformaia ei. Aceasta con- secven(a. c iv - p ro - Pro;
formaie e un compromis, deoarece nu - seciunea transversal prin modelul de colagen -
se pot realiza toate legturile posibile, trei catene umte i)r" les- H>unde Ca e al G,y-
dar acest compromis este cel mai favorabil i cel mai stabil din punct de vedere energetic.
Stabilizarea structurii determinat de aceleai legturi: de hidrogen, electrostatice,
hidrofobe, Van der Waals. Prima protein, a crei structur a fost stabilit, este mioglobina
- protein ce leag 0 2 n muchi. Ea conine n catena polipeptidic 150 aminoacizi i o
grupare neproteic numit hem (fig. 1 .7).

F igura 1.7 .Conformaia catenei mioglobinei (A) i a catenei din hemoglobina (B)
Scheletul are 8 segmente elicoidale, cel mai lung conine 23 aminoacizi, cel mai scurt
-7 aminoacizi, ce includ aproape 80% din resturile de aminoacizi. Radicalii ocup aproape
tot spaiul dintre segmente. Molecula e att de compact, nct n interiorul ei pot s se
acumuleze numai 4 molecule de ap.
Regiunile elicoidale sunt separate de segmente neelicoidale la nivelul crora lanul
polipeptidic i schimb direcia. n aceste puncte finale se posteaz prolina. Interiorul
moleculei e format din aminoacizi cu radicalul nepolar, excepie fiind dou resturi de
histidin ce leag hemul.
Grupele polare se afl pe exteriorul moleculei, n alte rsuciri - resturi de serin,
treonin, asparagin: hemul ce conine Fe leag o molecul de O,.
Cum sunt mpachetate alte proteine globulare, la fel constituite dintr-un lan
polipeptidic?
Citocrom - protein ce conine hem, dar se deosebete dup structura secunda
r, teriar, succesiunea de aminoacizi i proprietile biologice; lizowna - 40% fonneaz
structuri elicoidale; ribonucleaza, la fel protein globular, conine foarte puine a -
segmente, majoritatea se gsesc n -structuri, dar ca i lizozima conine 4 resturi de
cistein ce determin duritatea structurii (fig.
1.8, 1.9).
n proteinele ce funcioneaz n exteriorul
celulei astfel de legturi intracatenare disul
fidice sunt permanente. Fiecare protein se
caracterizeaz prin structur tridimensional
proprie doar ei, special adaptat pentru
ndeplinirea anumitei funcii biologice.
Proteinele acestei clase sunt mult mai
complexe dup conformaie dect cele
fibrilare, ndeplinesc funcii variate i
activitatea lor are un caracter dinamic. n
majoritatea lor proteinele sunt globulare.
Care sunt datele experimentale ce
confirm c anume conformaia molecu
lei e necesar pentru activitatea biologic
Figura 1.8. Scheletul moleculei de citocrom - n a p r o te in e i?
centru hemogrupa fixat covalent , mai intensiv ' _
colorat sunt aminoacizii invariani 1 S-a constatat c
sub aciunea ureei, la
nclzire, structura scheletului covalent
rrnne neschimbat, dar lanul polipeptidic
deine o conformaie neregulat i i pierde activitatea biologic.
2. La compararea lungumii lanului i diametrului spiralei cu mrimile reale ale proteinei
se constat c un lan polipeptidic din 584 aminoacizi are n -structur o lungime de
200 nm i grosime de 0,5 nm, n a-spiral - 90 nm lungime i grosimea de 1,1 nm,
globula acestui lan se cuprinde n lungimea de 13 nm i diametrul de 3 nm. Aadar,
lanul polipeptidic al albuminei este foarte bine mpachetat, n caz contrar nu ar ndeplini
funcia necesar.
Modul de mpachetare a catenelorpoli
peptidice n proteinele globulare ntr-o glo
bul steric e structura teriar. La forma
rea acestei structuri se evideniaz centrele
active, locusurile de fixare i identificare a li-
ganzilor ce detennin funcia proteinelor.
Concluzie: Dac structura secundar e
determinat de interaciunea resturilor de
aminoacizi n segmentele apropiate, apoi
cea teriar - de interaciunea lor din
segmentele deprtate. Un rol deosebit l are
i interaciunea R -grupelor catenelor
nvecinate.
O anumit importan structural n lanurile
F ig u ra 1.9. M odetui spaial al moleculei de polipeptidice au aminoacizii invariani ce
h zo zim a - m ai in te n s colorat su b stra tu l r r . '
polizaharidic. Lizozima e o m olecul fo a rte OCUp O p O Z lie S ta n d a r d 1 la n , i n d i f e r e n t d e
compact specia organismului respectiv (sursa proteinei).
Acetia se grupeaz la unghi, n locul fixrii grupelor prostetice.
La o rcire lent a soluiei proteice sau la evoluarea pi I spre normal, proteina i
restabilete funcia biologic (renaturaie), fapt ce confirm c infonnaia necesar pentru
mpachetare e determinat de structura primar. Proteina se mpacheteaz nu chiar simplu,
de exemplu: ribonucleaza n care se formeaz 4 puni disulfidice n aceleai poziii ca i n
cea nativ, teoretic, din 8 resturi de aminoacizi se pot forma 105 variante, dar se for
meaz numai una. Structura teriar nu-i rigid absolut, se caracterizeaz printr-un grad
de fluctuaie local i o anumit elasticitate. De exemplu, moleculele enzimei la legarea
substratului i schimb conformaia.
Proteinele se fonneaz din aminoacizi, cu o vitez mare. Proteina compus din 100
aminoacizi n 5 sec. i capt conformaia final. Dar dac s-ar cuta toate variantele, ar
fi nevoie de 105 ani. Procesul de asamblare are loc momentan, cu un grad mare de
cooperativitate. Aceasta nseamn c dac s-a mpachetat un segment mic, apoi
instantaneu crete probabilitatea aranjrii celorlalte segmente.
Dup uncie scheme structurale la nivelul organizrii teriare a moleculelor proteice, n
planul de asamblare e inclus un concept nou, care faciliteaz perceperea perfect a
raporturilor dintre structur i funcie, a organizrii pe domenii structurale. Prin cuvntul
domeniu se subneleg regiunile compacte cu organizarea teriar relativ rigid, separate
ntre ele de ctre segmentele mai puin organizate, care permit micarea unui domeniu
fa de altul (fig. 1 . 1 0 ).
Fiecare domeniu structural e responsabil de o anumit funcie a proteinei. Gradul de
flexibilitate a domeniilor variaz de la micri mai ample la altele mai restrnse, n
dependen de natura segmentelor interdomcniale. Domeniile se asociaz cu funciile de
legtur. Centrele active ale enzimelor sunt situate ntre domenii care i schimb poziia
unul fa de altul n procesul funcionrii biologice a proteinei. O alt proprietate foarte
important: domeniile cu structuri i proprieti similare suntprezente n diferite proteine,
exercitnd roluri asemntoare.
Multe proteine sunt alctuite din mai
multe lanuri polipeptidice i se numesc
proteine oligomere (hemoglobina e
constituit din patru lanuri i patru grupe
prostetice cu atomii si deFe) (fig.
1.11).
Fiecare lan (2a i 2) are structura
sa teriar, ocup poziia de tetraedru
unul fa de altul, formnd n ansamblu
s tr u c t u r a c u a te r n a r . Catena a con
tacteaz cu , interaciunea dintre ele (a-
a i -) fiind minim. Hemoglobina
animalelor are aproape aceeai structu
r te r t in r c i 1 n v n H m u l t n F igu ra 1.10. Imaginea schematic a unei
' 1 proteine compuse din 2 domenii. Centrul de fixare a
comun CUStructura mioglobinei, aceleai ligandului se afl ntre domenii
funcii. Cu certitudine, n cadrul
succesiunii aminoacizilor, proteinele omoloage conin un rnd de resturi de aminoacizi
invariani, 9 aminoacizi ocup aceeai poziie; e aceeai histidin distal i proximal, e la
fel de reprezentativ i interiorul nepolar al structurii.
Modul de asociere n spaiu a protomerilor - moleculelor oligomere - se atest
ca s tr u c tu r c u a te r n a r . La o asemenea protein funcia specific se manifest
numai Ia nivelul structurii cuaternare, protomerii separai sunt neactivi. Asamblarea
subunitilor se realizeaz prin fore slabe nccovalente i asocierea devine stabil dac
suprafeele de contact (ale domeniilor) sunt complementare, iar un numr ct mai mare
de atomi se apropie de nivelul razelor
Van der Waals. Complementaritatea
asigur un grad nalt de exactitate i de
specificitate a structurii cuaternare.
Interaciunea prin suprafeele de con
tact reprezint fenomenul de coopera
re, adic primele interaciuni favorizeaz
form area c e lo rlalte. S tru ctu rile
cuaternare permit funcionarea unor
mecanisme fine de reglare a activitii
proteinelor (forma T - tensionat i R -
relaxat). Perturbaia are loc la nivelul
unui protomer (Fe iese la 0 , 6 A din
planul hemului, la oxidare intr un plan -
histidin proximal avnd 15 contacte,
modific conformaia oligomerului, re- F ig u r a 1.11. M od elu l hem oglobinei
. .. .
structureaz spirala i unghiurile ei) (fig. - catene sunt colorate mai intensiv; a-catene sunt
] j2) celelalte; h - hemul n molecul (dup M. Perutz)
F igura 1.12. Modificrile conformafionale induse de deplasarea Fe la oxigenare. Structura
oxigenat e colorat mai intensiv dect cea dezoxigenat

Majoritatea proteinelor oligomere studiate, de regul, au un numr pereche de pro-


tomeri, situai bilateral simetric. Moleculele proteice nu sunt rigide, au o anumit flexibi
litate i manifestri diferite: de la micri simple njurul legturilor ordinare pn la fluctua
ii respiratorii. La fonnarea compuilor flexibilitatea scade. Vibraiile moleculare joac
un rol deosebit n procesul de depistare i stabilizare a strii tranzitorii.

FOLDINGUL. PROBLEM A MPACHETRII SPECIFICE


A LANULUI POLIPEPTIDIC
Au trecut mai mult de 40 de ani de la descoperirea tiinific a lui C. Anfmsen, dar i
acum sute de savani studiaz problema mpachetrii specifice a lanului polipeptidic.
S-a dovedit c a prezice conformaia proteinei n baza succesiunii de aminoacizi (innd
cont de proprietile lor, de solubilitatea n ap) nu e att de simplu. Problema are i
aspect practic: paralel cu dezvoltarea biotehnologiei i n baza reconstruirii genelor se
poate asigura sinteza noilor proteine.
S-a stabilit c la mpachetarea unor proteine imense iau parte i proteinele mult mai
mici, numite ciaperonine, ce se ntlnesc n bacterii, citoplasma celulelor eucariote, matrixul
mitocondrial. Sunt compuse din 2 elemente ce aparin diferitelor familii proteice - Hsp
60 (Gro EL) i Hsp 10 (Gro ES), mai substanial sunt studiate ciaperoninele la E.coli.
Gro EL e constituit din 14 subuniti identice, protomeri cu masa molecular 57 kDa
(548 resturi de aminoacizi), fiecare aranjai simetric cte 7. Analiza roentgenostruclural
a descifrat structura spaial a complexului. Fiecare protomer e compus din 3 domenii -
eucatorial, apical i intermediar.
Gro ES (co-ciaperoninele) sunt compuse din 7 protomeri identici aranjai simetric,
masa molecular a protomerului e de 10 kDa i conine 97 resturi aminoacide. Structura
spaial a protomerului prezint un nucleu de -structur pliant nconjurat de mici
structuri de a-elice (fig. 1.13).
Fiecare protomer n ciaperonine poate fixa cte o molecul de ATP. Au fost
determinate locusurile funcionale, unde are loc fixarea ATP, a polipeptidului substrat i
a Gro ES n Gro EL. Sunt constatate particularitile ciclurilor reactibile n ciaperonine la
formarea complexului activ funcional i fixarea substratului polipeptidic. Sunt propuse
diferite modele ale complexului, posibilele mecanisme de funcionare i asamblare a
proteinelor prin ciaperonine.
Complexul ciaperoninelor posed activitatea ATP-azic, se presupune c complexul
funcional activ e obligat s asigure condiiile cinetice primare pentru asamblarea proteinei
n afara ribozomului, n poriuni mai ndeprtate n citozolul celulei. S-a constatat c
fonnarca complexului activ necesit ionii de K+. Sunt date experimentale ce confirm c
in vivo asamblarea lanului polipeptidic n proteina activ are loc cotranslaional, adic
n acelai timp cu sinteza lanului n ribozom.
Cum are loc procesul de autompachetare a proteinelor?
Lanurile polipeptidice desfurate sau proaspt sintetizate sunt numite ghemuri
dezordonate. Studiul asupra proteinei denaturate a stabilit c n interiorul ei apar regiuni
rsucite, asociate ntr-un mod anume i diferite de ntreaga molecul. Aceste substructuri
(subdomenii) sau numai unele dintre ele sunt nestabilc, fluctuante, servind n calitate de
detonant (fitil), n jurul crora se fonneaz regiuni stabile structurale.
Despre starea denaturat a proteinei se tie mult mai mult dect despre cea desf
urat. Una din primele legiti ale mpachetrii const n faptul c contactul dintre
moleculele de H ,0 i aminoacizii hidrofobi trebuie, pe ct e posibil, s fie minim. A
doua legitate: globula proteic urmeaz s fie mpachetat compact, ns spaiul ci
trebuie s fie umplut astfel net atomii nvecinai s nu se intercaleze.
La momentul actual se disting dou concepii'.
Prima, mai puin pronunat, este cea care presupune c lanul polipeptidic
colapseaz rapid pn la dimensiunile finale ale globulei, cu ieirea aminoacizilor hidrofobi
din contactul cu apa. n starea dat molecula se reorganizeaz rapid, cptnd proprietile
ei de structur secundar i teriar (datele experimentale confirm aceast teorie).
A doua concepie, mai reuit, stabilete c lanul polipeptidic desfurat foarte
rapid formeaz segmente constante, limitate de structura secundar. Ele interacio-
ncaz i temporar se realimenteaz reciproc. Segmentele stabilizate, microdomeniile
respective transform conformaia moleculei proteice n direcia organizrii supreme
prin asociere cu alte segmente, favoriznd contactele dintre segmentele ndeprtate,
n stadiile tranzitorii se fonneaz intermediate, strucmri ce pot fi determinate foarte
greu, dat fiind existena lor de scurt durat.
Caracteristica structurilor vizate:
a) au dimensiuni mai mari dect molccula nativ i posed elemente fonnate de structura
secundar;
P roteina nou- Foldingul proteinei este com plet sau parial finalizat;
sinlelr/at echilibrul procesului este deplasat spre form area
.
P ro te in a nou-
conform aiei native finale
s in te tiz a t sc GroEL
P ro te in a n
ataeaz la GroF.L n co nform atic final
sitc -u l n cb lo c a t de
GroES

oldingul proteinei are loc n


interiorul com plexului
ATP e s te fix at de
Proteinei
s u b u n i t i l e ncconformat
com plet sunt legat
heptam crului G roEL
d in n o u ra p id
G roE L

H id r o liz a A T P-uhsi
d e te rm in e lib erare a a
14 ADP-uri i GroES

A GroES

(a) 7 ATP-uri i GroES


sunt ataate la GroEL
n site-ul localizrii
p ro te in e i

F igura 1.13. C iaperoninele n foldingu l proteinelor:


(a) mecanismul de aciune a ciaperoninelor E.coli GroEl (aparine familiei proteinelor IIsp60) i
GroES. Fiecare complex GroEL posed 2 site-uri formate din 2 inele heptamerice (masa
molecular egal cu 57 000 Da). GroES este, de asemenea, heptamer (masa molecular egal cu 10
000 Da) i poate bloca unul din site-urilc GroEL.
(b) suprafaa i seciunea complexului GroEL/GroES. n imaginea seciunii sc vede spaiul intern al
complexului, n interiorul cruia se amplaseaz alte proteine.
b) savanii au desfurat proteina nativ i apoi au realizat mpachetarea, oprind-o la
diferite etape; au identificat intermediatele dup formarea legturii S-S, ce apreau n
procesul de mpachetare i apoi dispreau pe neobservate n molecula nativ.
S-a demonstrat c unele fragmente formeaz asociaii temporare, altele stabile,
i se pstreaz n globula nativ, avnd un rol fundamental la iniierea procesului dc
mpachetare a lanului. Intermediatele au fost studiate prin metoda izotopilor.
Hidrogenul din grupele peptidice a fost nlocuit cu deiteriu prin incubaia lanului
polipeptidic n ap grea. Apa grea substituit apoi cu cea obinuit favoriza includerea
hidrogenului n legturile neformate, i n continuare, procesul avansa pn la finisarea
deplin. Identificarea regiunilor cu deuteriu a developat fragmentele moleculelor ce
se mpachetau n primul rnd. Aa s-a stabilit consecutivitatea fomirii intermediatelor.
S-a confirmat c n citocromul are loc asocierea primar a dou spirale n capetele
opuse ale lanului polipeptidic. n ribonucleaz, la nceput, se formeaz -structura
situat n centrul moleculei.
mpachetarea poate fi determinat i prin metode matematice, cu utilizarea funciei
energiei poteniale. n computer se introduc valorile n cifre care caracterizeaz forele
de atracie ntre perechile de atomi ai moleculei din lanurile polipeptidice. Apoi se
iau coordonatele atomilor la care energia total a moleculei se micoreaz pn la
minim (n eventualitatea c structurile finale au energie minim). Studiile recente
elucideaz posibilitatea precizrii structurii teriare dup succesiunea aminoacizilor.
O serie de investigaii confirm faptul c pentru mpachetare sunt necesari factori
spaiali i interaciune hidrofob. Rolul diferitelor fore variaz de la o protein la
alta. E posibil c forele electrostatice joac un anumit rol la stabilizarea conformaiei
finale, dar nu i la formarea ei.
Rezultanta final a foldingului este conformerul nativ ce posed activitate biologic.
Un domeniu cu o structur stabil secundar care se fonneaz primar, comparativ cu
cealalt parte a moleculei, e numit foldon.
Asamblarea proteinelor se consider un proces fizic de o valoare biologic deosebit.
Modelarea computerizat a procesului confinn c asamblarea demareaz de la lanul
desfaurat care fluctueaz mult timp far formarea unor contacte native eseniale. Apoi
lanul atinge ntinpltor starea n care persist un ansamblu de contacte native. Dup
aceast situaie, procesul de asamblare decurge foarte rapid pn la starea final - fonnarca
structurii native.
Se consider c un pas-limit n asamblarea acestor catene este formarea primar a
unui complex de contacte native (nivelul asamblrii), care, fulgertor, influeneaz toat
molecula. Acest nucleu nu e identic cu strile intermediare. S-a consolidat ideea c:
a) asamblarea ncepe cu formarea unui complex determinat de contacte native;
b) resturile ce se ihelud n acest nucleu sunt aranjate la diferite distane n lan.
Studiile au stabilit c nucleul asamblrii este constituit din resturi nefuncionale
mai conservative - proteinele legate evolutiv posed 2 complexe de resturi
conservative: unul pentru centrul funcional i altul pentru nucleul de asamblare.
Asamblarea confonn conotaici totul sau nimic corespunde mecanismului nucleaiei
i creterii i e tipic pentru proteinele foarte mici. Asamblarea proteinelor majore trece
prin stri intermediare. Una dintre ele este i globula n fuziune ce sc caracterizeaz prin
stare intermediar compact cu structur nativ asemntoare, dar fr structur teriar
rigid, prin lipsa de cooperativitate la temperatura de topire i micrile intramoleculare
rapide. O stare asemntoare e proprie i intermediatelor.
S-a demonstrat c n globula n fuziune, molecula proteic pstreaz unele particulariti
ale topologiei native (aranjarea reciproc a a i structuri), aranjarea rigid a catenelor
proteice. Aceasta clasific globula ca intermediat ntre catena desfaurat i starea
nativ, stare termodinamic ntre cele dou. Se presupune c molecula proteic poate
exista n trei stri: nativ, globula n fuziune i cea desfaurat.
S-a stabilit c globulele n fuziune, genetic, sunt un intermediat universal pentru
asamblarea proteinelor.
Aadar, prin f o l d i n g se subnelege aranjarea spaial corect de novo a catenei
proteice, iar r e f o l d i n g u l presupune aranjarea spaial dup denaturare.
Studiile contemporane confirm c proteinele auxiliare pot fi mprite n 2 grupe:
ciaperonine moleculare i enzime. Prima grup constituie o clas funcional de
proteine neomogene, care favorizeaz asamblarea corect necovalent a altor structuri
polipeptidice in vivo, nefiind componente ale acestor structuri organizate, ce i ndeplinesc
funciile biologice. Sunt evaluate multe proteine cu funcii asemntoare - proteinele ocului
termic formeaz o grup mare de ciaperonine.
Enzimele denumitefoldaze catalizeaz modificrile covalente, strict necesare la
formarea conformaiilor native funcionale ale diferitelor proteine. Deocamdat sunt
identificate 2 enzime ca foldaze -proteindisulfid izomeraza (PDI) ce catalizeaz formarea
legturilor native disulfidice ipeptidil-prolil-cis-trans-izomeraza (PPI) ce catalizeaz
izomerizarea unor legturi stabile trans-peptidil-prolil n cis-conformaie, necesare pentru
asamblarea funcional a proteinelor. Ambele sunt reacii covalente, rcacii-limite n etapele
foldingului proteinei corespunztoare. Procesul de Folding i formarea disulfidelor native
sunt procese strns legate ntre ele i decurg simultan.
S-a constatat c PDI prezint nu numai o izomeraz ce catalizeaz formarea legturii
disulfidice n peptidele sintetizate, dar i o ciaperonin molecular, ce particip la procesul
foldingului catenelor. Activitatea ciaperoninic nu e dependent de cea izomerazic.
Funcionnd ca foldaz n procesul de folding, este necesar att activitatea izomerazic,
ct i cea ciaperoninic.

PEPTIDELE ACTIVE
Endotelinele reprezint o familie de peptide noi cu o activitate biologic deosebit.
In 1988, M. Yanagisawa i alti savani au cptat din cultura endoteliului vascular un
peptid cu un efect biologic foarte pronunat, numit endotelin. Timp de zece ani s-a
efectuat un studiu amplu referitor la peptida respectiv, receptorii ci, enzima - endotelin
convertaza i inhibitorii ei.
Endotelinele sunt cei mai efectivi factori vasoactivi. Sunt implicate n patogenia
unor forme de maladii hipertonice, ischemii renale, hemoragii subarahnoidale. Este
determinat rolul lor n infarctul miocardic, aritmiile cardiace.
De rind cu endotelin-1 (ET-1), un peptid biciclic din 21 aminoacizi, s-au depistat i
alte 2 izoforme - ET-2 i ET-3, codificate probabil de gene diferite. Aceste peptide sunt
marea speran a savanilor pe viitor! Toate trei endoteline n mod diferit sunt expresate
n esuturile vasculare. Primele dou au o activitate major de vasoconstrictori.
Sunt donate i secvenate 2 tipuri de receptori (ET-A i ET-B), care s-au depistat att
n endoteliul vaselor, ct i n rinichi, plmni, suprarenale, esutul nervos. Constricia
vaselor e mediat de ET-A receptori, structuri fixatoare de G-protein; pe cnd inducia
receptorilor ET-B conduce att la constricia, ct i la dilatarea vaselor. Funcia acestor
receptori e cuplat cu activarea fosfolipazei i A,, cu majorarea nivelului de Ca2+
intracelular, fonnarea intensiv a prostaciclinei i/sau tromboxanului Ar ET-1 i ET-3 n
esutul nervos intensific sinteza fosfoinozitfosfatului.
ET-1 apare ca rezultat al proteolizei limitate a endotelinei majore - (B = ET) n trei
etape:
a) hidroliza protcolitic a preproendotelinei-1 la Arg(92) n endotelina-l-Lys-
Arg (40) sub aciunea convcrtazei (E,);
b) hidroliza captului -terminal = ET-1-Lys-Arg(40) la = -38) de o
carboxipeptidaz (EJ;
c) scindarea premergtorului B-ET-1 la legtura Trp(21) = Val (22) cu formarea
endotelinei ET-1, etap determinat de convertaza respectiv (E3).
Schematic:
Pre-Pro-ET-1 B=ET-1 -Lys-Arg(40) B-ET-1 (38)
, Endotelin-1
E 3 (enzima endotelin convertaza - ECE-1) este o metalproteinaz din grupa celor
fixate n membran, care particip n procesingul postsccrctorial al hormonilor peptidici
i neuropeptidelor. Are unele proprieti asemntoare cu familia Z\r - metaloproteazelor.
n centrul activ este restul Tyr i regiunea fixatoare de Zn2+.
E depistat enzima ECE (endothelin-converting enzyme) n majoritatea esuturilor.
Activitatea ei e determinat att prin metode imunochimice, ct i prin testare biologic.
Ea prezint un dimer cu subunitile de 120-130 kDa fixate prin puni disulfidice. Splaisingul
alternativ a demonstrat variante ale ECE c grupa N terminal e diferit, cu o specificitate
selectiv la substraturi. ECE-1arc o specificitate mare la B-ET-1 i mult mai puin efectiv
la ET-2 i ET-3. Aceste date presupun prezena enzimei n mai multe izoforme ale ECE-
1 ( 1 a i l).
ECE-2, o alt endotelin convertaz, n 59% e omoloag cu ECE-1 - o expresie
major e depistat n esuturile creierului. Ambele enzime au structuri de baz comune:
sunt proteine integrale membranare de tip II, ce conin o secven cu Zn2 caracteristic;
au 1 0 site-uri glicozil, cu o localizare nu chiar identic, sunt inhibate de aceiai inhibitori
cu diferit sensibilitate.
ECE-2 hidrolizeaz B-ET-1 mai efectiv dect B-ET-2 i B-ET-3. Dar cea mai
esenial deosebire e pH optim pentru forma 2, care este egal cu 5,5, i enzima e
neactiv la valori neutre, optime pentru ECE-1. Prezena, de asemenea, a ECE-2 n
esuturile neendoteliale demonstreaz c acest ferment funcioneaz ca enzim extra- i
intracelular, responsabil de hidroliza intravezicular a precursorului ET-1, sintetizat n
aparatul Golgi. Cele prezentate presupun 2 tipuri de sintez a endotelinelor: extra i
intracelular.
Sunt depistate i enzime ce degradeaz fiziologic endotelinele mature-
metaloendopeptidaza cu pH optim de 5,5; endotelinaza (serin proteinaza).
Endotelin i, corespunztor, ECE regleaz tonusul vaselor i, n general,
cardiohemodinamica. Peptidul particip la patogenia hipertensiei eseniale - inhibitorii
ECE previn dezvoltarea hipertensiei pulmonare n experiment. Efectele sunt
dependente de funcionarea sistemului renin-angiotenzin.
S-au depistat unele efecte neurologice ale ET-1 i ET-3, modificri n reaciile de
comportare, efect central cardiorespirator.
n prezent se presupune c endotelinele, de rnd cu ali reglatori ca histamina,
bradikinina, angiotensina II, particip la relisingul difereniat al adrenalinei i/sau
noradrenalinei din suprarenale n stres (situaii extremale). Esenial e rolul lor n
reglarea strii funcionale a endoteliului - stratului intim arterial i venos din diferitele vase
ale organismului. Dereglrile metabolismului nonnal al endotelinelor, expresia intensiv a
precursorilor i receptorilor respectivi, activitatea major a ECE devin factori de dezvoltare
a proceselor patologice din organism, motiv care impune investigarea unor metode de
control i de reglare a activitii lor n organism - inhibitorii metaloproteazelor. Inhibitor
clasic se consider fosfoamidonul. Mult mai activ este analogul tiorfanului. n baza
compuilor acidului fosfonic s-au sintetizat inhibitori ai ECE, foarte puternici i selectivi.
Sunt utilizai i analogi ai ET-1, care blocheaz activitatea ECE att in vitro, ct i in vivo.
n ultimii ani se confirm c unele peptide cu o structurfoarte simpl, predominant
din glicin iprolin (PG, GP, PGP, GPGG), posed o activitate biologic deosebit
referitor la coagularea sngelui, aciunea protectoare a mucoasei, nociceptie. La aceste
peptide se altur i PGc (ciclic) depistat n creier. O particularitate deosebit a acestor
fragmente, ce conin prolina terminal, este stabilitatea major n fluidele organismului
fa de altele (de mii de ori).
Aceste peptide au ca surs i alimentele, cci e stabilit c tripeptidele ce conin
prolin sunt absorbite de celulele endoteliale intestinale nescindate. Un precursor al
lor poate fi i enterostatina (APGPR), precum i colagenul i elastina.
Compartimentalizarea strict a proceselor permite realizarea unor funcii diametral
opuse, de exemplu, acidul glutamic, glicina, care ndeplinesc att rol plastic, ct i energetic
i servesc drept neurotransmitori. Asemenea compartimentalizare e real i pentru
precursorii peptidelor reglatoare (PR). Determinant poate fi esutul, organul, precum i
repartiia local a proteazelor.
S-a stabilit c aceste peptide blocheaz agrcgaia trombocitelor, formarea
trombinei i a fibrinci; sunt inhibitori ai fibrinazei (XIIIa). Posibil c aceste pcptide
simple ce conin prolin (fragmente ale colagenului i elastinei) sunt factori endogeni
cu aciunc de antitromboz i trombolitic.
Prolincomponentele peptidice, POP i GPGG, amplific rezistena mucoasei
gastrice la aciunea factorilor nocivi, devenind protectori antiulceroi. Este inhibat
endo- i exosecrcia pancreasului, motorica stomacului, utilizarea alimentelor (anorexia)
de enterostatin (pentapeptida APGPR).
Peptida GPc are efect stimulator n consolidarea memoriei, posibil se fonneaz
din colagen sau elastin.
Peptidele scurte, ce conin prolin, sunt activatori ai hemotaxisei, favorizeaz
formarea superoxidului, neutralizeaz analgezia provocat de morfin. Comparnd structura
peptidelor respective, se presupune dependena efectului dc prezena prolinei la captul
N-sau C-tenninal al peptidei.

Carnozina - dipeptida -alanil-L-histidina, extras n anul 1900 din muchiul


scheletal. n prezena acestei dipeptide, muchiul izolat de broasc se contract ca i la
acumularea cantitilor mari de lactat; pi a camozinei este de 6,9, iar a anserinei - 7,1
- ultima este derivatul ei metilat. Accti compui sunt ideal adaptai pentru rolul de tampon
n regiunea fiziologic a pH - au o cot pn la 40%.

I I CH2 CH NH C CH 2 C H ; NH :

N ^ N H COOH Camo*ina
Capacitatea tampon protonic mrimea - se msoar n slake i se determin
dup numrul de mkmol NaOI I sau HC1, necesari pentru a modifica pH a 1 g esut cu o
unitate - de la 6 la 7 sau 6,5 - 7,5. Se consider c i peptidele nrudite iau parte la
reglarea activitii enzimatice, la diminuarea reaciilor oxidante.
Datele experimentale confinn c carnozina prezint un antioxidant multifuncional,
capabil s inactiveze radicalii liberi, s formeze compui chelai cu metalele prooxidante
(Cu) i posed capacitatea de a fonna conjugate cu produse aldehidice toxice de oxidarc
a lipidelor. n prezena camozinei, limita Heiflikse extinde - celula din cultur mbtrnete
mult mai lent. Posibil, e i rezultatul unic al efectului diferit al camozinei ca: izvor al histidinei,
imunostimulator i neurotransmiter etc.
Glicozilarea nefennentativ a proteinelor este un proces dependent de vrst, activ n
diabet. Formarea legturilor transversale ntre polipeptidele modificate i proteinele
normale este cauza complicaiilor n diabet. S-a confirmat c carnozina este un agent
antiglical natural, ce se conine preponderent n muchii albi cu o glicoliz intensiv.
Carnozina indus de aldehida malonic inhib formarea n proteine a legturilor
transversale, precum i fonnarca gruprilor carbonilice n proteine, specifice la mbtrnirea
proteinelor i celulelor. Carnozina e capabil s reacioneze cu metil-glioxalul i, indus
de el, prentmpin modificrile proteice. Carnozina protejeaz celulele de aciunea toxic
a aldehidelor i cetonelor.
Proteinele glicate sunt imunogene, iau parte la generare n procesul de mbtrnirc a
autoantigenelor. E stabilit c carnozina glicat nu e mutagen, spre deosebire de
aminoacizi. Ea inhib reacia de glicare a lizinei, moduleaz toxicitatea produsului pentru
cultura celulelor.
mbtrnirea proteinelor este nsoit de acumularea polipeptidelor aderante,
ndeosebi ale celor ce conin grupa carbonil. Ultimele apar ca rezultat al oxidrii radicalilor
aminoacidici de FAO, precum i la interaciunea produselor oxidrii lipidelor- aldehida
malonic i hidroxinonenalii - cu lizina i n al treilea rnd, n procesul de glicare n care
aldehidele toxice induc fonnarea gruprilor carbonil n proteine.
S-a constatat c carnozina nu doar se fixeaz de gruparea carbonil din proteine, dar
i moduleaz activitatea lor, inhibnd formarea legturilor transversale n proteine, ca
rezultat al generrii complexului protein-carbonil-camozin aduct.
Deocamdat nu e clar unde anume are loc fonnarca acestui complex: n interiorul
celulei sau n afara ei?
Care este soarta proteinelor camozilate?
Posibil c reprezint o fonn a lipofuscinei - pigmentul mbtrnirii. Lipofuscina
are o natur foarte heterogen i efectele ei sunt controversate. E enorm de mult n
esuturile bogate n camozin- nervos i muchi, creier. Posibil c forma lipofuscinei fr
carnozina e capabil s reacioneze cu alte macromolecule celulare.
O alt variant ar fi proteoliza - scindarea de un sistem deproteozome. Carnozina
mascheaz gruprile carbonil, care sunt rezistente i chiar pot inhiba funcia proteozomelor.
S-a constatat c n prezena camozinei se activeaz metabolizarea unor proteine greu
metabolizante.
Grupele carbonil se fonneaz i la oxidarea fosfolipidelor (etanolamina) meinbranare.
La depurinizare i depirimidinizare a DNA, cu scindarea legturilor glicozidice, se
formeaz o molecul de D-oxiriboz cu proprieti toxice aldehidice. Carnozina fixeaz,
posibil, i aceste fonne toxice, inhibnd formarea legturilor transversale protein - DNA,
cu participarea aldehidelor, i micoreaz numrul de aderaii cromozomiale n cultura
celular. Carnozina favorizeaz procesele de detoxifiere. O dat cu mbtrnirea,
concentraia camozinei se micoreaz: nivelul coreleaz cu durata vieii. Indivizii care au
o statur nalt sunt asigurai cu longevitate mai mare.
Biosinteza camozinei: se sintetizeaz din -alanin i histidin, rea CpCcatalizat
de carnozin sintaza. -alanin aminoacid neproteinogen se produce n ficat ca
mctabolit final n degradarea uracilului i a timinei. Celulele capabile de sintez posed i
un sistem benefic de transport al acestui aminoacid. Cu ct celulele sunt mai difereniate,
absorbia -ala este mai efectiv. n oligodendrocite viteza maxim de sintez corespundc
capacitii majore de expresie a proteinei - mielina - marker al diferenierii
oligodendrocitelor n creier.
Carnozina e legat de cclulele neurogliei, care pot absorbi rapid carnozina marcat
pi int-un mecanism activ de transport al dipeptizilor. E prezent carnozina n neuronii
senzitivi, mpreun cu acidul glutamic, ce marcheaz rolul de neuromediatorn acest
proces. n secreie se consider c sunt prezente mai multe mecanisme (depolarizare
membranar, tumefierea astrocitelor cauzate de ionii K~, inversarea mecanismelor de
transport). Se confirm mecanismul vezicular, exocitoza determinat de Ca2+.
Carnozina este un inliibitor selectiv al NO-dependent-activare a guanilatciclazei, ce o
poate utiliza ca remediu efectiv la tratarea sepsisului, cancerului, astmului, migrenei, toate
fiind legate de activarea sistemului de semnalizare intracelular: NO-Gc solubil- GMPc.
Hidroliza camozinei e cauzat de 2 izoenzime: 1) camozinaza tisular (citozolic) i
2) cea seric (KF.3.4.13.3 i KF3.4.13.20). Forma tisular e zincodependent i poate
fi stabilizat de alte metale bivalente (Cd >Mn Z n C o ).
Carnozina mrete de 2-3 ori longevitatea celulelor cultivate in vitro. E stabilit
efectul de ntinerire a celulelor senile. Carnozina distruge celulele transformate sau
cancerigene. n amestec cu piruvatul (acidul oxaloacetatul i a-cetoglutaratul), efectul se
micoreaz. Citralul, izocitratul, fumaratul, succinatul i malatul nu influeneaz asupra
efectului citotoxic al camozinei.
Efectul camozinei poate consta n:
a) diminuarea gradului sau exprimarea efectelor care conduc la includerea
mecanismelor ce blocheaz ciclul celular. De exemplu: poate favoriza micorarea lungimii
fragmentelor pierdute n DNA-telomeric sau diminueaz metilarea DNA;
b) micorarea efectelor fiziologice determinate de modificrile n RNA, ce ar favoriza
ndeprtarea momentului de oprire tenninal a diviziunii celulelor. Un astfel de efect s-ar
manifesta n ntinerirea fenotipului celular, care se observ la cultivarea cclulclor in vitro
cu camozin. Carnozina, posibil, inhib glicoliza, de altfel i fonnarea de ATP n celulele
cancerigene. Acest efect e reversibil la adaosul piruvatul ui.

CLASIFICAREA PROTEINELOR
Savanii M. Levitt i C. Chothia (1970), examinnd structura proteinelor, le-au divizat
n 5 clase (fiecare clas difer dup prezena i poziia -spiralei i -structurii
(fig. 1.14, a-h)):
I. Proteine ce conin 100% a-elice, formnd o structur globular.
II. Proteine ce conin -structur i, de regul, sunt alctuite din dou straturi
antiparalele sau situate n form de butoiae.
III. Proteine ce includ att a, ct i componente segregate n structura teriar.
IV. Proteine ce nglobeaz a / segmente alternate n structura secundar, formnd
structura teriar cu centrul i ncercuite de a-spiral.
V. Proteine neorganizate cu structur secundar evideniat nesemnificativ. Plie
rea lanului este determinat n exclusivitate de interaciunea radicalilor (coit pro
teic) - punilor disulfidice. Acestea sunt proteinele mici.
Clasificarea sus-numit a fost desvrit de J.S. Richardson (1981).
Aadar, organizarea structural este determinat de modul aranjrii reciproce a
structurilor secundare. De aceea, un imperativ primordial pentru prognosticarea structurii
proteinelor o au principiile de mpachetare a elementelor constituente. Se tie c un rol
deosebit n accst context l joac repartiia resturilor hidrofobe n a-elice i -
stmetur.
Proteinele se mai clasific (W. Bennet i R. Huber, 1984) i dup dinamica dome
niilor structurale:
I. Proteine cu domenii rigide, imobile, dure, unite prin segmente mari, flexibile, ce le
permit acestora fluctuaii n diapazon larg reciproc.
II. Proteine cu domenii rigide, dure, unite prin poriuni mici, denumite Balama, cu o
circulaie mai redus.
. Proteine n care domeniile au roluri diverse - folosesc flexibilitatea pentru asigurarea
unor funcii (de legare); interacioneaz cu grupri determinate de antigen.
Clasificarea proteinelor e o problem dificil, deoarece structura multor protei
ne nu este studiat complet. O clasificare a proteinelor dup funcie e practic imposibil.
Exist proteine cu structuri apropiate, dar care ndeplinesc funcii diferite. Posibiliti
limitate de clasificare prezint i proprietile fizico-chimice.
Dup atitudinea fa de hidroliz se disting proteine simple i proteine conjugate
(proteide). Proteinele simple la hidroliz elimin numai aminoacizi, iar cele conjugate mai
conin i un component neproteic i, deci, deosebim: fosfoproteide, cromoproteide,
nucleoproteide, glico-, lipo-, metaloproteide.
Holoproteinele (proteine simple). Protaminele au o mas molecular mic i un
caracter alcalin, determinat de prezena argininei i lizinei - 60-80%, fiindu-le caracteristic
punctul izoelectric ce se afl n mediul alcalin i la fierbere se coaguleaz la adaosul bazei
n soluie. Proteinele sunt solubile n ap, se dizolv i n soluie de NH4, soluii diluate de
acizi i baze. Aceste proteine se gsesc n cantiti mari n celulele gemiinale naturale ale
petilor: salmina (lapii somnului), scumbrina (scrumbia), clupeina (heringul), n
componena lor triptofanul lipsete. Aminoacizii ce conin sulf n majoritatea lor nu includ,
de altfel ca i tirozina, i fenilalanina.
Histonele din componena nucleului celular iau parte la reglarea metabolic a activitii
genomului. Aminoacizi bazici se conin pn la 30%. Masa lor molecular e mai mare
dect la protamine, conin puin sau deloc triptofan. Sunt solubile n aceiai solveni i
precipitate de soluia NH4, se coaguleaz la nclzire.
Albuminele iglobulinele prezint masa principal a proteinelor sanguine, a lactate
lor, masei musculare, a proteinelor oului. Raportul albumine-globuline n diferite esuturi
rmne constant i este egal cu 1,5-2,3. n patologie acest coeficient se schimb. Albuminele
sunt mai solubile n ap, pe cnd globulinele sunt solubile numai n soluii diluate de sruri,
iar n celelalte cazuri insolubile. Solubilitatea diferit folosit pentru fracionarea i
detemiinarea lor n practica clinic. Pentru ultimele scopuri azi se folosete electroforeza
pe hrtie sau n gel, la cantiti nensemnate de snge. Albuminele conin 575 aminoacizi,
formnd un lan polipeptidic, au un punct izoelectric mic. Ele detennin presiunea oncotic
a sngelui, iau parte la transportul substanelor, prezint o fracie omogen. Globulinele
formeaz o fracie heterogen, fiecare comportnd diferite funcii.
Glutelinele i prolaminele sunt proteine de natur vegetal, se depoziteaz n
seminele cerealelor, masa principal a glutenului.
Prolaminele sunt solubile n soluie apoas de alcool etilic (60-80%). Conin 20-25%
acid glutamic i 10-15% prolin. Reprezentanii prolaminelor sunt: gliadina (gru), zeina
(porumb), orzeina (orez), hordeina (orz).

,
F igura 1.14. Tipologia unor structuri proteice:
a - spiralele sunt n form de cilindre i spirale;
- structura e reprezentat prin sgei;
a)protein n a - structur (miohemeritina);
b) protein n - structur (Cu, Zn-superoxiddismutaza);
c) a / structur (2 proiecii ale domeniului NA D din LDH);
d) Itemaglutenina virusului gripei;
e) a / structur (triozofosfatizomeraza);
f) CAP din E. coli;
g) a+ structur (lizozim);
h) neuroaminidaza virusului gripei.
Heteroproteidele (proteine conjugate) conin, pe ling compui proteici, diverse
grupe neproteice numite grupe prostetice. Acestea sunt mai profund studiate. Ele sunt
indispensabil legate de protein i prezint un anumit interes biologic.
Nudeoproteidele sunt compuse din proteine i acizi nucleici. Denumirea lor e
derivat de la numirea nucleului celular, dar se afl i n alte compartimente ale celulei. De
aceea nudeoproteidele constituie o clas individual de substane organice, cu o
componen, structur i funcie independent de localizarea lor n celul. Astzi putem
afirma c natura proteinelor studiate n celul e determinat de un reprezentant al
nucleoproteinelor - DNA.
Proprietile organismelor vii, ale celulelor i ntregului organism sunt detenninate ns
de proprietile proteinelor sintetizate. La hidroliza perfect se observ descompunerea
nucleoprotcidelor n proteine i acizi nucleici. Componena proteic o alctuiesc histonclc
bogate n arginin i lizin. Natura proteinelor nu este suficient studiat.
Cromoproteidele sunt compuse din compartimentul proteic i cel neproteic colorat,
de unde provine i denumirea lor; iau parte activ i obligatorie la procesele de acumulare
a energiei, ncepnd cu fixarea energiei solare n plantele verzi, utilizarea ei judicioas de
ctre organismul animalelor i al omului: fotosintez, respiraia celular, transportul 0 2 i
CO.,, reaciile de oxido-reducere, senzaiile de lumin i culoare etc.
Reprezentani: clorofila, hemoproteidele, sistemul de citocromi, catalaza, peroxida-
za. La baza structurii grupei prostetice se afl inelul porfirinic, care adiioneaz elemente
chimice diferite (Fe, Mg).
Fosfoproteidele sunt proteine compuse dintr-o parte proteic i acid fosl'oric.
Accstor molecule Ie sunt proprii legturi esterice ale acidului fosforic cu proteina
ce se adiioneaz prin OH al aminoacizilorserina, treonina.
Reprezentanii proteidelorcazeinogcnul (proteina laptelui), fosfovitina, vitelina, vitelinina
(din glbenuul oului), ihtulina (icre de pete)ocup un loc deosebit n compuii ce conin
fosfor, muli dintre acetia se gsesc n sistemul nervos central. Fosfatul labil e absolut
necesar pentru funcionarea celulei i exerc itarea menirii sale biologice. n procesul de
embriogenez, de cretere postnatal i dezvoltare servesc drept material preios energetic
i plastic. Un ir ntreg de enzime, ce regleaz procesclc de metabolism celular, se
caracterizeaz prin legtura strnscu fosforul.
Glicuproteidele, ca exponeni ai grupei prostetice servind glicoaminglicanii, se
includ n esuturi i n form liber. Legtura cu glucozamina, galactozamina com
puilor proteici se realizeaz prin asparagin, serin, treonin. Componena glucidic
determin rolul biologic al glicoproteidelor indispensabili de existena membranelor
celulare, participnd la rcaciile imunologice, schimbul de ioni, adeziunea intercelular.
Lipoproteidele, ca grup prosteic, sunt reprezentate de lipide neutre, acizi grai
liberi, fosfolipide, colesterol, cu funcii variate. Fiind compui ai membranelor cclularc i
organitelor, pot exista i n form liber n plasma sngelui.
Metaloproteidele metalul este legat complex de resturile de aminoacizi (transferi-
n, ceruloplasmin, feritin). Aici se includ i unele proteine enzimatice ca anhidraza
carbonic (Zn), ascorbatoxidaza (Cu) etc.
PROPRIETILE GENERALE ALE PROTEINELOR
Proteinele sunt compui macromoleculan cu proprieti hidrofile, adic sunt solubile.
Aceast nsuire se datoreaz repartizrii pe suprafaa moleculelor a resturilor de
aminoacizi cu sarcini electrice sau a grupelor polare. Proteinele fbrilare sunt insolubile n
ap, pe cnd cele globulare atest grade diferite de solubilitate.
Solubilitatea proteinelor
Solubilitatca n ap este puternic influenat de diverse sruri ale metalelor uoa
re: NaCl, MgCl2, Na2 S 0 4, (NH 4 )2 S 0 4. n concentraii mici ele au un efect favorabil.
De exemplu, globulinele sunt greu solubile n apa pur i se dizolv uor numai n
soluii saline diluate. Efectul nu depinde de natura srii, dar dc concentraia ei i de
numrul de sarcini ale fiecrui ion din soluie. Mai eficace sunt srurile ce conin ioni
bivaleni (Mg), fa de cele ce au ioni monovaleni. Solubilitatea mrit e determinat de
creterea gradului de disociere a grupelor ionizate n proteine.
n concentraii foarte mari srurile amintite reduc solubilitatea proteinelor pn
la precipitarea lor din soluie - salifiere. Procesul e mai efectiv n punctul izoelectric
al proteinelor. Mecanismul e complicat: ionii de sare atrag moleculele de ap
polarizat, micornd cantitatea de ap ce interacioneaz cu proteina, cauza fiind
concentraiile mari de sare n care numrul ionilor este imens fa de numrul grupelor cu
sarcin a proteinei. Dar avnd n vedere c solubi 1itatea proteinelor n ap este dependent
de formarea membranei apoase n juml grupelor ionice hidrofile, transferul molecular de
ap la ali ioni micoreaz solubilitatea proteinei. Procesul decurge mai rezultativ atunci
cnd toate operaiile se efectueaz la temperaturi joase, n condiiile n care proteinele
sunt mai stabile.
Diferite proteine se salifieaz la diferite concentraii de sruri fenomen ce este
utilizat pentru fracionarea lor. Globulinele precipit cnd soluiile care le cuprind sunt
aproximativ semisaturate n (NH4 )2 S 0 4, pe cnd albuminele precipit la concentraii mai
mari de 75% saturaie.
Procesul de salifiere a proteinelor n multe cazuri nu e legat de pierderea capacitii
proteinei de a se resolubiliza dup nlturarea agentului. Eliminarea prin dializ a
(NH4 ) 2 SO, sau Na - sulfat complet conduce la resolubilizarea n ap a proteinei salifiate
cu formarea soluiilor adecvate. Capacitatea de resolubilizare rapid se menine i n
cazul nlturrii imediate a proteinei de la salifiat (alcool): proteina i pstreaz proprietile
native.
Soluiile n ap a proteinelor au un caracter coloidal. Diametrul unor astfel de
particule e de la 1 la 100 n m . Remarcm soluii reale:
a) ioniceparticulele sunt mai mici dect 1 nune, disociaz n ioni, conduc curentul
electric;
b) molecularese descompun pn la molecule, nu disociaz i nu conduc electricitatea
(glucoza, alcoolul)dau spaiu optic nul.
Dac particulele sunt mai mari de 100 ininc i substana rmne solid n faza lichid,
rezult suspensia, iar cea lichid n lichid - emulsie.
Pentru soluiile coloidale (dar proteinele formeaz soluii coloidale) e caracteristic:
a) fenomenul lui Tindal pozitiv;
b) nu di fundeaz prin membrane semipermeabile, care uor transfer apa sau sub
stanele micromoleculare. Procesul e numit dializ i st la baza funcionrii aparatului
rinichiului artificial. Majoritatea membranelor biologice normale nu sunt penneabile pentm
proteine;
c) substanele ce fonneaz soluii coloidale nu se cristalizeaz la mrirea concentra
iei, dar genereaz precipitat amorf. Proteinele pot forma cnstale numai n anumite condiii,
din soluia-mam;
d) soluiile coloidale au o viscozitate mrit ce depinde de masa i fonna mole
culelor. Proteinele de aceeai mas molecular, dar cu molecule asimetrice, au o viscozitate
mult mai mare. Substanele coloidale interacioneaz cu apa. n proteine grupele ionogenice
leag apa: COOI I - 4 molecule de H 2 0 , NH2- 3 molecule, OH i NH - cte 2 molecule;
e) viteza de difuziune e foarte mic. Difuzia este procesul sumar de transfer al
moleculelor dizolvate sub influena gradientului de concentraie. Coeficientul de
difuzie depinde de mrimea i fonna moleculelor, de rezistena detenninat de vis-
cozitatea solventului. Procesul de difuzie constituie baza funcionrii celulei,
transferului de substane. Viteza difuziei i distana la care pot fi transportai diferii
metabolii n celul sunt parametrii principali ce limiteaz metabolismul n celulele
vii i organitele lor;
f) soluiile coloidale n concentraii mari au o presiune osmotic mic. Ea depinde de
numrul particulelor dizolvate n unitate de volum, dar nu de natura lor;
g) au tendina de a fonna diferite complexe moleculare;
h) sunt capabile de absorbie i singure se supun absorbiei;
i) se tumefiaz i se coaguleaz.
Soluiile coloidale capt fonna de so lsoluie lichid cu o anumit fluiditate i
compoziie de gel, pierzndu-i fluiditatea dm cauza fonnrii structurii de reea intern cu
fixarea apei. Atare structuri apar: 1) la tumefierea xerogelului (agar-agar, clei, gelatin);
2) n unna polimerizrii fibrinogenului; 3) n urma condensrii amidonului, gelatinei.
La nvechirea gelului are loc sinereza, proces de expulzare a apei datorit contraciei
structurilor fonnate din particulele coloidale i eliminarea solventului imobilizat. Apa inclus
n reeaua structural e numit imobilizat, pe cnd apa structural e legat de gmpcle
hidrofile interne ale macromoleculei proteice. Sinereza are loc la coagularea sngelui, n
proccsul de retracie a cheagului.
Proprietile electrochimice
Proteinele sunt amfolii macromoleculari, nglobnd un numr redus de grupri acidc
i bazicc. Contribuia cea mai important o au resturile de glutamil, aspartil, lizil, arginil i
histidil. Resturile aminoacide de la capetele i N tenninale nu au o influen semnificativ,
mai ales cnd lanul polipeptidic este mai lung. Grupele ionizate sunt dispuse n interiorul
suprafeei moleculare.
Proprietile acido-bazice sunt determinate de numrul mare dc grupe ionizate ale
resturi lor de aminoacizi. De predominarea lor depind proprietile electrice. n albumin
exist 109 resturi dc C 001I i 120 de NH.,; hemoglobina conine 48 COOH i 48
NH,. Sarcina electric determinat de structura proteinei.
Moleculele proteice, fiind electrolii amfolii, interacioneaz cu acizii i cu bazele,
particip la meninerea pH. n intervalul 6-7 al pH capacitatea-tampon a proteinelor
foarte mic. Numai aminoacidul histidin posed proprieti tampon la valori normale
ale pH. Hemoglobina (Hb) eritrocitelor, transfernd O,, sc caracterizeaz prin coninut
evident de histidin, dc aceea i are Hb - aceste proprieti - tampon la pH = 7.
Particulele proteice n soluie pot s-i schimbe sarcina electric n dependen de
pH. n soluie acid are loc inhibarea disociaiei COOl I i, avnd sarcina pozitiv, proteina
migreaz spre catod, n soluie bazic inversspre anod.

R COOH R COOH RCOOH R ~ COONa


I +HC1 K +NaOH
NH, +H,0
NH 2 NH 3 C 1 nh 2

pH - soluiei, n carc proteina apare cu o sarcin electric nul, numrul gruprilor (+)
este egal cu acela al gruprilor (-), este denumit pH izoelectric sau punct izoelectric
(pi). Valoarea pl depinde de compoziia proteinei n aminoacizi. O protein ce arc surplus
de lizin i arginin denot un pi >7, iar aceea care are o proporie mare de aminoacizi
dicarboxilici - pi < 7.
R COO +H+ R ~ COOIi R -C O O ' +OH- R COO'
1+ !+ > I + 2
NH 3 ~ > NH3 NH3
n tabelele 1.4. i 1.5. sunt date valorile pi ale unor aminoacizi i ale unor proteide.
La pH izoelectric solubilitatea, mobilitatea proteinei n cmpul electric este minim;
pentru fiecare protein e caracteristic pi propriu. Valoarea lui e determinat de numrul
de grupe ionizate i de valoarea constantelor de ionizare (ribonucleaza7,8; citocromul
10,6; pepsina1,0). n p l molecula proteic e cu sarcin nul i ntre moleculele
nvecinate nu apar fore electrostatice de respingere, ceea ce nseamn c n atare condiii
soluiile sunt nestabile.
la o eiu i 1.4. vaiorue pu nctuiui izoelectric pentr u unu aminoacizi proteino em

Aminoacid pi Aminoacid Pi

Acid L-aspartic 2 , 7 7 L-Valina 5,96


Acid L-glutamic 3 . 2 2 L-Leucina 5,89
L-Cisteina 5,07 L-Izoleucina 6,00
L-Cistina 5,66 L-Glicocol 5,97
L-Tirozina 5,66 L-Alanina 6,00
L-Serina 5,08 L-Prolina 6,30
L-Fenilalanina 5,48 L-Histidina 7,59
L-Triptofan 5,89 L-Lizina 9,74
Protcide Pi Proteide pi

Pepsina 1, 0 Fibrinogen 5,5


Cazeina 4,6 - globiilina scric 6,7
Ovalbumina 4,6 Hemoglobina 6,9
Albumina seric 4,9 Mioglobina 7,0
Ureaza 5,0 Chimotripsinogen 9,5
Insulina 5,4 Citocrom 10, 6

Miozina 5,4 Lizozim 11, 0

Evident c prezena sarcinilor antipode pe segmentele distanate ale particulelor cre


eaz condiii pentru o agregare rapid cu fonnarea agregatelor mari. Acest lucru favori
zeaz precipitarea lor i la asemenea valori ale pH au o solubilitate mic. Astfel de
particularitate este caracteristic mai ales proteinelor globulare.
La valori mai mici sau mai mari de pi toate moleculele au aceeai sarcin i, ca
rezultat, sc resping una pe alta, agregarea fiind imposibil. Aadar, sarcina electric e
un factor stabilizant al soluiilor coloidale. n soluii supraacide sau suprabazice
proteina nu va precipita chiar la fierbere, adic nici chiar atunci cnd i va pierde
proprietile hidrofile. Se tie c unfactor stabilizator al soluiilor coloidale e membrana
apoas. Solubilitatea proteinelor e dependent de hidratarea molecular a lor, adic a
gaipelor ionizate. Apa, joncionndu-se de pe suprafaa moleculelor i cuplndu-se sub o
form de dipoli, fonneaz membrana apoas care mpiedic adiia, fuzionarea particulelor
coloidale i n punctul pi.
Apa specific orientat n jurul grupelor hidrofile e numit ap legat i se
caracterizeaz prin :
a) dispunere mai compact, cc o apropie dc un corp solid;
b) proprieti reduse dc solvent;
c) nu nghea la temperaturi joase;
d) constanta diclectric este egal cu 2 ,8 , pe cnd la apa obinuit este de 8 (constan
ta diclectric este fora de atracie a ionilor ncrcai opus). Prin urmare, factorii
stabilizatori ai sistemului coloidal sunt sarcina electric i membrana apoas.
Precipitarea i denaturarea proteinelor
Pentru aplicarea acestor proprieti ale moleculei proteice e necesar de a o lipsi
anume de stabilizatori. Metodele sunt diferite. n medicin ele sunt folosite pentni
caracteristica cantitativ i calitativ a proteinelor, din componeni biologici: urin, snge,
exudatetc.
nlturarea sarcinii electrice se efectueaz prin aducerea proteinei la starea p.I. Dac
drept ion de precipitaie se folosete cationul, precipitarea e mai favorabil n soluie slab
alcalin; dac e folosit anionul, atunci soluia trebuie s fie puin acidpentru a aduce
particulele coloidale n starea electroneutr.
Membrana apoas poate fi nlturat cu ajutorul dehidratanilor (alcool, aceton). Ultimii
leag apa. Dehidratanii au o constant dielectric mic, micornd-o i pe cea a soluiei. n
consecin, ei mresc atragerea ntre dou sarcini antipod, crend astfel condiii pentru
fonnarea perechilor de ioni ce favorizeaz agregarea proteinelor.
Corpurile proteice constituie o confonnaie nativ i posed anumite caliti fizico-
chimice i biologice n condiii normale ale T, pH etc. Conformaiile sunt extrem de
fragile i uor perturbabile sub aciunea multor ageni, care afecteaz interaciunile covalente
din coninutul moleculei. Modificrile conformaiei native unice se numete
denaturare, iar agenii care o provoac ageni denaturani. Denaturarea e o
particularitate a proteinelor.
La denaturare sunt lezate legturile necovalentc; agenii denaturani nu afectea
z legturile covalente, nu sunt lezate nici jonciunile peptidice, nu se elimin ami
noacizi. Structura primar a proteinei rmne neafectat.
Trsturile caracteristice ale proteinei denaturate:
1 ) pierderea sau micorarea activitii biologice;

2 ) micorarea solubilitii;

3) schimbarea fonnei i mrimii moleculelor;


4) modificarea caracterului dispersiunii razelor Roentghen;
5) creterea rcactibilitii unor grupe (SH);
6 ) apariia unor grupe funcionale anterior nedetenninate;

7) pierderea capacitii de a se cristaliza;


8 ) scderea capacitii de rezisten la hidroliz;

9) capacitatea sporit de a da reacii de culoare;


1 0 ) micorarea mobilitii electrice.

Denaturarea este provocat de diferii ageni: temperatura nalt, sruri ale metalelor
grele care n concentraii mici produc denaturarea, coagularea proteinei. Proteina coa
gulat din soluie se leag i se precipit cu factorul nociv. Fenomenul e utilizat n practica
medical. La intoxicaie cu sublimat bolnavului i se administreaz lapte, ovalbumin n
cantiti mari. Proteina fonneaz, n ansamblu cu substanele toxice, un precipitat ce
micoreaz absorbia lui. n unele condiii proteina denaturat poate rmne n soluie,
dac aceasta este acid sau alcalin, chiar i la temperatura de 100C. Precipitatul va
aprea la neutralizarea soluiei.
La o aciune de scurt durat i la eliminarea rapid a agentului denaturant e posibil
renaturarea proteinei cu restabilirea activitii ei biologice. Denaturarea e ireversibil
atunci cnd se mp legturile chimice, n special cele disulfidice inter- i intracatenare.
n procesul de sterilizare are loc denaturarea tennic i, n consecin, insuficiena de
timp sau de t duce la generarea i rspndirea microbului etc.
Multe proteine nu sc denatureaz la sublimare (liofilizare). Totui, unele enzime i
diminueaz activitatea. E necesar s tim c exist substane ce pol mpiedica denaturarea,
i anume: soluia de glucide simpl saturat, alcooli multiatomi (glicerina), unii anioni
organici (dodecilsulfat, unii acizi grai) etc. Pentru a evita denaturarea proteinele se izo
leaz. Ele se pstreaz la rece, n soluii concentrate de sruri i la un pH anumit.
M etodele de identificare a proteinelor. Problema elucidrii complete a
structurii macromoleculare a proteinelor este una dintre cele mai actuale i de o
incontestabil importan teoretic i practic. Pentru determinarea masei moleculare
proteice pot fi utilizate urmtoarele metode: mrimea presiunii osmotice, constanta
ultracentrifugrii (proteinele sedimenteaz n raport cu mrimea i masa lor); metoda
difuziunii luminii (intensitatea difuziunii e dependent dc numrul particulelor i dc masa
lor molecular); mrimea difraciei razelor Roentghen, microscopia electronic; coninutul
unor elemente (n Hb concentraia Fe este egal cu 0,34%), care se conin n cantiti
mici (n albumina seric concentraia triptofanului e de 0,58%).

Masa molecular _ Masa atomului x 100


minim a proteinei Cantitatea elementului n %

Masa molecular _ 204 x 100


a albuminei (T rp )----------^ ~ 34000 Da

Masa molecular _ 56 x 100 _ j


a hemoglobinei (Fe) 0,34

Stabilirea structurii unei proteine ncepe cu izolarea i purificarea ei, determinarea


masei moleculare, identificarea calitativ i cantitativ a aminoacizilor componeni, modului
lor de legare, secvena aminoacizilor, n fine, cu orientarea tridimensional a
macromoleculelor.
1. Proteinele se separ de celelalte componente prin dializ, utilizndu-se membrane
semipenneabile. Pentru accelerarea procesului se aplic electroliza electrodializ.
2. Soluiile proteice se purific, difereniindu-se dup mrime i form prin filtrarea cu
geluri speciale care funcioneaz ca site moleculare moleculele de mrimi mici se
repartizeaz ntre faze, iar cele mai mari nu ptrund n faza intern. Moleculele asimetrice
pot s nu ptrund n faza intern. (Granulele porozitate de gel sunt suspendate ntr-o
soluie, formnd 2 faze - una intern n granule, i alta externn afara lor). n cazuri
aparte la purificarea unor enzime se pot utiliza i alte metode. Se observ afinitatea lor cu
diveri ioni, grupe funcionale cromatografia de afinitate (fig. 1.15 a,b,c).
a) Cromatografia prin schimbtori de ioni este bazat pe distingerea semnului i
sarcinii elecfrice la pH-ul dat. Coloana matrice prezint un polimer sintetic ce conne
grupri fixate. La legarea gruprilor anionice matricea este schimbtoare dc cationi, iar
la fixarea gruprilor cationiceschimbtoare de anioni. Afinitatea proteinei pentru
gruprile fixate n coloan este influenat de pH (starea ionizant a moleculei) i de
concentraia ionilor salini din mediul respectiv. Separarea poate fi optimizat prin
schimbarea succesiv a pH-lui i /sau a concentraiei saline a fazei mobile.
b) Gel -filtrarea separ proteinele n dependen de dimensiuni. Matricea coloanei
prezint un polimer fixat ce conine pori cu anumite mrimi. Proteinele mari migreaz mai
Proteinele trec prin
coloan la rata
Granule polimerice cu determinat de sarcina
grupri funcionale lor la pH-ul dat.
ncrcate negativ Proteinele cu sarcina
negativ trec mai
repede i sunt eluate
mai rapid
Amestecul proteic este adugat n
coloana ce conine schimbtori de
cationi

Amestecul proteic

este adugat n
Granule coloana ce conine
polimerice un ligand fixat la j
cu pori polimer, specific
pentru proteina ce
prezint interes

Amestecul proteic este adugat


n coloana ce conine polimer Proteina ce prezint interes
cu legturi transversale este eluat cu ajutorul soluiei
ce conine ligand liber

Moleculele proteice se separ n dependen de Proteinele nedorite


dimensiune: moleculele mai mari trec mai liber sunt splate din
i apar n fraciile timpurii coloan

Figura 1.15. Metode cromatografice utilizate pentru purificarea proteinelor:


a) cromatografia prin schimbtori de ioni; b) gel-filtrarea; c) cromatografia de afinitate
rapid dcct cele mici (nu ptrund n porii granulelor). Proteinele mai mici intr n pori,
sunt reinute, avnd o cale mai lung de traversat.
c) Cromatografia de afinitate separ proteinele n dependen de specificitatea lor
de legare. Proteinele reinute n matrice sunt fixate specific de liganzi prin legturi
transversale (termenul ligand se refer la o grup sau o molecul care se leag de
macromolecule de tip proteic). Dup eluarea proteinelor nefixate n coloan, proteina
legat de interes particular este eluat prin intennediul unei soluii ce conine ligand liber.
n tiina contemporan este pe larg utilizat metod elecroforezei (fig 1.16a). Diferite
probe sunt introduse n rezervoarele ce conin gel de poliacrilamid. Proteinele trec n
gel, unde este aplicat un cmp electric. Dup cteva ore de la efectuarea elecroforezei,
proteinele pot fi vizualizate prin tratarea gelului cu diferii colorani (albastru de metilen),
care se fixeaz de proteine, dar nu la gel. Fiecare band din gel reprezint o protein
individual. Proteinele mai mici migreaz mai rapid i sunt depistate mai departe de baza
gelului. n fugur este ilustrat purificarea enzimei RNA polimeraza din E.coli. Prima
band corespunde proteinelor prezente n extractul celular nativ.
Necesitile tiinifice impun utilizarea clecroforezei cu cromatografia vertical sau
focalizarea izoelectric electroforez bidimensional.
n focalizarea izoelectric (fig. 1,16b), tehnica modern permite separarea proteinelor
n dependen de punctul lor izoelectric (tab. 1.5).

F igura 1.16. Metode utilizate pentru purificarea proteinelor: a) electroforez, b) focalizarea izoelectric

Un gradient constant al pH-lui este stabilit n gel prin adausul amfoliilor potrivii (1).
Amestecul proteic este plasat ntr-un rezervor n gelul la care se aplic un cmp electric
(2). Proteinele ptrund n gel i migreaz pn ce fiecare atinge pH-ul echivalent pl propriu
(3). Amintim c atunci cnd pH este egal cu pi, sarcina net a proteinei este egal cu
zero. n figur sunt artate proteinele dup coloraie, care sunt distribuite dc-a lungul
gradientului pH-lui n dependen de valoarea pi.
n electroforez bidimensional (fig. 1.16c) proteinele iniial sunt separate prin
focalizarea izoelectric ntr-un gel cilindric. Apoi gelul este amplasat orizontal pe un alt
gel n form de plac, unde proteinele sunt separate prin elecroforez n gel de
_ Mr---------f

w , . . Electroforez

Gelul focalizat
izoelectric este
* \

i
*

1t *
I
plasat n ------- V
gelul de
0 m s ) r>: poliacrilamid \ t
Focalizarea
;
izoelectric
1 '
.: - 1 t j

F igura 1.16. ) elecroforez bidimensional

poliacrilamid. Separarea orizontal reflect diferenele de pi, iar cea vertical masa
molecular. Utiliznd aceast tehnic, pot fi separate mai mult de o 1000 de diverse
proteine din E. coli.
Mobilitatea electroforetic a proteinei n gel de poliacrilamid poate fi utilizat i n
determinarea masei moleculare (fig. 1.17).
Proteinele standarde cu masa molccular cunoscut sunt supuse electroforezei. Aceste
proteine - marker (1.17a) pot fi utilizate pentru a estima masa molecular a proteinelor
necunoscute.
n (1.17b) este redat dependena logaritmului masei moleculare a proteinelor marker
versus migraiei relative la o electroforez liniar. Graficul respectiv pennite determinarea
masei moleculare a proteinei necunoscute. La moment sunt cunoscute metode mult mai
sofisticate de purificare i apreciere structural a proteinelor.

a) 1 2

_ j n n

Miozina 200,000

-galactozidaza 116,250
Glicogen fosforilaza 97,400
P r o te in a
Seraibumina 66,200 studiat

Ovalbumina 45,000

Carhanliidraza 31,000

Inhibitorul tripsinei 21,500


Lizozimul 14400


MT standard
Figu ra 1.17. Estimarea masei moleculare
ENZIMELE
Istoria biochimiei este, n primul rind, istoria studierii enzimelorcelor mai distinctive
i specifice proteine cu proprieti catalitice.
Enzimologia e demult considerat o tiin aparte i s-a dezvoltat efectiv n ultima
perioad de timp, dar nceputurile ei se atest din primele decenii ale secolului al XIX-
lea.
Dac n 1920 erau estimate 10-15 enzime prin observarea efectului aciunii lor,
astzi sunt caracterizate partial peste 2000 enzime, dintre care circa 500 au fost obinute
sub fonna unor preparate perfect purificate (unele cristaline) i studiate din punct de
vedere fizico-chimic i biologic.
Manifestrile aciunii enzimelor (fermentaia, digestia) erau cunoscute de foarte mult
timp, dar explicaia mecanismului acestor procese complexe, rolul i locul enzimelor n
transformrile substanelor celulare rmneau neclucidate. Un ir de mecanisme sunt i
pn astzi nedefinite.
Definiia cnzimei s-a conturat atunci cnd s-a observat c n sistemele biologice
au loc procese catalitice survenite din extractele de orz genninal ce realizeaz hidroliza
am id o n u lu i. Cu a ju to ru l p re c ip it rii re p e ta te cu alco o l etilic
s-a obinut (1833) o pulbere alb extrem de termolabildiastaza (din grecete
didotabis - separare).
n perioada 1834-1837 savantul suedez J.Beizelius formuleaz conceptul de cataliz,
confonn cruia un catalizator mrete viteza reaciilor chimice i rezult la sfiritul
lor nemodificatcantitativ i calitativ. El sugereaz c diferitele fenomene biologice
(fennentaia, digestia) pot fi explicate prin prezena unor catalizatori biologici specifici
materiei vii. n 1860, L.Pasteur stabilete c fermentarea zahrului de drojdii n spirt e
catalizat de fermeni organizai indispensabil de organismele implicate n procesele
fennentative.
Aceast concluzie era n contradicie cu postulatul lui J.Liebig, care considera c
fennentul e solubil, fiind produs de celula vie i nu constituie celula propriu-zis.
n anul 1877, W.Kuhne propune termenul enzim (de la grecescul enzyme n
drojdii) pentru atare grup de substane. O fierbere aparent cauzat dc ferment (n
latinferverea fierbe), cu degajarea C 0 2 n procesul fermentativ, caracterizeaz
aceste fenomene biologice.
Celebra disput tiinific Pasteur Liebig a fost finalizat cu brio n 1897, de ctre
H. i E.Buchner, care au demonstrat c sucul cclular al unei culturi de drojdii conservcaz
ntreaga activitate fermentativ, proprie acestui microorganism.
n ultimii ani ai sec.XIX, E.Fischer, efectund studii asupra unor enzime hidrolitice, a
specificitii enzimelor, elaboreaz teoria interaciunii enzim-substrat. Aceast teorie a
stimulat cercetrile n acest domeniu.
Epoca modern ncepe o dat cu izolarea, purificarea i cristalizarea primelor enzime.
n 1926, J. Sumner a cristalizat ureaza i a determinat c enzimele totalmente sunt de
natur proteic. El nainteaz conceptul c toate enzimele sunt proteine, dar savantul
german Richard Willsttter, o adevrat somitate n materie, confirm c enzimele
sunt substane cu o greutate molecular mic, iar proteina depistat e o simpl murdrie.
Mai trziu, J.Northrop, mpreun cu colaboratorii si, cristalizeazpepsina i tripsina,
confirmnd astfel c i ele sunt proteine. Aadar, natura proteic e stabilit incontestabil.
S-au nceput studii intensivem acest domeniu, ce au dat rezultate rcmarcabi le. Cu toate
acestea, o serie de ntrebri, cutn ar fi: dc ce proteinele joac rol de catalizatori; care
este cauza c molecula enzimeie mult mai tnare dect a substratului; decc aminoacizii
nu posed proprieti similare, dar unite n lan polipeptidic capt proprieti catalitice;
n ce mod are loc reglarea activitii enzimelortoate ateapt rspunsuri explicite.
Ce sunt enzimele?
Enzimele sunt uniti funcionale ale metabolismului celular. Acioneaz strict ntr-o
anumit consecutivitate. Catalizeaz sute de reacii n lan, finaliznd cu eliberarea
moleculelor din substane nutritive. Energia substanelor rcagente trece dintr-o form n
alta cu o eficacitate mare i se acumulcz n ATP ce este utilizat n proccsele vitale.Din
micile biomolecule se asambleaz macromoleculele celulei.
O grup deosebit sunt enzimele reglatoare, care sesizeaz diferite semnale perfect
metabolice i, respectiv, i modific activitatea catalitic. Datorit acestor enzime n
celul totul e coordonat: garantat un echilibru armonios dintre procesele metabolice
necesare pentru meninerea integritii i, n final, a vieii celulelor, viabilitii sistemului i
al ntregului organism.
Insuficiena sau lipsa complet a unuia sau a mai multor fermeni duce la apariia
diferitelor afeciuni ereditare; diferite stri patologice apar la o activitate excesiv a uneia
sau a mai multor enzime. i o dat cu elaborarea unui preparat medicamentos care ar
regla activitatea acestor enzime, vom trata eficient boala.
Enzimele joac un rol important la stabilirea diagnosticului, detenninnd activitatea lor
n lichidul biologic. n industria chimic i alimentar evaluarea enzimelor este utilizat
pe larg. Enzimele au un rol aparte i n agricultur.
Structura enzimelor
Enzimele sunt proteine i posed toate proprietile fizico-chimice specifice accstor
macromolecule (solubilitate, proprieti osmotice, sarcin electric net, denaturare termic,
reacii chimice etc.). Activitatea lor e dependent dc pstrarea structurii native a proteinei.
Confirmrile experimentale ale acestui postulat sunt:
1 . Distrugerea lanului polipeptidic prin fierbere m soluii acide sau prelucrarea lui cu

tripsin ducc la pierderea activitii catalitice. Pentru meninerea ultimei e necesar pstrarea
structurii primare.
2. Modificrile n mpachetarea lanului polipeptidic (nclzind proteina sau acionnd
cu pH de valori extreme, cu ageni denaturani) cauzeaz pierderea activitii catalitice,
ccea ce indic necesitatea meninerii structurii secundare i teriare a proteinei.
Masele moleculare ale enzimelor variaz n limite foarte largi. Ribonucleaza are o
mas molecular egal cu 13700Da. Limita superioar este greu de definit. Numeroase
enzime sunt alctuite numai din resturi de aminoacizi unite ntre ele prin legturi covalente,
peptidice i nu doar printr-un lan, ci prin mai multe lanuri polipeptidice.
Unele enzime sunt asociate cu compui dc mase moleculare mici, dializabili. Cnd
aceti compui organici sunt strns legai n structura enzimei, ei poart denumirea dc
grupri prostetice, ns cnd mbinarea lor este uor disociabilcoenzime.
Aceti biocatalizatori se numesc halo enzime, iar componenta proteicapoenzime.
Pentru totalitatea compuilor neproteici din structura heteroenziinelor se utilizeaz termenul
cofactor. n calitate de cofactori apar frecvent cationii unor metale i foarte rar unii
anioni. Un numr relativ redus de cofactori, de coenzime n asociere cu diferite apoenzi
me dau natere unui numr foarte mare de heteroenzime. Se atest sute de dehidrogcnaze
cu coenzima NAD+. Datorit legturilor foarte slabe ntre NAD+i diverse apoenzime,
un numr mare pot aciona simultan ntr-un compartiment celular, utiliznd o cantitate
nensemnat de coenzime. i n aceste situaii este absolut necesar ca procesele de redu
cere s fie echilibrate cu reoxidarea lor.
Ce e comun i ce e distinct la cataliza enzimatic i cea chimic?
Enzimele sunt catalizatori i respect legile catalizei:
1. Enzimele accelereaz viteza reaciilor chimice posibile din punct de vedere
termodinamic, determinnd o scdere a energiei de activare i conducnd la instaurarea
mai rapid a strii de echilibru; accelereaz reaciile n ambele direcii n mod identic
A B.
Ln lipsa enzimei viteza (A B) e egal, de exemplu, cu 1O' 4 sec., reacia invers
(A - B) decurge n IO' 6 sec.
Constanta acestei reacii este egal:

[] Cd io4
c = --- = 7 = 1 0 0
-

[A ] Ci IO' 6

n stare de echilibru concentraia substanei este de 100 ori mai marc dect a
substanei A, chiar dac prezent sau nu enzima. n lipsa enzimei echilibrul se stabilete
timp de cteva ore, iar cu enzim an cteva secunde. Enzimele accelereaz apariia
echilibrului chimic n reacia catalizat.
2. Viteza reaciei crete de milioane de ori. De exemplu, reacia catalizat de
carbanhidraz: C 0 2 + H ,0 H2 C 0 3
Fiecare molecul de enzim hidrateaz n 1 sec.- 105 molecule dc COn i, prin
urmare, viteza reaciei n prezena enzimei crete dc 1 0 7 ori.
Efectul enzimelor e extraordinar n comparaie cu cel al catalizatori lor sintetici. Enzimele
se prezint n concentraii extrem de mici la concentraii de substrat relativ mari. Eficiena
catalitic a enzimei este net superioar celei nregistrate n cazul catalazei chimice,
exprimndu-sc prin numrul de turnover numrul de molecule ale substratului
transformat ntr-un minut de o molecul de enzim.
3. La sfritul reaciilor chimice enzimele, la fel ca i catalizatorii, se regsesc, din
punct de vedere cantitativ i calitativ, ntr-o stare chimic neschimbat, participnd la un
nou act catalitic.
4. Enzimele sunt substane macromoleculare extrem de instabile, reacionnd n condiii
optime numai la anumii parametri - parametri optimi de aciune a enzimei soluii apoase
diluate, pH valorii fiziologice, T anumit i presiune adecvat.
SPECIFICITATEA EN ZIM ELO R
Cea mai important prioritate a enzimelor e nalta lor specificitate de aciune -
atribut fundamental ce determin succesiunea reaciilor care favorizeaz calea metabolic.
Multitudinea formelor de manifestare a specificitii poate fi ncadrat n 2 categorii -
cea de reacie i de substrat.
1. Specificitatea de reacie este proprietatea de a cataliza un anumit tip de reacie
ce st la baza clasificrii enzimelor. Enzimele proteolitice catalizeaz hidroliza legturilor
peptidice:
O O
H 2 N CH C-i-NHCHC-i-NHCHCOOH + 2H20
I ' I ' I
RI R2 R3

H 2 N C H -C O O H + H 2 N C H -C O O H + H 2 N C H -C O O H
- I - I - I
RI R9 R2

Multe enzime catalizeaz i hidrolizeaz legturile esterice, reacia fiind asemntoare.


R iC 0 - R 2 + H70 - R. O + Ro OH
II I
O OH
Unele enzime au 2 zone distincte n structura lor proteic, fiecare responsabil
pentru un anumit tip de reacie specific.
2 . O enzim cu o anumit particularitate de reacie poate asigura transformarea

corespunztoare a unui grup dc substane nrudite chimic specificitate relativ,


sau reacia se resfrnge asupra unui substratspecificitate absolut. Drept exemplu
de specificitate absolut pot servi anhidraza carbonic, ureaza, ultima reprezentnd o
enzim ce catalizeaz urmtoarea reacie:

H 22 N C NH
2
2
2
+ H ,0 , + 2NH 3
O
Specificitatea relativ se manifest n diferite ipostaze:
a) posed o arie larg, fa de numrul substraturilor (proteazele n funcie de resturi
de aminoacizi: chimotripsina legtura peptidic, format de COOH a Phe, Tyr, Tip;
tripsina-deC O O H ai Lysi Arg; trombina de COOH ai Arg i NH, ai Gly);
b) formeaz o arie mai ngust: alcool dehidrogenaza dehidrogenaz un grup
de alcooli monohidroxilici cu un numr mic de atomi de (specificitatea de grup),
adic se manifest prin gruparea chimic:

r - c h 2- o h ^ ^ r - c h = o
N A D + NADH+ H +
) n lipazele digestive specificitatea coreleaz cu poziia legturii esterice ntre
glicerin i acizii grai:
O
II
CH2- 0 C - R , c h 2- o h
I Lipaza pancreatic
C H - O c o - r 2 C H - O R2
I
CH2 o c R, 2H20
r , - cooh ch, - oh
II R 3- C O O I I
O

CH2OH
Lipaza intestinal
CH OH
II2 0 r 2- cooh c h 2- o h

Stereospecificitatea de su b strat i de reacie


Majoritatea biomoleculelor posed un atom de asimetric i, fiind chirali, pot exista
sub forma celor 2 enantiomeri. O enzim atac numai un izomerstereospecificitate:
a) n toate reaciile glicoliticc enzima corespunztoare acioncaz asupra esterilor
fosforici ai D-hexozclor i D-triozelor; se utilizeaz numai L-aminoacizii; n aceste cazuri
substratul optic activ se transform n produs care poate fi sau nu optic;
b) cnd substratul este inactiv optic, dar este produsul optic al reacici, sc consider
c reacia este o sintez asimetric Aceeai situaie sc observ i n activitatea fumarazei,
SDH, LDH:
LDH
H 3 C C H -C O O H H 3 C - C COOH
I II
OH NAD+ NADH+ H + o
L-acid lactic Acid piruvic
c) enzimele catalizeaz transformrile doar a unui singur izomer-cis sau trans;
d) pentru a utiliza ambii antipozi optici, organismul dispune de racemaze (epimera-
ze), care transform un izomer n altul:
D-alanin L-alanin
Utilizindu-sc substraturi marcate cu izotopi radioactivi, s-a constatat c unele
enzime sunt capabile s diferenieze dou grupe chimice identice.
Glicerolkinaza fosforileaz asimetric glicerolul, estcrificnd aceeai grup de alcool
primar:

' 2OH 1 CH2OH


2 CHOH ST 2 c h -o h
ATP ADP , I 2
3 CH 2 OH 3 CH2 PO 3
Enzimelor le sunt proprii manifestri absolut specifice, anumite substraturi. Ele
accelereaz diverse reacii chimice, far formarea produselor auxiliare. Moleculele
substratului trebuie s posede anumite particulariti structurale de baz:
a) substratul conine o legtur chimic specific pe care enzima o scindeaz;
b) substratul trebuie s posede o anumit grup funcional, grupa de legtur,
care joncioneaz cu enzima i orienteaz moleculele substratului n ccntrul activ. Cu
alte cuvinte, legtura chimic a substratului trebuie s ocupe o poziie adecvat fa de
grupa catalitic a enzimei.
Ce mecanism de accelerare a vitezei reaciei chimice posed enzimele?
Pentru a ptrunde acest mecanism, e necesar contientizarea unor noiuni ca: ener
gia de activare exprimat n calorii, energie necesar tuturor moleculelor unui mol de
substan, care la o anumit temperatur s ating starea de tranziie corespunztoare
apexului barierei energetice. Factorul ce asigur desfurarea reaciilor n organismele
vii la TC intern constant este delimitarea la valori minime a energiei de activare.
Viteza reaciilor e dependent de diferena valorilor de energie liber (aG) pentru starea
A (s) i complexul de tranziie. Ea este egal cu: aG = Gst - Gs. Se mai numete energie
liber de activare Gibbs.
Viteza reaciilor e proporional cu numrul de molecule, a cror energie liber
este egal sau mai mare dect aG. O dat cu creterea T, numrul moleculelor sporete
de 2 ori la 10 C. Enzimele accelereaz viteza reaciilor chimice (VRC), micornd bariera
de activare, i reacia decurge dup alt mecanism, ce se caracterizeaz printr-o energie
de tranziie mult mai mic (fig. 1.15).
Formarea i scindarea legturii chimice de enzim e precedat de formarea
complexului enzim-substrat [CES]. Substratul e fixat de o zon restrns n
enzim, specific, denumit "centrul activ al enzimei. Aadar, centrul activ (CA)
e o mbinare n timp i spaiu a anumitelor grupe funcionale, ce intr n
legtur cu moleculele substratului i determin activitatea catalitic a enzimei.
Dispunem de numeroase
investigaii experimentale ce G
Starea de tranzitie far enzim
vizeaz formarea complexului j ~
enzim-substrat (CES):
1 .Investigaii demonstrative
' AG..P S
prin intermediul microscopiei I 0
Ijn---------- ^
e lec tro n ice i al an alizei JaGoE
roentgenostructurale.
2.Formarea CES e nsoit 1 _ _ U go_ _
de m o d ificrile fizice ale p Starea final
enzim elor: so lu b ilita te ,
termolabilitate. Durata reaciei
3. Se modific i caracteris
Figura 1.15. Diagrama ce reprezint energia liber de
tica spectroscopic, dac n activare n reaciile chimice: S-substrat A; P-produs fin a l B;
componena enzimei intr grupe E S i EP- compui intermediari,AGo - energia de reacie
prostetice colorante. standard S~*~P
4. Adecvat e i metoda rezonanei electronice de spin (RES) sau rezonana magnetic
nuclear (RMN).
5. La formarea CES se manifest un grad mare de stereospecificitate (D -
aminoacizii nu pot servi ca substraturi, nu se leag cu enzima). Zona de legtur are o
fonn geometric bine conturat (fig. 1.16).
6 . Uneori afinitatea mare a enzimei cu

substratul A (n lipsa B) nlesnete stabilirea


complexului EA.
7. La concentraia constant a enzimei
viteza reaciei sporete o dat cu mrirea
concentraiei de substrat, ajungnd la viteza
maxim.
n 1913, L.Michaelis a explicat noiunea
de vitez maxim a reaciei fermentative fa
de formarea CES. Concluzia c viteza
reaciei devine maxim la concentraia mare
a substratului, n condiiile n care acesta
ocup toate centrele active ale enzimei, e o
argumentare nrdcinat demult i O dovad Figu ra 1.16. Fixarea substratului n centrul
concludent a funcionrii complexului activ al chimotriPstnei
enzim-substrat.
Unele particulariti ale centrului activ (CA)
Centrul activ este alctuit dintr-un centru de legare i un centru catalitic. Mai
exact, n centrul activ unele grupri (sau resturi ale aminoacizilor) sunt implicate n
legarea substratului, altele asigur cataliza propriu-zis, fiind intercalate ca grupe
catalitice.
Enzimele confer o varietate structural destul de mare, la fel de vaste sunt
specificitatea i mecanismul aciunii catalitice. i, totui, rezult unele concluzii generale,
referitoare la proprietile lor:
1. CA ocup o parte relativ mic din
volumul enzimei i majoritatea din restul s.,.1 .

aminoacizilor moleculei de enzim nu ? , jL


contacteaz cu substratul. E o enigm
& > CyJ9>

solicitarea unor dimensiuni att de mari de


a.
ctre enzime. i
2. CA e o structur tridimensional (nu e 4 . V * 4 C y 00


doar punct, linie sau plan) structur
complex, la fonnarea creia particip vel Ctr _ **'
grupe ale diferitelor resturi de aminoacizi \ \ I
Ser- n j
(exemplu: nstructuralizozimului,dincei 129 Sn \
de aminoacizi radicalii aminoacizilor din Os ft
secvena liniar35,52,62,63,101 particip
la formarea CA). Centrele active ale unor F igu ra 1.17. Centrul activ al chintotripsinei
enzime sunt redate n fi guri le 1.17-1.18.
-64
3. Substratul relativ slab se leag cu
enzima. Energia liber a interaciunii e de
3-12 kcal/mol. Fora legturilor covalente
nu deviaz de la limitele 50-110 kcal/mol.
4. CA are form de adncitur sau
cavitate (an, despictur), unde apa n-
are acces, cu excepia dac aceasta servete
drept reagent al reaciei. Aceast cavitate
conine civa aminoacizi polari ce exercit
legarea i cataliza. Regiunea CA are un
caractcr nepolar ce favorizeaz fixarea
substratului. De menionat c forma CA
creeaz un microspaiu, n care resturile Figura 1.18. Centrul activ al elastazei
polare capt nsuiri deosebite, necesare
pentru cataliz.
5. Fixarea specific e dependent de
poziia bine dctenninat a atomilor n CA.
Substratul ptrunde n CA, cu condiia
similitudinii de form. n 1890, Emil Fischer
+
>
a elaborat modelul clasic al structurii Figura 1.19. Formarea complexului enzim-
substrat (ES) dup modelul E. Fischer
spaiale a CA n raport cu structura
substratului. Anume acest principiu' lact
-ch eie a contribuit cu succes la evoluia conceptului catalizei stereospecifice
(fig. 1.19).
n ultimii ani ns s-a constatat c centrul activ nu e o structur rigid cum presupunea
E.Fischer, ci se modific la fixarea substratului. Modelul dinamic, propus de D. Koshland,
presupune o flexibilitate a zonei de cazare a CA n enzima liber. CA este preformat,
ceea ce denot c are o conformaie spaial puin diferit de cea necesar fixrii
substratului. Substratul induce o
modificare conformaional a zonei
CA, realiznd o configuraie optim
fixrii (fig, 1.19a).
Unele enzime fixeaz substratul n
form a lor te n sio n at , ce
corespunde strii de tranziie.
D in p u n ct de vedere
F igura 1.19a. Modificrile conformaionale n molecula
termodinamic, situarea cea mai enzimei la fixarea substratului (modelul D. Koshland)
potrivit a substratului n raport cu
enzima reduce la mi ni m gradele de libertate ale transirii i rotaiei substratului, i micoreaz
entropia, ceea ce favorizeaz obinerea efectiv a strii de tranziie i motiveaz n mare
parte scderea energiei dc activare a reaciei catalizate enzimatic.
E incontestabil faptul c flexibilitatea structurii enzimei determin prezena substratului
n sfera de aciune a grupelor catalitice i ieirea produsului din acest sistem.
Unele enzime induc o peiturbaie a electronilor pe substrat, amplificnd cu mult viteza
catalizei (carboxipeptidaz).
Exist o varietate mare de factori ce influeneaz viteza reaciilor ferm entative
i determin activitatea catalitic a enzimelor.
1. Concentraia fermentului:
a) n condiii standard, 2 molecule de enzime ntr-o anumit perioad de timp vor
cataliza de 2 ori mai multe molecule de substrat dect o molecul de enzim V = R[E]
o relaie strict proporional. La mrirea concentraiei de enzim se observ devieri de la
relaiile strict liniaredevieri imaginare ce in de metoda de studiu;
b) n prezena mai multor enzime, viteza va fi limitat de concentraia uneia dintre ele;
c) o dat cu sporirea concentraiei enzimei, viteza unei reacii complexe se va micora
n cazul n care coenzima practic va fi legat de o enzim inaccesibil pentru celelalte;
d) adaosurile toxice pot fixa enzima. Numai dup legarea lor, enzima va deveni apt
pentru activitate.
2. Concentraia substratului. Concentraia enzimei din esuturi suport variaii mici
n timp (cu excepia enzimelor inductibile), astfel net ea poate fi considerat
constant.
n schimb, concentraia substratului poate varia destul de mult conform strii
metabolice a esutului. Dependena vitezei reaciilor de concentraia substratului constituie
aspectul cel mai important al cineticii
enzimatice (fig. 1.20). v (/min)
Reprezentarea grafic reflect o I V =V_
curb cu afiniti de hiperbol.
E xplicarca ei se datoreaz lui
L.Michaelis i M.Menten. KMeste
egal cu concentraia substratului
pentru care Vo prezint o jumatate
din V . Exprimarea KMse face n
uniti de concentraie i se deduce
din presupunerea de baz precum c
factorul-limit al vitezei reaciilor
fe rm e n ta tiv e este scin d area
complexului ES n produs i enzim. F igura 1.20. Variaiile vitezei reaciilor enzimatice n
Fiecare enzim n parte are valoarea fu n cie de concentraia substratului
KM pentru substratul dat. Unele Ecuaia lui Michaelis-Menten.
enzime (catalaza, carbanhidraza) cer cantiti relativ mari de
substrat pentru a atinge viteza egal cu Vo; altele (hexokinaza) V maxL[S]J
ating mrimea dat la concentraii mici de substrat. V =-
n condiiile de mediu al celulei, enzima nu-i saturat cu
substrat Ti nu funcioneaz
*
cu Vmax. Modificnd concentraia
substratului, posibil, n anumit msur, reglarea proceselor oxidative din celul.
3. pH optim al fiecrei enzime, ce genereaz o aciune maxim a ei, nu coincide
obligatoriu cu valorile pH caracteristice mediului intracelular al enzimei.
Mrind sau micornd pH-ul mediului,
se poate regla activitatea catalitic a
enzimelor. Acest optim pH e dependent de
gradul de ionizare a grupelor funcionale, al
afinittii enzimei cu substratul i stabilittii ei
(fig. 1 .2 1 ).
Ionii H+ i OH' au un efect denaturant
asupra enzim elor rup legturile, ce
determin structura teriar. Dac n CA al
enzimelor se afl grupri ionizabile, acide
sau bazice, acestea interactioneaz direct
cu ionii H+ i OH;, rezultnd creterea sau Figura 1.21. Activitatea unor enzime n
dependen de p H
scderea gradului lor de disociere i
acionnd ca adevrai inhibitori ai enzimelor
(am ilaza n sucul g a stric).
4. Influena temperaturii (T) determin
sta b ilita te a i v iteza de scin d are a
complexului ES, influennd afinitatea enzimei
la substratul activator sau inhibitor. Creterea
vitezei reaciei o dat cu creterea
temperaturii este interpretat prin prisma
energiei de activare. Pentru fiecare enzim
se poate stabili o temperatur optim,
viteza atingnd valoarea maxim. Creterea
temperaturii cu 10C pn la 40C dubleaz
n continuare viteza reaciei. Viteza scade activitii enzimelor

din cauza distruciei enzimei, iar temperatura


inactivaiei enzimei coincide cu punctul de
denaturare a proteinei (fig. 1 .2 2 ).
EXPRIM AREA ACTIVITII ENZIMATICE
Pentru a exprima activitatea enzimei sunt necesari unntorii factori: ecuaia sumar a
reaciei; metoda de analiz; factorii enzimei, ionii sau coenzimcle ei; valoarea constant
dup Michaelis; pH i TC optime.
In practica biochimic curent sunt importante variaiile de activitate, i nu activitatea
absolut. Se ia o anumit unitate arbitrar, care servete drept referin.
- Unitatea Internaional (U.I.) e acea activitate enzimatic ce asigur conversia
a 1jimol de substrat ntr-un minut n condiii standardizate de pH, T (25-30). Cofactorii
i alte condiii optime asigur aciunea enzimelor.
- Katalul (kat) constiftiie activitatea care asigur transformarea unui mol de substrat
ntr-o secund (lm kat = 60U .I),(l U.I. = 16,67 nkat).
Se mai utilizeaz:
- activitatea specific numrul de U.I. cu referin la 1mg protein;
- activitatea molecular - numrul de molecule de substrat transformate de ctre o
molecul de enzim ntr-o secund numrul turnover ( carbanhidraza - 36
milioane pe minut, catalaza - 40.000.000/sec.);
- activitatea oxidoreductazelor cu coenzima NAD+ sau NADP* se exprim prin
creterea sau descreterea extinciei la 340 n m (absorb numai formele reduse). Ca
unitate servete creterea sau scderea cu 0 , 0 0 1 a extinciei ntr-un minut.
La reaciile ferm entative ale metabolismului iau parte enzimele care se leag cu
moleculele diferitelor substraturi. Exemplu:
E
Glucoza + ATP Glucozo-6 -P + ADP (E - hexokinaza)

Reaciile cu participarea a 2 i mai multe substraturi includ transferul atomilor sau


grupelor funcionale de la un substrat la altul. Atare reacii decurg n dou moduri.
Primul tip de reacii reacii de substituie unitar: 2 substraturi A i se leag
specific sau sporadic cu enzima, rezultnd fonnarea complexului EAB cu scindarea lui n
i D (fig. 1.23); al doilea tip de reacii reacii ce decurg confonn mecanismului
substituiei duble (de tipul ping-pong). n astfel de reacii CA al enzimei n fiece
moment leag un substrat.

F igura 1.23. Reacii de substituie unitar

Adiionarea primului substrat e nsoit dc transferul grupei funcionale pe enzim i


numai dup eliminarea produsului fonnat din primul substrat poate s adiioneze la enzim
i al doilea substrat, dup care s rcccpionezc ginpa funcional:
AX + B ^ A + BX (fig.1.24).
F igura 1.24. Reacii de substituie dubl

Am accentuat c enzima accelereaz viteza reaciilor catalizate de IO8 - IO20 ori.


Ureaza la pH = 8 i T= 20 mrete viteza reaciei de 1014 ori.
Care este mecanismul ce atribuie enzimelor o activitate intens n condiii att
de subtile?
Sunt antrenai 4 factori decisivi:
1. Apropierea i orientarea substratului de grupa catalitic. Legtura chimic
explorat a substratului se afl nu numai foarte aproape, dar i direct orientat fa de
grupele catalitice. n consecin, probabilitatea c complexul ES va atinge starea de
tranziie se amplific.
2. Tensionarea i deformarea sunt ntr-o concordan indus: alipirea substratului
produce modificri conformaionale n molecula enzimei, tensionnd structura CA,
concomitent deformndu-se i substratul legat, ceea ce favorizeaz atingerea strii de
tranziie a complexului ES. Apare
concordana indus, adic modificri
n structura teriar i cuaternar a
molcculci enzimaticc.
3. Cataliza general acido-
Ser.195
bazic. n CA al enzim ei 'x TI r-
O
conlucreaz grupe specifice ale
resturilor de aminoacizi, servind /
drept donatori sau acceptori de R2 < - C R 1 < /%
protoni. Grupele acide i bazice O
R2N H ,
rep rezin t catalizato ri
efectivi ai multor substane
COO SH; OH; NH
organice din soluiile apoase
(fig. 1.25). HN NH

4. Cataliza covalent. Enzimele reacioncaza cu substraturile, formnd compui ES


nestabili legai covalent, care n reaciile ulterioare fonneaz produsul reaciei mult
mai rapid dect n reaciile necatalizate. Compusul covalent e nestabil i se hidrolizeaz
mult mai rapid dect R.

RX + E OII R - O H + EX > EX + HOH E OH + HX


Enzimele stimuleaz diferite procese metabolice n celule, fiind organizate n sisteme
(sau complexe) multienzimatice, n care enzimele activeaz coordonat. Ele genereaz
reacii succesive ale unei anumite ci metabolicc. Produsul primei reacii din astfel de
sisteme devine substrat pentru cealalt enzim.
Sistemele multienzimatice pot include 15 i mai multe enzime, carc activeaz
ntr-o anumit succesiune. In fiecare sistem exist un ferment cu rol de dirijor, care
determin viteza tuturor reaciilor catalitice din lan, fiindc catalizeaz stadiul-limit,
adic reacia cea mai lent, ce determin viteza procesului n ntregime. Enzimele de
acest tip ndeplinesc nu numai fimeia catalitic, dar i cea de modificator al propriei
activiti ( ) , ca respondente la diferite semnale. Ca rezultat, fiecare reacie metabolic
i schimb viteza, fapt ce conduce la adaptri rapide. n condiiile noi apare o adaptare
imediat, de avarie. n aceast categorie logic se include transformarea enzimei neactive
n activ, sub influena factorilor att specifici, ct i nespecifici.
n majoritatea sistemelor multienzimatice fermentul-dirijor catalizeaz prima
reacie din lanul lor consecutiv. Cantitatea suficient de ceilali fermeni determin
activitatea catalidc intensiv, ndeplinind indicaiile dirijorului i intensifiendu-i activitatea
la creterea cantitii de substrat.
Enzimele, activitatea crora se gsete sub influena unor semnale molecu
lare, sunt numite enzime reglatoare. Exist 2 clase de astfel de enzime: una
alosteric reglate (Alio stereos - alt loc) de modulatori ce se fixeaz necovalent, i a
doua enzime ce se regleaz prin modificri covalente.

ENZIM ELE ALOSTERICE. Ele posed cu totul alt sau alte centre dect cel
activ, n care sunt fixai liganzii. Ce le este caracteristic acestor enzime?
1. Posed, ca i toate enzimele, centru catalitic, unde se fixeaz i se modific sub
stratul, dar mai posed un alt centru care are o poziie spaial pentru fixarea
metabolitului reglator, numit efector sau modulator. Acest centru e specific pentru
fiecare modulator.
2. Moleculele enzimelor alosterice sunt
mai mari, mai complexe i primordial Mioglobina
oligomere pare.
3. Au cinetica lor viteza reaciilor, n
dependen de concentraia substratului, are
forma sigmoidal, dar nu hiperbolic,
cauzat dc urmrile interaciunii ntre
protomeri ce leag substratul n mod
cooperativ (exemplu mioglobina i
hemoglobinafig. 1.26).
Exist 2 tipuri de enzime alosterice:
a) homotrope n care modulatorul i
substratul constituie aceeai substan. 1.33 2.67 3 38 5.3 6.67 kPa
Acumularea substratului activeaz viteza Figura 1.26. Curbele de oxigenare ale
inioglohiitei (Mb) i hemoglobinei (Hb)
reaciei catalizate dc aceast enzim:
H exokinaza
Glucoza + ATP G - 6 - P + ADP
(de altfel, ca i alcoolul ce activeaz enzima ce l
scindeaz - alcooldehidrogenaza);
b) heterotrope enzimele sunt reglate de
modulatori care difer dup structur de
substrat, muli dintre ei avnd aciune antipod.
La fixarea modulatorului, enzimele alosterice i
modific conformaia. Modulatorii accelereaz
sau inhib utilizarea substratului de enzima
respectiv (fig. 1.27).
Unele sisteme enzimatice manifest o parti pozitivi (+) i negativi (-) asupra cineticii
cularitate deosebit: produsul final al sistemului reaciilor catalizate de enzimele alosterice
inactiveaza enzimaun rezultat al activittii mai
productive a sistemelor multienzimatice, dect e necesar
COO
celulei. Acest produs final acioneaz ca un inhibitor specific
H3N- H
al primei enzime i, ca rezultat, viteza sistemului se echili
I breaz n corespundere cu cerinele celulei - retroinhibi-
H- -C-OH
H,
ie sau inhibiie prin produs final, inhibiie de tipfeed back.
L-treonina Transformrile L-treonina L-izoleucina necesit
. Treonin
: i dehidrataza 5 enzime. Prima enzim e treonindehidrataza, inactivat
de izoleucin, modulator ce se fixeaz n CA. Este un
exemplu clasic de reglare necovalent i e reprodus n
fig. 1.28.
Se nregistreaz enzime reglatoare, la baza activrii
crora se atest modificri covalente ale moleculei:
E
Glicogenn+ P Glicogenn , + Glucozo-l-P

Enzima fosforilaza A (forma activ constituie un


dimer compus din 2 protomeri idcntici, fiecare avnd
rest specific de serin, fosforilat pe grupa OH) catalizeaz
reacia. Fosfataza fosforilazei catalizeaz hidroliza legturii
COO'
P cu serina i transfer F A n F B mai puin
H3N(!)
_ -H
I activ. Kinaza fosforilazei catalizeaz transferul grupei P
- ,
dc la ATP la OH serinei i reactiveaz activitatea enzimei
CH2
L-izoleucina (B ^ A) (fig. 1.29).
CH,
Trecerea dintr-o fonn n alta e nsoit dc modificri ale
F igura 1.28. inhibiia de tipul fe ed structurii cuatemarece atinge centrul activ, regleaz activitatea
e n z ta e i^ ie ^ p ro t^ lo rT a c to X
de enzime. Treonindehidrataza E , Reaciile catalizate de enzimele alosterice sunt
este mhibata de produsul fin a l ireversibile, au AG - negativ. Exist i alte modificri
covalente ale enzimelor metilarea resturilor de ami
noacizi, adiionarea adenilatului etc.(fig. 1.30).
La unele enzime foarte complexe activitatea Oll Oll
I I
poate fi reglat att covalent, ct i necovalent. CH, CH,

O categorie de enzime sunt sintetizate n forma Fosforilaza


neactiv de precursor, care se activeaz la o
proteoliz limitat (proenzimele). Exemplu:
1 ) enzimele digestiei ce scindeaz proteinele 21- 2ATP-,
Kinaza
n stomac i duoden - pepsinogenul, chimotripsi- Fosfataza
, . , , .
nogenul, tripsinogenul, proelastaza, procarboxi
, fosforilazei
y "2 H .O 2ADP j fosforilazei

peptidaza;
2 ) coagularea sngelui e determinat de
avalana de reacii cu aciune proteolitic;
3) hormonii proteici (insulina);
4) proteinele fibrilare (colagenul). - / Fosforilaza A
Exist o grup de proteine-enzime, starea activ
a crora e condiionat de mpachetarea spontan 1 ,29' Res la re< aciyitau ghcogen
1 r fosforilazei prut modificrile covalente
a m oleculelor cu form area unei structuri
tridimensionale caracteristice enzimei date (lizozim).

M o d if ic r ile c o v a le n te Resturile de am inoacizi accep-


tati n modiFicrile covalente
ATP ADP o
II .
Enz E nz P O
F o s fo r ila re a I- T yr, S e r , T h r , IJis
O
ATP PPi
O
E nz E nz P O C H , o A d e n in a Tyr
A d e n ila re a I
O'

UTP PPi
11 T yr
E nz E n z P O C H , o . U ra c ilu l
U rid ila re a
O" II H .
H H

OH OH
NAD Nicotinam ida o
E nz x _ z I?
Enz ,0 CH2 O P O P O C H 2^ o _A d e n in a
A D P - rib o z ila r e a O' O'
H H
H ' A
ou OH OH
S -a d en ozil S -a d en o zil A r g , G in , C y s
M e tila re a m etio n in a h o m o c iste in a

E nz s ______ _
E nz CH 3 Ght
Figura 1.30. Exemple de modificri covalente ale diferitelor enzime
n 1922 Al. Fleming descoper, ntr-un mod deosebit,
lizozimul, iar n 1929 tot dnsul descoper i penicilina.
M ecanismul interaciunii alosterice
n 1965 savanii J. Monod, J. Wyman, J. Changeux au
propus un model fin i clar al interaciunilor alosterice (MWC)
modelul simetric sau concentrat , avnd urmtoa
rele caracteristici cardinale (fig. 1.31):
1 . enzima alosteric este compus din 2 subuniti identice,

simetrice, cu un centru activ, centrele fiind echivalente;


2. enzima (oligomcrul) poate exista n dou stri: T-
tensionat (constrns), cu afinitate mic de substrat, i R-
relaxat, cu o afinitate mare de substrat;
3. conformaia fiecrui monomer este constrns de
asocierea cu ceilali monomeri;
4. formele T i R pot trece din una n alta i se afl n
F ig u r a 1 .3 1 . M o d elu l
echilibm T R; simetric defixare cooperativ
5. pentru acest model se face o excepie: ntru a pstra a substratului
simetria dimerului, ambele subuniti trebuie s adere la
aceeai conformaie.
n lipsa substratului, toate moleculele se afl n forma T Inhibitor alosteric
(la IO4 molecule o molecul poate cpta forma R).
Prezena substratului modific conformaia, ducnd la
apariia formei R. Cnd substratul se leag cu centml activ,
cellalt la fel trebuie s se afle n R - stare. Treccrea de la
T la R i viceversa se produce coordonat. La adiionarea Forma T
substratului partea molecular a enzimei n starea R
A ctivator alosteric
progreseaz i fixarea substratului devine cooperativ. La o
saturaie complet toate moleculele enzimei se fixeaz n R
stare.
Inhibitorul sc leag cu forma T, activatorul cu fonna R,
astfel efectele homolrope devin pozitive, iar celeheterotrope
pozitive sau negative (fig. 1.32). Forma
D.Koshland, G.Nemethy i D.Filmer (KNF) propun
Figura 1.32. Inhibitorul alosteric
modelul secvenial, mai clasic (fig. 1.33). Baza lui constituie stabilizeaz form a T, pe cnd
trei postulate: activatorul respectiv forma R
1 . fiecare monomer poate exista n una din confonna-

iile posibile - T sau R;


2 . fixarea substratului modific forma doar a unei subuniti, cealalt nu sufer modificri

vdite;
3. modificrile conformaionale detenninate de substrat la o subunitate pot mri sau
micora afinitatea la substrat a celorlalte subuniti. Fixarea este cooperativ.
Deosebirile ntre modele: cel simetric nu presupune echilibm ntre formele R i T n
lipsa substramlui, dar din contra, fixarea substratului induce trecerea T R.
n accst model esenial este simetria monomerilor.
Modelul secvenial denot c trecerea de la T la R n diferite
\
subuniti are loc coordonat i ntr-o anumit succesiune. Un rol I J
primordial are fonna hibrid RT. Monomerii interacioneaz cu TT
condiia prezenei formei confonnaionale diferite. n ultimul model
(secvenial) efectul substanelor homotrope poate fi pozitiv i 1
negativ. Fixarea de enzim a dou molecule dc substrat depinde
efectiv de natura modificrilor structurale, detenninate de fixarea
primei molecule de substrat.
?
Recent se consider c aceste modele reprezint dou cazuri TR
aparte de interaciune. n realitate ea e mult mai complex, de +s
pendent de particularitile structurii cuaternare, teriare etc.
E stabilit c sub aciunea guanidinhidroclorurei (G4 HC1) sau a
ureei inactivaia unor enzime are loc la concentraii relativ mici ale
agenilor denaturani, n care nu se observ modificri globale n
conformaia moleculei. Studiile recente confinn c pierderea RR
activitii fermentative e detenninat de micorarea interaciunii n F ig u ra i .3 3 . M odelul
molecule ce are, drept consecin, creterea mobilitii prii ei se cv en ia l de fix a r e
luntrice. i denaturarea tennic prezint date c pentru un ir de Sh
enzime inactivarea este antecedent modificrilor confonnaiei,
care este indus de T nalt. Pierderea activitii enzimatice n
acest caz nu e provocat de efectul inhibitorilor. Posibil c enzimele oligomere (creatin
kinaz), disociind la monomeri, ar putea s se inactiveze n lipsa vdit a desfurrii
moleculei enzimatice. Observaiile denot c disocierea creatin kinazei are loc la
concentraii ale agentului denaturant, cu mult mai majore dect ale celor ce provoac
inactivarea enzimei.
Studiile actuale demonstreaz c micorarea activitii enzimatice n condiii de
concentraii relativ mici ale agenilor denaturani sunt cauzate nu de efectul lor inhibitor
sau de disociaia enzimelor oligomere, dar de dependena de perturbarea conformaiei
centrului activ.
Datele experimentale elucideaz c centrele active ale majoritii enzimelor sunt situate
n regiuni ale moleculei mult mai mobile (ntre domenii) i deci sunt mult mai sensibile la
aciunea agenilor denaturani sau a factorilor fizici. n confonnitate cu ipoteza potrivirii
induse a lui D.Koshland, n fiecare faz a ciclului catalitic regiunea centrului activ capt
o conformaie specific fazei. Activarea enzimei este rezultatul coaptrii CA a confonnaiei,
perfecte, ce detennin efectul catalitic maxim. Dar n caz de sporire a activitii enzimatice
la nclzire i proteoliz, are loc trecerea dintr-o conformaie compact i stabil n alta
relativ mai deschis i structurat mai fin. La proteoliz limitat activarea zimogenului e
cauzat nu de coaptarca CA a conformaiei perfecte cu modificri fine n trcccrea de la
conformaia zimogenului la cea neccsar pentru cataliz, dar de majorarea mobilitii
moleculei proteice n regiunea CA. Anumeflexibilitatea, dar nu structura bine format
a centrului activ, e responsabil pentru funcia catalitic.
INH IBIIA ACTIVITII ENZIM ELOR
Activitatea enzimatic poate fi inhibat de molecule mici specifice, precum i de ioni,
n ansamblu prezentnd un mecanism de control. Distingem inhibiie specific i
nespecific. Inhibiia st la baza aciunii substanelor medicamentoase, a agenilor
toxici i poate fi reversibil i ireversibil.
La inhibiia ireversibil inhibitorul se fixeaz sau se leag covalent att de profund
de enzim, nct disocierea are loc foarte lent. n acest tip de inhibiie se formeaz un
complex enzim-inhibitor stabil, nedisociabil: E + 1 *- EI (reacie ireversibil).
Inhibiia ireversibil prezint urmtoarele caracteristici:
1. Inhibiia se accentueaz progresiv, pn la nlturarea complet a activitii enzimatice
i nu poate fi anulat prin ndeprtarea inhibitorului.
2. Se datoreaz unor modificri covalente i permanente ale gruprilor funcionale
necesare catalizei, transfonnnd enzimele n molecule inactive.
3. La nceput, acest tip de inhibiie este incomplet, dar crete pe durata timpului, pe
msur ce apar modificrile chimice respective.
Aproape toi inhibitorii ireversibili sunt substane toxice, fiind numite i otrvuri
enzimatice. Amintim n acest sens acidul iodacetic, DIPFP, metalele grele, compuii
arsenici, etc. Acetia interacioneaz cu radicalii aminoacizilor din centrul activ al enzimei,
eseniali pentru structura i funcia acestuia.
Exemple: Diizopropilfluorfosfatul (toxina neuroparalitic) se fixeaz de grupa OH
aserincinCAalacetilcolinesterazei cu fonnarea enzimei neactive:

H 3 CC H - C I I 3
I
O O
E CH 2 O P = 0 + HF
:
O o
H 3c CHCH 3 H3c CHCH 3

Iodacetamida se fixeaz de cisteina din centrul activ al enzimelor:


ICH 2 C NH 2 + E CH2 SH *- ECH 2 SCH 2 C NH 2 + HI
II I
O O
Paraclormercur benzoatul de asemena leag grupele SH din centrul activ:

COOH COOH
Ca surse nedietare de cianide poate fi nitroprusidul de sodiu (agent hipotcnsiv),
succinonitrilul (agent antidepresant), acrilonitrilul, ct i fumul de igar. Expoziia
cronic se manifest prin demielinizare, leziuni ale nervului optic, ataxia i depresia funciei
glandei tirade. Intoxicaia acut cu cianidc necesit un tratament rapid. Baza biochimic
a tratamentului efectiv const n crearea unui complex nontoxic al fiero-porfirinei.
Administrnd nitriii (NaNO, - intravenos, amilnitrita - inhalaie) convertim poriunea de
hemoglobin normal n methemoglobin (Fe3+). Ultima e capabil s fixez complexul
CN-citocromoxidazic elibernd citocromoxidaza i genernd cianmethemoglobina.
Methemoglobin este rentoars n proces graie activitii rodanazei (tiosulfat-cianid
sulftransferaza) eritrocitare, care va transforma tiosulfatul n tiocianat.

CH2 = CHCN Oxihemoglobina [H b 2 0 2 (Fe2+]


A crilo n itrilu l
N itriii (N 0 2)
N a 2 Fe(C N )5NO
Form ele reduse
N itro p ru sid u l de sodiu
Methemoglobin [^MetHbOH(Fe3+)|]
NCCH2CH2CN
Succinonitrilul [C it.aa 3 (Fe3 +)CN]


t ^ C i t . a a 3(Fe3+)]
Cianmethemoglobina
Tlios
iosulfat (S 2 0 3 )
Rodana
Rodanaza

Sulfit (S 0 3 )

Methemoglobin + Tiocianat (SCN )

La o inhibiie reversibil echilibrul dintre enzime i inhibitori se instaleaz repe


de. Inhibiia revesibil prezint urmtoarele caracteristici:
1. ntre enzim i inhibitor se formeaz un complex EI, E + 1 EI (reacie
reversibil). Reacia fiind reversibil, inhibiia poate fi nlturat prin deplasarea echilibrului
spre stnga, cu regenerarea enzimei.
2. Sc poate defini i o constant de disociere a inhibiiei complexului EI:
E+ I EI
K . J J E H I]
[ E I]
3. Inhibiia reversibil poate fi competitiv, uncompetitiv i necompetitiv.
La inhibiia competitiv inhibitorul se fixeaz de centrul activ al enzimei, ca
urmare a afinitii structurii cu substratul, concurnd cu el i mpiedicnd fixarea lui.
Nu e posibil fixarea simultan
a substratului i inhibitomlui. Hnzima
va fixa acel competitor care se
acumuleaz ntr-o concentraie mai
mare. Inhibiia competitiv diminu
eaz viteza catalizei, micornd
cota moleculelor de enzima fixatoa
re ale substratului.
Se poate prevedea efectul unor
inhibitori pentru o enzim dat, F igura 1.34. Reprezentarea grafic a ecuaiei
utiliznd ecuaia Lineweaver-Burk Lineweaver-Burk
- o form invers reciproc a ecuaiei
Michaelis-Menten. Grafic este reprezentat n fig. 1.34.
1/Vo = 1/Vmax X KM/[S] + 1/Vmax
M L J

Km 1 1
n cazul inhibiiei competitive: 0 + - ) + V,
V Vnmax [S ]

Analiznd aceast ecuaie se constat c dac concentraia S crete foarte mult, 1/[S]
tinde spre zero, iar ecuaia devine: 1 _ 1
V Vmax
n inhibiia competitiv, unde are loc interaciunea de tipul E + 1 =?== EI, KM
crete, Vmax rmne nemodificat, panta curbei L - variaz la intersepta constant
(fg. 1.35 a i b).
Prin urmare, n cazul inhibiiei
competitive viteza de reacie poate
atinge Vmax, ca i cum inhibitorul nu
ar fi prezent, dac se m rete
suficient de m ult concentraia
substratului.
Inhibitorii competitivi ns mresc
considerabil panta curbei KM, scznd
afinitatea enzimei pentru substrat.
Se ob serv c a d u g a re a
inhibitorului nu modific Vmax, deci
Figu 1.35a. Curba Michaelis-Menten n absena i atmgndu-Se viteza maxim. l l acelai
prezena inhibitorilor competitivi. timp crete mult , scznd afinitatea
a) Jaru inhibitor; b) cu cantitai nuci ile inhibitor; c) . . M
cu cantiti mari de inhibitor enzimei pentTU substrat.

Exemplu:
SDH
H O O C -C H 2 - C H 2- C O O I I - IIOO - -C O O H

Acid succinic fad F A D lb Acid lumaric
T/tS]
1/Km
F igura 1.35b. Inhibiia competitiv a) - cu inhibitor
b) - far inhibitor

O structur similar o au acizii malonic, oxalic, malic, care pot servi drept inhibitori
competitivi ai SDH.
HOOC CH2-C O O H H O O C -C O O H hooc- ch - c h 2- c o o h
I
Acid malonic Acid oxalic OH
Acid malic
Inhibitorul nu se scindeaz fennentativ. O particularitate esenial const n faptul c
efectul se nltur la cretcrea concentraiei de substrat (succinat). Acest principiu st
la baza tratamentului intoxicaiilor cu etilenglicol(CH2OU)2, component al antigelului.
Produsul oxidrii, (COOH)2, este toxic i apare ca rezultat al aciunii alcool
dehidrogenazei (ADH). Cristalele de oxalai uor se precipit, dereglnd funciilc rinichilor.
Administrarea etanolului n doze aproape toxice inhib reacia de oxidare i
etilenglicolul se elimin din organism far consecine grave.

CH 3 OH (metanol) (CH 2 OH ) 2 (etilenglicol)


Etanol ADH
O
HCHO (formaldehida) (glicoaldehida)
H
HCOOH (acid formic)
CH 2 O H -C O O H (acid glicolic)

H O C - COOH (acid glioxilic)

HCOOH (acid formic) (COOH ) 2 (acid oxalic)


Acelai mecanism st la baza tratrii intoxicrilor cu metanol. Produsul oxidrii este
acidulformic (HCOOH). Foarte sensibile la intoxicaii cu metanol sunt celulele retinei
ochiului, sistemului nervos central (depresie). O terapie ntrziat nclude hemodializa i
administrarea bicarbonailor exogeni.
O categorie important de inhibitori competitivi suntsulfamidele i derivaii respectivi.
Aciunea antibacterian a sulfamidelor const n substituirea aciduluip-aminobenzoic
(PAB) din acidulfolie, indispensabil pentru creterea microorganismelor, mpiedicnd
dezvoltarea lor. Metabolismul n organismul gazdei nu este afectat deoarece acidul folie
este asigurat de aport alimentar. Eficacitatea sulfamidelor e dependent de cantitile
administrate.
La o inhibiie necompetitiv, dar reversibil, inhibitorul i substratul se leag si
multan cu enzima, dar locusurile sunt diferite. Aciunca inhibitorului const n
micorarea numrului turnover al enzimei, dar nu i a numrului de molecule de sub
strat. Mrirea concentraiei de substrat nu micoreaz inhibiia.
Inhibiia necompetitiv prezint urmtoarele caracteristici:
1 . ntre inhibitor i substrat nu se realizeaz o competiie pentru a se lega de enzim.

2. Inhibitorul nu prezint asemnri structurale cu substratul.


3. Inhibitorul se leag de enzim n alt loc dect centrul activ.
4. Inhibitorii necompetitivi scad Vmax, dar nu afecteaz KM.
Deoarece inhibitorii se leag de enzim n alt loc dect centrul activ, este posibil
formarea complexului ES, ct i a complexului ESI. Deoarece complexul ESI nu se poate
scinda pentru a fonna produsul de reacie, la o vitez de fonnare a complexului ES mai
marc dect a complexului ESI, reacia este ncetinit, dar nu oprit.
La o inhibiie necompetitiv (noncompetitiv) de tipul
E+I 1 EI i
ES + I ESI,
KMnu se modific, Vmaxdescrete, iar panta i intersepta variaz (fig. 1,36a i b).
Se observ c 1/Vmaxcrete, deci n inhibiia necompetitiv Vm.ixscade.
Practic, n cazul inhibiiei
necompetitive inhibitorul, chiar
dac nu se leag de centrul activ v max
t al enzimei, acioneaz asupra
acesteia deformnd-o, astfel net
ea nu mai poate fonna complexul V|T>ax
ES la vitez normal pe de o
p arte, iar pe de alt parte
complexul ES format nu se mai
descompune cu vitez normal
pentru a forma produsul de
reacie. Este evident c n acest
caz inhibiia nu poate ti nlturat
prin m rirea co n ce n tra ie i
i substratului.
ES *~E + P
+
I
j
ESI

=
[
Q
Cei mai vdii inhibitori de acest tip n celulele vii sunt produsele intermediare ale
metabolismului, care se fixeaz reversibil cu locusurile specifice pe suprafaa unor
enzime reglatoare, modifcnd activitatea lor.
Iat cteva exemple:
1. Cel mai comun tip dc inhibiie necompetitiv este produs de agenii chimici care se
pot combina cu unele grupri funcionale ale enzimei; acestea, chiar dac nu fac parte din
centrul activ al enzimei, sunt eseniale pentru meninerea structurii tridimensionale i, prin
urmare, pentru activitatea catalitic a acesteia.
Spre exemplu, ionii metalelor grele (I Ig2+, Ag+, Pb2+), unele substane organice ca
acidul iodacetic, PCMB, DTNB etc. sunt inhibitori necompetitivi pentru numeroase
enzime.
2. Unele enzime metaloactive sunt inhibate necompetitiv de ageni capabili s lege
aceste metale, precum este EDTA care complexeaz ionii Mg2+, Ca2+, Mn2+.
3. Inhibitori necompetitivi sunt i CN' i pentru citocromi, substane care intervin
n ultimul segment al lanului respirator mitocondrial.
Inhibiia uncompetitiv (incompetitiv) prezint urmtoarele caracteristici:
1. Inhibitorul nu sc combin cu enzima liber i nu afecteaz relaia ei cu substratul.
2. Inhibitorul se combin cu complexul ES, formnd un complex ESI ce nu poate
genera produsul dorit.
3. Se ntlnete rar n reaciile cu un substrat, dar este frecvent n reaciile cu dou sau
mai multe substraturi.
Dcci, la o inhibiie incompetitiv panta este constant, intersepta variaz, KMi Vmax
se micoreaz (fig. 1.37a i b).
Reprezentarea grafic a ecuaiei Lineweaver-Burk n diferite cazuri de inhibiie este
redat n fig. 1.38.
E+ S

,'
ESI

F igura 1.37a. Curba Michaelis-Menten n absena i


prezena inhibitorilor incompetitivi.
a) fr inhibitor; b) cu inhibitor incompetitiv

F igu ra 1.37b. Inhibiia incompetitiv

Activitatea enzimatic poate fi inhi


bat la interaciunea
diferitor subunitti
ale enzimelor oligomere - inhibiia alos-
teric.
Izoenzim ele. Se atest enzime ce
exist n form e moleculare multiple, la
aceeai specie, n acelai esut i chiar
n aceleai celul. Catalizeaz aceeai
reacie, dar se deosebesc dup proprie
tile cinetice, dup aminoacizi ca com
ponen i succesiune. Atare fonne mul
tiple se numcsc izoenzinte.
E studiat mai detaliat LDH - lactat l/K n i a) - competitiv; b) - incompetitiv;
dehidrogenaza ce catalizeaz transfor c) - noncompetitiv; d) - f r inhibitor.

marea lactatului npiruvat. Ficcarc izo-


F igura 1.38. Reprezentarea grafic a ecuaiei
enzim e compus din 4 lanuri polipep- Lineweaver-Burk n diferite cazuri de inhibiie
tidice cu masa molecular aproximativ egal cu 33500 Da, care conin dou tipuri de
lanuri polipeptidice n diferite raporturi: A(M) i B(H), codificate de gene diferite.
Enzima ce conine H 4 se localizeaz n inim - LDHp iar cea compus din M 4 - n
muchi - LDH5. Izoenzimele difer att dup Vmaxi KMpentru substratul lor, ct i dup
sensibilitatea la modulatori alosterici (fig. 1.39-1.40). E bine cunoscut i creatin kinaza
care are 3 izoenzime (M, B, MB) la asocierea a 2 lanuri polipeptidice.

0
Originea LD, ld 4 LD, LD, LD,
M4 M 3H M 2H2 MH3 H*

Figu ra 1.39. Repartizarea electroforetic a izoenzintelor lactat dehidrogenazei

F igura 1.40. Subunitile componente ale izoenzimei lactat dehidrogenazei

Care-sfactorii ce determin prezena izoenzimelor? Acetia sunt:


1. Particularitile metabolice ale diferitelor organe.
2. Localizarea si rolul metabolic al enzimei anumite n celulele aceleiai specii -
(mitocondrii sau citozol-malat dehidrogenaza-MDH).
3. Procesul de evoluare i difereniere a esutului omului matur din formele iniial-
embrionare (LDH ficatului la embrion are o anumit caracteristic, ce se schimb o
dat cu evoluia organului; scindarea glucozei la tumori e catalizat de aceleai enzime,
proprii i embrionului).
4. Sensibilitatea la modulatorii alosterici care permit o reglare fin a reaciilor
metabolice.
5. Rezultatul mutaiilor ce modific activitatea catalitic a enzimelor i cauzeaz
maladii genetice, dar nu ntotdeauna. Se pot observa i fenomene opuse - adaptarea la
factorii nocivi.
Enzimele din celule se pot afla i n stare liber (n citozol), se pot fixa de structuri
supramolecularc (n matricea mitocondrial); se organizeaz n complexe multienzimati
ce sau asociate, ndeosebi cele ce conin mai multe subuniti (fosforilaza). Unor enzime
le este caracteristic o localizare dubl: n citozol i n mitocondrii (MDH).
Exist enzime ataate la membrane (membrana citoplasmic - adenilatciclaza);
mitocondriile nzestrate cu dou membrane se caracterizez printr-o distribuie complex
a enzimelor.
Complexele enzimatice sunt fixate de diferite structuri. P. Srerc (1985) propune tennenul
metabolon care reprezint un complex enzimatic supramolecular ce catalizeaz consecutiv
fazele unei ci metabolice i elementele structurale ale celulei. Adic noiunea includc i
substructura celular n care este absorbit complexul. Exemplu: enzimele glicolitice cu proteina
respectiv n membrana eritrocitului; complexul PDH cu elementele structurale ale
membranei interne mitocondriale; sintetaza acizilor grai etc. Dimensiunile metabolonilor
oscileaz vdit (2-5 rnJn kDa) cu diametrul particulelor 20-50 nm. Enzimele ciclului Krebs
la fel reprezint o organizare de enzime de tipul metabolonului. Este evident c enzimele n
cclule agregheaz n complexe i structuri bine determinate. Interacioneaz cu fonnarea
asocierilor de grad nalt, asigurind integritatea celulei.

CLASIFICAREA ENZIM ELOR


Principiul cardinal ce st la baza clasificrii i denumirii enzimelor e detenninat de tipul
reaciei catalizate i mecanismul ei. Criteriile acestei sistematizri constau n unntoarele:
1. Reaciile i enzimele respective sunt aranjate n ase clase, n fiecare clas se
difereniaz cteva subclase (de la 4 la 13).
2. Denumirea enzimei e compus din dou pri: prima - de numirea substratului (sau
a substraturilor), a douatipul reaciei catalizate i se finalizeaz cu -aza.
3. Fiecare ferment are codul su dup clasificarea dat: prima cifr reprezint clasa
de reacii, a doua subclasa, i a treiasubsubclasa (acceptorul), ultima cifr indic
numrul de ordine.
Enzimele, n afar de denumirea lor sistemic, mai posed i o denumire trivial. Mai
jos sunt redate cele 6 clase de enzime i unele exemple.

1. Oxidoreductazele
Enzimele date catalizeaz reaciile de oxidoreducere, transferul electronilor cu
participarea a dou substraturi: Sr + S o '= ^ = S 0 + Sr'. Sunt catalizate reaciile cu
participarea grupelor: CFI-OH (1), C-OH, C = 0 (2), CH-CH (3), CH-NH,(4) i CFI-
NH- (5).
Unele exemple de subclase:
1.1. Enzimele ce acioneaz asupra grupei CH-OFI ca donatoare.
1.1.1.1. Alcool: NA D f - oxidoreductaza (alcool dehidrogenaza)
Alcool + NAD+ Aldehid sau Ceton + NADH + FP
1.2. Enzimele ce acioneaz asupra gmpelor C-OH sau C = 0 ca donatoare.
1.2.1.12. D-gliceraldehid-3-fosfat: NAD+- oxidoreductaza (gliceraldehid-
fosfat dehidrogenaza)
D-GA-3-P +P. + NAD+ ===== D -1,3-difosfoglicerat +N A D H + H +
1.3. Enzimele ce acioneaz asupra grupei CH-CH ca donatoare.
1.3.1.3.4,5-dihidrocortizon: NADP+- oxidoreductaza (cortizon rcductaza).
4,5-dihidrocortizon + NADP+ Cortizon + NADPH + H+
1.4. Enzimele ce acioneaz asupra grupei CH-NH 2 ca donatoare.
1.4.1.3. L-glutamat: NAD(P)+- oxidoreductaza (dezaminaza). Denumirea
trivial - glutamat dehidrogenaza. Forma NAD(P)+confirm c acccptori
de electroni pot fi att N A D \ ct i NADP+.
L-glutamat + H ,0 + NAD(P) a-Cctoglutarat + N H f++
+ NAD(P)H + iP
1.5. Enzimele ce acioneaz asupra grupei C-NH ca donatoare.
1.5.1.3.5,6,7,8-tetrahidrofolat: NAD(P)+- oxidoreductaza (tetrahidrofolat
dehidrogenaza).
5,6,7,8-THF + NAD(P)+ 7,8-DHF + NAD(P)H + H+
1.6 . Enzimele ce acioneaz asupra grupelor NADH sau NADPH ca donatoare.
1.6.4.2. NAD(P)H: glutation-oxidoreductaza (glutation reductaza).
NAD(P)II + H+ + GSSG NAD(P)+ +2G SH
1.8 . Enzimele ce acioneaz asupra grupelor ce conin sulf ca donator.
1.8.4.1. Glutation: homocistin-oxidoreductaza (glutation-homocistin
transhidrogenaza).
2GSH + Homocistin = ^= GSSG + 2Homocistein.
1.11. Enzimele ce acioneaz asupra H ,0 , ca acceptor.
1.11.1.6 . H 2 0 2: H ,0 , - oxidoreductaza (catalaza).
+ H 20 2 O, + 2 H ,0
1.11.1.7. Donator: H 2 0 2 - oxidoreductaza (peroxidaza).
Donator + H 2,0 ,2 D o + 2H2,0
1.99. Alte enzime ce utilizeaz O, ca oxidant - lipooxigenaza, homogentizat oxigenaza
etc.

2. Transferazele sunt enzime ce catalizeaz transferul grupelor funcionale (G) (diferite


de atomul de hidrogen) de la un substrat la altul: S-G + S'=r-^S'-G + S.
Catalizeaz aceste enzime transferul grupelor: monocarbonice(l), cetonice sau
aldehidice (2), acil (3), glicozil (4), azotice (6 ), ce conin fosfor (7) i sulf ( 8 ). Unele
exemple:
2.1. Transferul grupelor monocarbonice.
2.1.2.1. L-scrina: tetrahidrofolat-10-oximetiltransferaza (serin-oximetil-
transferaza).
L-serina+TH F ===== Glicina + 10-oximetil-THF
2.2. Transferul grupelor aldehidice i cetonice.
2.2.1.1. D-sedoheptulozo-7-fosfat: D-gliceraldehid-3-fosft-glicolaldcbid
transferaza (transcetolaza).
D-sedoheptulozo-7-P + D-GA-3-P ===== D-R-5-P + D-X-5-P
2.2.1.2. D-scdoheptulozo-7-fosfat: D-gliceraldehid-3-fosfat-dioxiaceton
transferaza (transaldolaza).
D-sedoheptulozo-7-P + D-GA-3-P ^?^= D-E-4-P + D-F-6 -P
2.3. Transferul grupelor acil.
2.3.1.6 . Acetil-CoA: cholin-o-acetil-transferaza (cholin-acetil-transferaza)
Acetil-CoA +Cholina === CoA +o-Acetil-cholina.
2.6. Transferul grupelor azotice.
2.6.1.1. L-aspartat: 2-cetoglutarat-aminotransferaza (aspartat-aminotrans-
feraza)
L-aspartat + 2-cetoglutarat = ?= Oxaloacetat + L-glutamat
2.7. Transferul grupelor ce conin fosfor:
a) ca acceptor servete grupa alcoolic:
2.7.1.1. ATP: D-hexozo-6 -fosfat transferaza (hexokinaza).
ATP +D-hexoza ADP + D-hexozo-6 -P
2.7.1.11. ATP: D-fructozo-6 -fosfat-1-fosfotransferaza (fosfofructokinaza)
ATP + D-F- 6 -P ADP + D -F-l, 6 -diP
2.7.1.40. ATP: piruvat-fosfotransferaza (pimvatkinaza)
ATP + Piruvat *.. ADP + Fosfoenolpiruvat
b) ca acceptor servete grupa fosfat:
2.7.4.3. ATP: AMP-fosfotransferaza(adenilatkinaza):
ATP + AMP ^ ADP + ADP
2.8. Transferul grupelor ce conin sulf.
2 .8 .2 . 1 . 3 '-fosfoadenilil-sulfat: fenol-sulfotransferaza (aril-sulfotransferaza)

3 '-PAS + Fenol Adenozin-3 ',5 '-diP + Aril-sulfo-eter.

3. Hidrolazele catalizeaz reaciile de hidroliz, cu utilizarea moleculelor de ap.


3.1. Acioneaz asupra legturilor esterice.
3.1.1.3. Hidrolaza esterilor glicerolului (lipaza).
Trigliceraldehida+H20 Digliceraldehida+ Acid gras.
3.2. Acioneaz asupra compuilor glicozilici.
3.2.1.1. a-1,4-glucan-4-glucano-hidrolaza (a-amilaza)
Hidrolizeaz legturile 1-4 npolizaharide.
3.3. Acioneaz asupra legturilor eterice.
3.3.1.1. S-adenozil-L-homocistein-hidrolaza (adenozil-homocisteinaza)
S-adenozil-L-homocisteina +H20 Adenozina +L-homocisteina
3.4. Acioneaz asupra legturilor peptidice.
3.4.1.2. Aminopeptidaza. Hidrolizeaz di- i tripeptidele, scindnd restul
N-terminal.
3.4.4.1. Pepsina. Hidrolizeaz peptidele prin grupele aminice ale aminoacizilor
aromatici sau ale acizilor dicarboxilici.
3.5. Acioneaz asupra legturilor C-N.
3.5.1.2. L-glutamin-amidohidrolaza (glutaminaza)
L-glutam ina+H 20 - L-glutamat +N H 4+
3.5.1.5. Carbamid-amidohidrolaza (ureaza)
Ureea + H20 ^ , + 2NH 3
3.6. Acioneaz asupra legturilor anhidrice.
3.6.1.8 . ATP - pirofosfohidrolaza (ATP-aza)
ATP + H 2,0 ^ AMP + PP.I
4. Liazele catalizeaz adiia la legturile duble i reaciilc inverse.
4.1. C-C liazele
4.1.1.1. Carboxiliaza 2-cetoacizilor (piruvat decarboxilaza)
2-cetoacid Aldehid + ,
4.1.2. Aldchid-liazele.
4.1.2.7. Cetozo-l-fosfat-aldehid-liaza(aldolaza).
Cetozo-l-P DHOAP + Aldehid
4.1.3. Liazele cetoacizilor.
4.1.3.7. Citrat-oxaloacetat-liaza (CoA acetilat) (Citrat-sintaza sau citrat
-enzima de condensare)
Citrat + CoA Acetil-CoA + Oxaloacetat
4.2. C -0 liazele.
4.2.1.2. L-malat-hidro-liaza (fumaraza)
L-malat Fumarat + H ,0
4.2.1.3. Citrat-hidro-liaza (aconitaza).
Citrat - cis-aconitat + H20
5. Izomerazele determin transferul grupelor n interiorul moleculei, cu fonnarea
izomerilor.
5.1. Racemazele i epimerazele.
5.1.1.1. Alanin racemaza.
L-alanina D-alanina.
5.1.3.2. UDP-glucozo-4-epimeraza.
UDP-glucoza UDP-galactoza.
5.3. Oxidorcductazele intrainoleculare.
5.3.1.1. D-gliceraldehid-3-fosfat-cetoizomcraza(triozofosfat-izomeraza)
D-GA-3-P DI
5.4. Transferazele intramoleculare.
5.4.2.1. D-fosfoglicerat-2,3-fosfomutaza (fosfogliceratfosfo mutaza)
1-3-P-D-glicerat ===== 2-3-P-D-glicerat.

6. Ligazele catalizeaz reaciile, formnd legturile covalente cu utilizarea ATP.


6.1. Formarea legturilor C-O.
6.2. Fonnarea legturilor C-S.
6.2.1.1. Acetat: CoA-ligaza (ATP) (acetil-CoA-sintetaza)
ATP + Acetat + CoA AMP + PP.I + Acctil-CoA
6.3. Fonnarea legturilor C-N.
6.3.2.3. y-L-glutamil-L-cistein: glicin-ligaza (ATP)(glutation-sintetaza)
ATP + y-L-glutamil-L-cistein + L-glicina - ADP+ P. + GSII
6.4. Fonnarea legturilor C-C.
6.4.1.1. Piruvat: ,- ligaza (ATP) (piruvat-carboxilaza).
ATP + , + Piruvat*- ADP + P. + Oxaloacctat.
6.4.1.2. Acetil-CoA: CO,-ligaza (ADP) (Acetil-CoA-carboxilaza).
ATP + Acetil-CoA + ,2 ADP + P.I + Malonil-CoA.
COENZIMELE
Drept constitueni coenzimatici servcsc vitaminele. Ele nu reprezint materie
structural (de felul proteinelor, glucidelor, lipidelor), nu au valoare encrgetic, dar particip
la multiple i variate reacii metabolicc. Pentru ndeplinirea acestor roluri funcionale
organismul are nevoie de cantiti mici de vitamine. Animalele superioare i omul au
pierdut capacitatea de a sintetiza vitamina, i coninutul ei n raia alimentar e obligatorie.
Vitamina . Drept coenzim servete fonna ei activ tiamin pirofosfatul.

HUC
Tiamin pirofosft (vit.Bi)

Particip la reacii enzimatice de transfer al unei uniti de aldehid activ (n reacia


de decarboxilare oxidativ a a-cetoacizilor - piruvat, a-cetoglutarat), n reacia de
transcetolare a metabolismului glucidic; se include n alte complexe multienzimatice.
n ciclul tiazolic, datorit ionizrii azotului (N+), carbonul C, devine carbanion i
declaneaz un atac nucleofil asupra C, din molecula acidului piruvic. Ca unnare, se
fonneaz un compus de adiie, care apoi se decarboxileaz, rczultnd hidroxietil TPP
Ulterior, accsta elimin acetaldehid i regenereaz TPP.

R. Ri
CH 3
N- -CH 3 I H3c n ' CII 3
+
c=o h o o c -R o
-r2
COOH
OII
R R,
CH,
H3C N- -CH 3 N- -CH,
c=o
-. H -C - r 2 R, +
H H

La insuficiena de vitamin B, sufer dereglri sistemul nervos central, sistemul


cardiovascular, tractul gastrointestinal, drept consecin a deficitului de energie, prin
defectarea degradrii glucozei.
Vitamina , riboflavinae componenta coenzimelor flavinice.
Centrul activ al enzimelor conine unele metale, de aici i denumirea enzimelor
respectivemetaloflavoproteine. FAD i FMN sunt coenzime implicate n procesele
de oxidoreducerc. Enzimele respective se numesc fiavoenzime sauflavoproteine. In
cadrul reaciilor de oxido-reducere, concomitent, ciclul izoaloxazinic sufer reduceri
reversibile prin fixarea la azotul N ( 1 , 1 0 ) a 2 atomi de hidrogen preluai de la substrat
substratul se oxideaz, iar flavinele se reduc FMNH, sauFADH,. Acest sistem
FAD - FADH 2 sau FMN - FMNH, dispune de un potenial electric standard.

HCOH
I
HCOH
I
C lh O P 0 2 O PO 2 Riboza Adenina
Riboflavma (B2 )
FMN
~F A D
Vitamina PP niacina, niacinamida, B ,. Se include n structura a dou coenzime
nicotinamidice, care particip la reaciile de oxidoreducere NAD" i NADP'. Ambele
contribuie la dehidrogenarea substraturilortransferul unui hidrid-ionH'(H+i 2e ),
alt proton se permut n soluie (H+). Legtura cu componenii proteici este slab (enzimele
NAD+dependente particip la procesele catabolice, cele NADP+dependente anabolice).

-COOH -CONH 2

4 ,
N N'
Acid nicotinic Nicotinamida (NA)
Structura NAD + i i\ADP~

H
CONl-b -c o n h 2

0 -----CH 2 O N -----Gbb N

0 = 0 = . - _

nh2 nh2

N- N. N
= - ' < 0= - ' <
N- N^ N-
-----? 2/0.
.
II


NADH NADPH

Structura DH i NADPH
Vitamina Bhpiridoxina. Drept coenzim servesc formele activepiridoxalfosfat
i piridoxaminfosfat.

: h 2o h :o h : h 2 n h 2
2-
HO- -CH 2 OH HO- -CH 2 OPO 3 H O ' -CH 2 OPO 3
H3 O h 3c- N. 3 -
N N' N
Piridoxina Piridoxalfosfat Piridoxaminofosfat

Enzimele Bftdependente iau parte la:


1 ) procesele de transaminare, transformnd un aminoacid n cetoacid i, viceversa,

servind ca coenzim n aminotransferaze (mecanismul ping-pong) prin formarea


de baze Schiff intermediare;
2 ) reaciile de decarboxilare a am inoacizilor, ap licndu-se acelai
mecanism;
3) procesul de transsulfiirare a unor aminoacizi;
4) determinarea activitii glicogen fosforilazei (degradarea glicogenului).
Vitamina B3 acidulpcmtotenic componenta CoA. Conlucreaz la transferul gru
pelor acil, datorit grupului reactiv SHcu formarea tioesterilor.
H CH 3
I I
H O O CCH 2 - C H 2N C -C H -C -C H OH
il I i
2

O OH CH 3

-alanina Acidul pantoic

Acid pantotenic

0 H CH,
II I I
C - C H 2- CH2 N - C - ^ H - C - C H 2O
NH O OH CH
1
CH 2
CH 2
SH

Coenzim A
Vitamina H biotina servete drept coenzim a carboxilazelor ce leag ,
i-l transfer la substraturi. , se activeaz, unindu-se cu biotina i utiliznd ATP.

C O -E C O -E
I , I
(CH2)4 (CH 2 ) 4

\
c=o
V V -W
I ,o
c< -

Biotina Carboxibiotina O

Vitamina Bc - acidulfolie. Vitamina Bc n organism se reduce, formnd fermentativ


acidul tctrahidrofolic (FH4) ce servete drept coenzim (5,6 ,7,8 ), transfernd de la o
molecul la alta gruprile atomilor de carbon n cadrul diverselor reacii fermentative.

OH COOH
- N H CH Acid
I glutamic
(CH 2 ) 2
COOH
Pteridina Acid p-aminobenzoic

Acid folie (vitamina Bc)


Gruprile atomilor de carbon care sunt transferate de ctre acidul folie:
CH 3 CH2, = , , C H = N H , C H 2OH
Vitamina acidul ascorbic (organismul uman nu e apt s-l sintetizeze).
Vitamina joac un rol esenial la:
1. Reacii de hidroxilare, cu implicarea O,.
2. Hidroxilarea poate avea loc i n baza reducerii formei oxidative (pe seama
acidului dehidroascorbic).
Triptofanul 5-hidroxitriptofan.
3. Diverse reacii de oxicloreducere, n care funcioneaz cuplat cu glutationul sau
coenzimele NAD 1 si FAD - dependente.
4. Drept cofactor activator al anumitelor enzime (degradarea oxidativ a tirozinei,
fonnarea adrenalinci, etc).
O OH OH OH
II I I I
C C = C C H -C H -C H 2OH
I------- o
Acid ascorbic ( vitamina )
-91 -
Vitam ina B n ciaricobalamina posed o structur complicat, depistat n
1957. Gruparea CN din coenzim este substituit prin adenozil. Servete drept co
enzim pentru unele transmetilaze i anumite mutaze (izomeraze):
1. La transformarea homocisteinei n metionin, se utilizeaz FH4 ca donator de
CH3, dar enzima accept metil-cobalamina drept coenzim.
2. La transformarea metilmalonil CoA n succinil CoA (restructurarea scheletului de
atomi de C), drept coenzim servete 5-dezoxiadenozil cobalamina.

Vitaminele liposolubile:
Vitamina servete drept cofactor al sistemului cnzimatic (carboxilaza), ce exercit
carboxilarea acidului glutamic n gama-carboxiglutamic cu asocieri de oxigen. Acest
acid se conine n protrombin ( 1 0 resturi de acid) ce poate chelata calciul.
Se presupune c ea particip
activ la fosforilarea oxidativ,
fiindc sub aciunea antivitamine- C IL
lor acest proces se decupleaz. I
Vitamina e necesar pentru (CH 2 C H = c CH 2 )n H
coagul are (vezi capitolul
respectiv). Vitamina Kt
Vitamina A retinoluleste un derivat poliizoprenoidic, care conine nucleul
ciclohexenului i mai multe uniti izoprenice.
Retinolul (retinalul) este un component al rodopsinei din bastonaele retinei (opsina
i 1 1 -cis-retinal).

CH
I 3
3 CH
!
3

C H = C H - C = C H C H = C H C = C H CH2OH
CH 3
Retinol (vitamina A)

La absorbia de ctre rodopsin a cuantumurilor dc lumin are loc descompunerea


ei n opsin i trans-rctinal, care vor izomera ncis sub influena enzimei specifice
retinol izomeraza. Acidul retinoic particip la transportul prin stratul bilipidic al
oligozaharidelor ncoiporate n glicoproteine (graie modificrilor cis-trans.)
Vitamina E este un antioxidant. Ea protejeaz celulele de diveri oxidani toxici,
exclude oxidarea vit. A, a acizilor grai eseniali. Conlucreaz cu selenul n procesele
antioxidante i previne, de altfel, aciunea distructiv a peroxizilor.

CH 3
I
CH 2 (CH2 CH2- C H - CH2)3- H

Vitamina E

Pentru funcionarea normal a organismului sunt necesare i unele m ic r o e le m e n te


n cantiti mici (miligrame). Ele funcioneaz drept cofactori sau grupe prostetice.
Rolul pe care-1 comport:
1. Au funcie catalitic vizavi de o anumit reacie chimic, viteza creia se amplific
n prezena proteinei fermentative (Fe, Cu).
2. Ionul poate fonna simultan un complex cu substratul i centml activ al enzimei i,
atandu-se, trec n fonn activ, modificnd confonnaia.
3. La un stadiu anumit al ciclului catalitic, ionul de metal joac rolul de acceptor al
electronilorsunt antrenate metaloenzimele.
4. Ionii stabilizeaz structura enzimelor.
Exemple de diverse enzime ce conin metale:
Fe: Citocromoxidaza, catalaza, peroxidaza, proteinele fiero-sulfidice (nu conin hem,
ci un numr par de Fe i S ntr-o fonn labil).
Cu: Liziloxidaza i citocromoxidaza, conlucrnd la mpachetarea colagenului i
elastinei.
Zn: Enzimele NAD' dependente, alcool dehidrogenaza, RNA i DNA polimeraze-
lc, carbanhidraza, carboxipeptidazele.
ntre Zn2+i Cu2+sunt sesizabile fenomenele de antagonism, la fel ca i ntre Mg2" i
Ca2+.
ngrminte le minerale conin sulfat de amoniu, care surcleseaz seleniul necesar
pentru activitatea glutation peroxidazei (scindrii H ,0,). Organismul uman, pentru
funcionarea lui normal mai necesit: nichel ureaz: crom pentru asimilarea
glucozei de ctre esuturi: plumb pentru procesul de calcifiere a scheletului;
cobalt intr n componena vit. p: molibden n structura xantin oxidazei.
M etaloproteinazele reprezint o grup important de enzime care comport o
activitate major n celulele tumorale, activitate ce coreleaz cu procesul invaziv i
mctastazic. Toate au structur asemntoare, dar difer dup tipul de protein ce
scindeaz. Exemplu: scindarea colagenului (IV) din membrana bazal.
Metaloproteinazele se sintetizeaz n forma neactiv detenninat de o secven foarte
conservatoare de 9 aminoacizi. La acest capt se afl cisteina foarte reactibil, care
leag metalul n centrul activ al enzimei i blocheaz scindarea, adic capacitatea de
a scinda proteinele - int.
Ce iniiaz scindarea acestui peptid, transformnd MP n form a activ?
S-a stabilit c forma activ a metaloproteazclor nu acioneaz n prezena inhibito
rului tisular al proteazei (TIMP) o familie de proteine ce regleaz creterea
esutului. Celula tumorilor la fel le sintetizeaz, activitatea fermentativ fiind detenninat
dc echilibrul aciunii pozitive i negative a proteinelor reglatoare. TIMP sunt
supresori ai metastazei, depistndu-se deja gena absent sau inactiv din tumorile
maligne. Proteinaprodusul e ilipsete n celulele cancerigene.
Celulele ce nu metastazeaz, conin cantiti mari de protein nm 23 ( nonmetastazic),
corelnd cu trecerea celulelor de la stare normal la tumoare, cu capacitate de
invaziune. Determinarea proteinei joac un rol important n diagnosticul, pronosticul
i tratamentul bolnavului (cancer mamar).
Cum inhib proteina procesul metastazic al celulelor?
Proteina activ nm 23 favorizeaz adiia grupelor fosfat la moleculele proteice,
modificnd transferai semnalelor ce influeneaza creterea celulelor.
Pe parcursul a milioane de ani de evoluie proteina dat nu s-a modificat, i practic
rmne intact att la om, ct i la anul. La ultima e absolut necesar pentru dezvoltarea
normal a organelor ce se difereniaz din epiderma embrionului - creierul, ochii, aripile,
picioarele, organele genitale. Se poate de presupus, dup analogie, c i la om proteina
joac un rol determmant n organizarea i comunicarea intercelular. Reglarea aberant
a nm 23 conduce, n consecin, la o stare celular nestabil, ce stimuleaz comportri
autonome ale celulelor cancerigene i metastazarea lor.
Modificrile comunicaiei intercelulare, prin interniediul preparatelor sintetice, precum
i modificrile fluxului de ioni de calciu n celule pot bloca metastazele celulelor
cancerigene.
c a p it o l u l . ACIZII NUCLEICI
Studiile fundamentale (1868) ale lui F. Mischer au pus temelia chimiei nucleului celular.
Dnsul a extras nucleele cclulelor din puroiul tifoanelor chirurgicale utilizate i a demonstrat
c n aceste nuclee se afl un compus ce conine fosfor, pe care l-a denumit nuclein.
S-a constatat c aceasta e o nucleoproteid. Drept izvor de nucleoproteide servete
timusul. Aceast gland se utilizeaz ca materie experimental pentru toate investigaiile
tiinifice. A fost nevoie de decenii de cercetri, pn cnd mai multe generaii de savani
au stabilit compoziia chimic a acizilor nucleici i componentelor lor de baz.

STRUCTURA CH IM IC
Acizii nucleici sunt compui macromoleculari, degradnd hidrolitic n nuclcotide i
nucleozidc, dealtfel ei suntpolinucleotide, compui dintr-un numr foarte mare de
mononucleotide. La hidroliza complet degradeaz i mononucleotidele, genernd
baze azotate (purinice i pirimidinice), pentoze i acid fosforic n cantiti echimolare.
Bazele azotate pirimidinice sunt derivai ai pirimidinei, se ntlnesc n acizii nucleici.
De notat trei baze majore: uracilul, citozinai timina.

NH,
H
.C
ti I
. C .'sx CH, C.
n 3:
4
, HN' CH HN CH
I !!
11 CH CH
^ 6 /'/' 'S, M
N N N o N
H II
Uracilul Timina Utozina
Pirimidina 2,4-dioxipiri- 5-metil-2,4-dioxi- 2-oxi-4-amino-
midina pirimidina pirimidina

Exist i unele baze minore pirimidinice ca: 5-metil-citozina i 5-hidoximetil-


citozina, metiluridina, tiouridina, pseudouridina.

0
Riboza
H N ^ S lf
i !
( " N /
H

5-rrEtil-citozina 5-hidroximetil-citozina Pseudouridina (\)/) 4-tiouridina


Acizii nucleici conin i bazepurinice adenina iguanin. Purina este derivatul
pirimidinei: molecula conine inele condensate ale pirimidinei i imidazolului.

NH, O
H II
.N ,N ^ ^N
Ni -,C A\ N" C' HN C ^ \\
I II CH I I! CH CH
HC* , / HC c. C.
N N 'N 'N H,N
H H
A denina G uanina
Purina (6-am ino-purina) (2-am ino-6-oxipurina)

Se ntlnesc n acizii nucleici i baze purinice minore ca: 2-metil-adenina, 6-metil-


adenina, 1-metil-guanina, 7-metil-gunina i inozina. Bazele minore se conin n circa
5% i difer mult de la o specie la alta.

HN N
>
- N 'N ' NH
'N H
Riboza I
6-metil-adenina 2-metil-guanina Inozina 7-metil-guanina

Proprietile
Bazele azotate prezint fenom enul de tautomerie (structuri ce difer prin poziia
unui atom de hidrogen i a unei duble legturi): formele lactim sau lactam, ultimele mai
stabile, predomin n structur.

O OH OH
HN | j _______ a N ^K , N ^ j

O '^ N ^ 0 '^ " 'N HO '4 N'"


H H
Laclarn I.actim Dublul lactim

Bazele azotate sunt slab solubile n ap; cele pirimidinice au o structur plan, cele
puriniceaproape plan, puin pliat. Bazele pirimidinice sunt mai stabile dect cele
purinicc. Bazele azotate posed maxim capacitate de absorbie de ultraviolet (ntre
260-280 nm), ceea ce permite determinarea cantitii dc acizi nuclcici (cu att mai
mult ai componentelor- baze, nucleozide). Pentru identificare se utilizeaz i cromatografia
etc.
La o hidroliz menajat nucleotidele degradeaz n nucleozide i acid fosforic.
Nucleozidul constituie N-nucleozide ale bazelor purinice sau pirimidinice, n care glucidul,
pentoza (riboza sau dezoxiriboza) cu atomul su de C, formeaz legtura glicozidic cu
Nj (pirimidina) sau N 9 (purina). Legtura glucozidic n nucleozidele naturale este .
Pentozele sunt prezente n forma furanozic, fonnnd legtura cu hidroxilul semiacetalic.
Distingem ribonucleozide i dezoxiribonucleozide. Nucleozidele sunt mai solubile n
ap dect bazele azotate, mai stabile n soluii alcaline i uor sc hidrolizeaz la nclzire n
mediul acid, producnd baze libere i pentoze. n organism nucleozidele sunt hidrolizate
de nucleozidaze specifice. Denumirea nucleozidelor deriv de la bazele azotate prin
adugarea sufixelor: -uzina, pentru derivaii purinici i -idina, pentru cei pirimidinici.
Adenina i riboza rezult n adenozin, respectiv: guanozina) aceiai analogi cu
dezoxiriboza; uridina, citidina, timina, cu dezoxiriboza, se numete timidin, iar
compusul timinei din tRNA poart denumirea de riboziltimin.
Din punct de vedere steric, nucleozidele pot avea dou conformaii: sin i anti. Forma
anti este caracteristic compuilor naturali, fiind cerut de aezarea corect a bazelor
complementare n structura dublu helicoidal a DNA. n forma Z conformaia sin
alterneaz cu anti.
Esterii fosforici ai nucleozidelor egaleaza cu nucleotidele la legturile C 5 i C 3 ale
pentozei. n dezoxiribonucleotide se manifest numai aceste dou poziii, iar
ribonucleotidele se completeaz i cu poziia Cr Modificnd condiiile de hidroliz, se
pot obine toate tipurile. Celulele n stare liber coopteaz, preponderent n poziia 5',
grupa fosfat. Structural, pentoza sau dezoxipentoza ocup o poziie dc legtur ntre
fosfat i baze azotate.

Nom enclatorul nucleotidelor i nucleozidelor

Purinice Pirimidinice
BAZELE
A denina (A) G uanina (G) Citozina (C) U racilul (U) Tim ina (T)
A denozin G uanozina Citidina U ridina
N uclcozidul n: dA dcnozina dG uanozina dCitidina Tim idina
A denilat G uanilat Citidilat U iidilat
N uclcotidui n: dCitidilat
D NA dA denilat dG uanilat Timidilat

N ucleozid ADP GDP CDP UDP


difosfai dADP dGDP dCDP TDP
N ucleozid ATP GTP CTP UTP
trifosfai dATP dGTP dCTP TTP

Ambele mononucleotide reprezint acizi deosebit de activi i se afl sub fonn de 5'-
mono, di- sau trifosfai. Grupa fosfat 2 i 3 uor poate fi hidrolizat de enzime specifice,
far scindarea altor legturi.
Rolul nucleotidelor
1. Element structural al acizilor nucleici.
2. ATPpurttorul energiei chimice n celul, servete la transferul grupelor fosfat
macroergice i prezint cheia de legtur ntre procesele ce decurg cu eliminarea,
degajarea energiei i ntre cele ce utilizeaz energia. ADP i AMP se fonneaz n
rezultatul defosforilrii ATP, fosforilnd pn la ATP n procesul respiraiei tisulare. Ciclul
ADP-ATP n celul constituie sistemul principal de transfer al grupei fosforice.
3. Acizii nucleici iau parte la transfenil unor blocuri de constmcie (acidul acetic,
glucoza, cholina), transfonnndu-le n substane biologice active uridinddifosfatglucoz,
citinddifosfatcholina etc.
4. Servesc ca precursori macroergici ai unitilor mononucleotidice la sinteza
fermentativ a DNA i RNA, cednd grupa pirofosfat, se transform n resturi de
nucleozidmonofosfatbaza structural a lanului polinucleotidic.
5. Unele mononucleotide primordiale conin i ali compui - nicotinamida n nicotin-
amidmononucleotid, precursorul NAD, vit. B, n flavinmononucleotid i FAD.
6 . n organisme sunt prezente 2 feluri de esteri fosforici ai nucleotidelor (AMP, ADP,

ATP), n alte cazuri fosfatul leag 2 atomi de O, ai pentozei n cadrul aceluiai nucleotid,
fonnndu-se nucleotide ciclice - 2',3' i 3',5'.

OH OH 0:-P - 0
AMP AMPc 2,3' AMPc 3',5

Produsul 2',3' rezult ca intermediar la degradarea ribonucleotidelor, pe cnd AMPc


3',5' este un ribonucleotid natural, ce posed proprieti unice i o activitate biologic
deosebit, reglnd metabolismul ca mesager al efectului hormonal.
DNA. Structura primar. Polinucleotidele sunt realizate prin stabilirea legturilor
covalente ntre nucleotidele ce se succed n lan. Gruparea '-hidroxil a unui nucleotid
este legat de gruparea 5'-hidroxil a mononucleotidului urmtor prin legtura fosfo-
diesteric. Att DNA, ct i RNA au proprieti comune chimice i fizice sunt greu
solubile n soluii acide, dar uor se extrag din esut cu ajutorul soluiilor de sruri neutre
i fenol.
Bazele azotate sunt responsabile de informaia genetic, pe cnd grupele glucidi-
ce i fosfatul au o funcie structural. DNAconceptul actual structural s-a fonnat prin
anii 1950. Moleculele de DNA din celulele tuturor speciilor sunt compuse din 4
mononucleotide dAMP, dGMP, dCMP i TMP, legate intr-o secven variat cu punile
3',5'-fosfodiesterice. Dar raportul i succesiunea nucleotidelor, greutatea molccular a
DNA din diferite organisme vor fi diferite. Se nregistreaz i o cantitate nu prea mare de
derivai metilai ai bazelor.
DNA e un polimer cu o catena extrem de mare zcci dc mii dc uniti monomcrc.
Lanul poate fi reprezentat schematic n felul urmtor: pentru baze servesc simbolurile:
A,G,C,T; liniile verticale corespund pentozelor, iar linia diagonal cu simbolul P reprezint
legtura fosfodiesteric ca leag captul unei linii verticale cu mijlocul celeilalte.
Locusul legrii corespunde '-OI I i 5'-OH.

3'
a 4 OII
Lanul are o direcie i o polaritate specificcapetele 5'-OH i '-OH care nu
sunt angajate ntr-o legtur internucleotidic. S-a convenit c structura unei
catene polinucleotidice va fi indicaia strict dc la captul 5' spre stnga, iar cel 3' spre
dreapta. Direcia 5' 3'.
Pna la mijlocul secolului trecut enigma DNA nu era descoperit, pe cnd istoria
DNA ncepe cu F. Mischer. n 1944,0.Colin, C.McLeod i M.McCarty au demon
strat c acizii nucleici de tipul dezoxi sunt factorul detenninantn transfonnnle extractului
de pneumococi III forme le neviru lente se transformau n virulente, la adugarea
DNA extrase din formele virulente ale pneumococilor. Proprietile virulente se transmit
prin ereditate.
Cu ajutorul izotopilor radioactivi, Alfred Hershey i Martha Chase au demonstrat
c informaia genetic pentru replicarea virusului T, n celulele Escherichia coli e
transmis nu dc componenta proteic, dar dc DNA. S-a constatat c anume DNA este
componenta cromozomilor, purttoarea informaiei genetice n cclulcle vii.
Un merit major la descoperirea tainelor structurii DNA i aparine lui Erwin Chargaff,
care, la sfritul anilor 40 al secolului trecut, a ajuns la urmtoarele concluzii:
1. Preparatele de DNA obinute din esuturile aceleiai specii de organisme au
componena nucleotidic identic.
2. Componena nucleotidic a DNA e diferit la diferite specii.
3. Componena nuclcotidic a DNA la aceeai spccic nu se modific cu vrsta, nu
depinde de alimentare i de influena mediului ambiant.
4. Numrul resturilor de adenin n orice DNA, indiferent dc spccic, este egal cu cel
al timinei A = T; G = C. Din acest raport rezult c A + G = T + C.
Aceste relaii au facilitat nelegerea codificrii informaiei gcneticcn DNA i transmiterii
de la o generaie la alta. Secvena mononucleotidelor n lanulpolinucleotidic al
DNA reprezint structura sa primar, structura covalent. Aceast structur e
stabilizat de legturile fosfodiesterice.
S tru ctu ra secundar. n 1953, J.Watson i F.Crick au depistat structura
tridimensional a DNA i au propus mecanismul posibil al replicaiciun fenomen
excepional n istoria biologiei, ce a deschis calea conceptului funcionrii genei la
nivel molecular. Ei au analizat tabloul difraciei razelor X, efectuate pe cristale de DNA
de ctre R.Franklin i M.Wilkins, au propus modelul structural, care n linii generale e
justificat i const n urmtoarele caracteristici:
1. Dou lanuri polidezoxiribonucleotidice se rsucesc helicoidal n jurul unei axe
comune. Lanurile au sens opus, sunt antiparalele, formnd o dubl elice cu orientare
spre dreapta (fig.2 . 1 ).
2. Bazele azotate, hidrofobe sunt orientate spre interior i perpendicular pe axa
elicei, inelele glucidice, legate prin resturi fosfat, constituie schcletul extern al dublului
helix i sunt orientate aproape sub un unghi drept fa dc baze. Toate gruprile fosfat
la pH = 7 sunt ionizate i ncrcate negativ (fig. 2.2).
3. Cilindrul ce ncadreaz dublul helix are un diametru de 20, distana ntre bazele
azotate nvecinate e de 3,4 A, iar poziia uneia fa de alta este de 36 grade. Structura se
repet dup 10 nucleotide, avnd o perioad de identitate (pasul) de 34 (3,4nm) (fig.
2.3.).

Figura 2.1. Spirala ile DNA, F ig u r a 2 .2 . M o d elu l spiralei F ig u r a 2 .3 . M odelul schem atic
al
potrivit axei spiralei duble de DNA bazele ocup dublului helix de DMA. Structura se
interiorul, iar scheletul glucido- repet dup 36 , ce corespunde la III
fo s fo r ic - exteriorul cilindrului n ,v ,r/ nflecare caten
4. Stabilitatea dublului helix e asigurat de
interaciunile hidrofobe ntre bazele azotate, precum
i dc legturile de hidrogen ce se stabilesc ntre
bazele azotate de pc o caten i cele complemen
tare de pe cealalt. Dublul helix este de tip plecto-
nemical(adic transversal n acelai plan), i nu
paranemical (adic longitudinal). Legturile de
hidrogen determin primordial mperecherea spe
cific a bazelor.
5. n seciune, dublul helix are trei straturi:
a) unul intem, cu bazele nucleice;
b) unul mij lociuglucidiccu planurile dispu
se radiar;
c) altul periferic resturi de acid fosforic;
d) cele dou catcne delimiteaz pe suprafaa
moleculei 2 caneluri:mareimic(fig. 2.4.).
6 . Nu exist limitri n succesiunea bazelor azo

tate din lanul polinucleotidic; o anumit secven- Figura 2 4 ModeM spaial al dMului
determin O informaie genetic concret. helix de DNA. Se vd cele 2 caneluri -
O proprietate primordial a dublului helix "Iare ^ l m,c ^
e mpachetarea specific a bazelor azotate.
Rcieind din limitrile sterice i din capacitatea de a fonna legtura de hidrogen, se
postuleaz c adenina se mperecheaz numai cu timina, guanina cu citozina. Acest
spaiu poate fi ocupat numai de perechea purin-pirimidinic: pentru 2 purine e mic,
pentru 2 pirimidine e mare i nu pot forma legturi de hidrogen. mpachetarea depin
de i de regulile de formare a legturii de hidrogen. Hidrogenul ocup o anumit
poziie n baze. Adenina nu sc poate mperechea cu citozina, la fel cum guanina nu se
poate mperechea cu timina, fiindc n locul unei legturi s-ar gsi doi atomi de hidro
gen, iar n alt locnici unul.
Adenina fonneaz cu timina dou legturi de hidrogen, pe cnd guanina cu citozina
trei. Orientarea acestor legturi i deprtarea dintre ele e optim pentru o interaciune
puternic ntre baze.
E de menionat c cele dou catene antiparalele ale dublului helix de DNA nu
sunt identice nici dup succesiunea bazelor, nici dup componena lor. Ele sunt
numai complementare una fa de alta. Una conine adenina, cealalt neaprat
timina; guaninei i corespunde citozina.
Investigaiile efectuate la dou Universiti din Cambridge au confirmat c s-a sintetizat,
cristalizat i descifrat structura a dou fragmente de DNA deosebite. n mijlocul lor
se afl o secven, n care catena conine multe A, iar cea complementarT. E curios
faptul c aceast DNA are proprieti uimitoare e rezistent la aciunea factorilor
externi. Care-i cauza? Aceeai a-elice de dreapta, n care A i T n fiecare pereche
sunt dispuse una fa de alta aidoma clicelor la elicopter, adic nu sunt n acelai plan.
Efcctul este neordinar: 1) e mai ngust cnelui spiralei; 2) NH, a A ocup o poziie de
mijloc ntre O, a dou T nvecinate, formnd legturi de hidrogen n plus cu T din lan
o legtura vertical ce joncioncaz longitudinal stivele dc baze azotate. Rezult o
rezisten mai mare la factorii nocivi ai mediului. Astfel, legturile sunt proprii i proteinelor,
dar n DNA s-au stabilit pentru prima dat.
n dependen de cantitatea de ap i fora ionic a mediului, configuraia dublului
helix al DNA se poate modifica. Este elocvent prezena ctorva fonne de DNA.
Forma B spirala clasic a lui Watson i Crickconine lOresiri, ca perioad de
identitate e de dreapta i planul bazelor e perpendicular pe axa spiralei. Forma A -
pasul e compus din 1 1 resturi i planul deviaz aproximativ cu 2 0 grade fa dc
perpendicular de pe axa spiralei. Se fonneaz la dehidratarea fonnei beta. Dac A
ndeplinete rolul de matrice n transcripie, apoi rolul dc matrice la replicarea DNA
(ambele sunt n confomaia anti). Forma Z rsucit spre stnga, conine 12 resturi la
pas (fig. 2.5).
Dublul helix are o rezisten deosebit, concordat cu rolul de purttor al
informaiei genetice. Nu este o structur rigid, fixat pe toat lungimea ei. Ea este
supus permanent unor defonnaii interne, ce oscileaz dc la o parte a moleculei la alta,
adic posed un anumit dinamism. Acestor devieri le e caracteristic dependena de
anftirajul extern al moleculei de DNA.
Structura teriar. n procesul de izolare a DNA s-a stabilit c n unele segmente
dublul helix poate fi mpachetat ntr-o structur tridimensional superhelix sau
form deschis - inelar, ce presupune integritatea catenei, dar nu fonn geometric.
28
F igu ra 2.5. Compararea form elor , i Z de
I DNA. Structurile se deosebesc dup pasul
spiralei i orientarea perechilor de haze fat
de ax (20" ,6" ,7), diametru! (26A., 20A ,
18A l distanta dintre bazele azotate nvecinate
(2,6A ; 3,4A ; 3,7A )
z

Forma negativ superspiralizat


dc DNA

ADP*.
DNA-giraza
ATP3 a)

Fonna relaxat de DNA

A
b)
DNA-giraza

Fonna pozitiv superspiralizat de DNA


F igu ra 2.7. Lk numr. n poziia (a) este
Figura 2.6. Superspirulizarea DNA sub egal cu 1, iar n (b) = 6
aciunea DNA-girazei
Unele molecule ale DNA sunt liniare, altele, la virusuri,
X,
li sc pot transformam inelare, cptnd o proprietate
nou. Forma inelar, far spire, e denumit relaxat.
V)
!'j Pentru transformarea ci n spiral e nevoie de energie.
\X Se consider c energia unei DNA spiralate e
V'\
proporional cu ptratul numrului de spire n helix
DNA relaxat (fig. 2 .6 ).
I.k * 200 Superspiralizarea denot funcii biologice: 1 )
' V mpachetarea DNA ntr-o fonn mai compact dect
cea relaxat; 2 ) determin gradul de desfacere a du
6( ) ^ blului helix i interaciunea cu alte molecule.
Superspiralizarea negativ favorizeaz desfacerea

\) helixului. Aproape toate formele inelare din natur sunt
negativ superspiralizate.
ii U jj
v:J O caracteristic esenial a DNA inelar este
Ul =198 !.h202
Figura 2.7a. Superspirala numml de rsuciri, adic de cte ori un lan l va ntretia
negativ i pozitiv pe altul, dac se vor proiecta pc acelai plan (fig.2.7).
Acest numr (Lk- linking number) trebuie s fie ntreg,
e o caracteristic tipologic i poate varia, dac ntr-un lan sau n ambele se fac
rupturi. S-au izolat enzime ce au atare funcie.Densitatea superhelical (o) reprezint
relaia dintre diferena numrului de
spiralizri () faa de numrul de spire
prezente n DNA relaxat (Lko) =/ DNA dublul helix
Lko. Semnul negativ al densitii
superhelicale indic superspiralizarea
negativ a DNA underwound, iar
pozitiv superspiralizarea pozitiv
overwound ( fig 2.7.a)
O particularitate distinctiv a mole
culei de DNA naturale e lungimea ei
lanul DNA al omului constituie aproxi
mativ 2 m; organismul dispune de apro
ximativ IO13 celule. Lungimea tuturor
f \ \ Asocierea
Disocierea'
DNA ale omului este de 2x10 10 km.
catenelor i j catenelor
Comparm cu distana pn la Soare
1,44x 108 km i perimetrul Pmntului
4x104 km. Unitatea de lungime egal cu
1 0 0 0 perechi sau nucleotide este o kilo-
V J /V
baz (aproximativ are o mas molecular
egal cu 660 kDa i o lungime de 3,4
mkm). Separarea complct a catcnclor
nclzind soluia dc DNA, adugind F igura 2.7b. Denaturarea reversibil i
acid sau baz, putem disocia catenele renaturarea DNA
de DNA. La o Cromozomi mitotici
anumit tempera 1
Linker DNA Cromatida
tur are loc procesul
Hi stone de d e sfacere a (diam etrul ~ 600 nm)

d u b lu lu i h elix -
denaturarea lui.
iHistone Degradarea unei
D NA
core jumti de structur
spiralic are loc la
Nucleozom te m p e ratu ra de
topire. Dublul helix
F igura 2.8. Nucleozomul cu
e o structur cu un
DNA linker i histonele H t
grad mare de coo-
perativitate. Temperatura de topire depinde de compo
nena nucleotidic. Moleculele bogate n i G au o
temperatur mai nalt dect cele nnobilate cu A i T. Dac
temperatura e mai joas dect cea de topire, lanurile de
DNA reasociaz cu fonnarea dublului helix, produendu-
se regenerarea renaturarea (fig 2.1b).
Aproape tot DNA n celula eucariotelor se afl n
cromatina nucleului, care formeaz cromozomi naintea
mitozei. Cromatina conine DNA (35%), RNA (5%),
proteine specifice (60%). DNA n cromatin este legat de Fibra de
proteine-histone, care mpacheteaz compact DNA i crom atin
(diam etrul - 30
formeaz uniti structuralenucleozomi. Ele sunt sta
bilizate de fore electrostatice. Nucleozomii au o struc
tur asementoare fonnei discului.
DNA ncolcete histonele. ntre nucleozomi se situ
eaz DNA de legtur (linker) (fig. 2.8.). Nucleozomii (diam etrul ~ 10
ocup o anumit poziie n spaiu. Modelul mpachetrii
DNA n nucleozomi, cromatin, cromatide cromozomi
mitotici este redat n fig. 2.8.a.
mpachetarea DNA cu proteinele n spaiu reprezint
structura sa cuaternar. Un rol deosebit l au hertonele
proteine nehistonice. Diametrul unei superspirale de
DNA e egal n medie cu 90 ntr-o spir sunt localiza
te 80 de perechi de baze pasul ei.
Cristalografia cu raze Roentgen a constatat c buclele DNA
pe carc se ncolcete DNA reprezint octameri, fiecare
fiind constituit din 8 molecule proteice a cte 2H4,2 H 3,
H, A i H,B (fig 2.8.b). Octamerul este nfurat de DNA Figura 2.8a. Modelul
npachetrii DNA n
(dublul helix) cu lungimea de 146 nucleotide cromozomi
nucleozomul, ce recent s-a confirmat, cu ajutorul
F igura 2.9. PoHnucleozomii constituind
un solenoid cu diametru! de 30

2 4
( )
F igura 2.8b. Reprezentarea spaial a proteinelor in itucleozom

nucleazclor. In cromatina eucariotclor polinucleozomii fonneaz un superhelix, dispunn-


du-se dup un solenoid cu un pas de 10 nm i diametrul de 30 nm (fig. 2.9.).
Molecula Hj de histone este ataat de partea exterioar a catenei de DNA i dc ambele
capcte ale DNA de legtur. S-a stabilit c proteinele ce formeaz octam erul
nucleozomului nu se deosebesc mult la diferite sp e c iinu exist o diferen
esenial a succesiunii aminoacizilor, ceea ce confirm c nu doar mpachetarea
DNA constituie funcia acestor proteine. n caz contrar, n-ar fi fost nevoie de a pstra
timp de milioane de ani consecutivitatea aminoacizilor, fiindc orice protein cu un
coninut mare de aminoacizi pozitivi, ar detennina mpachetarea DNA ncrcat negativ,
n alte capitole vom examina rolul acestor histone n reglarea genelor.

J.W atson F.Crick


STRUCTURA RNA
Acizii ribonucleici sunt produi macromoleculari, fiind rezultani ai policondensrii
ribonucleotidelor. Nucleotidclc se racordeaz prin fosfat diesteric3'5'. Numrul de
nucleotide variaz de la 75 - la multe mii. Structura covalent a RNA se deosebete de
DNA prin urmtoarele:
1. Restul de zahr e riboza, dar nu dezoxiriboza.
2. Una din bazele azotate n RNA e uracilul i nu timina care fonneaz o pereche cu
adenina. De rnd cu aceste baze majore, RNA mai conine baze minore, rezultnddin
metilarea, tiolarea celor majore.
3. Molecula de RNA este monocatenar (cu excepia vimilor). De aceea, compozi
ia nucleotidic nu se supune legitii complementare coninutul de adenin nu e egal
cu al uracilului i al guaninei cu citozina, adic structura dubl catenar complementar
pentru RNA este exclus. Se evideniaz ns unele poriuni, unde complementaritatea
bazelor permite organizarea n structuri duble helicoidale. Poriunile de baze
necomplementare sunt expulzate n fonne de bucle n afara zonelor de dublu helix,
mpachetarea bazelor nu e perfect, unele dintre ele nefiind complementare. Cota dublului
helix n diferite RNA variaz mult, atingnd 50%. Cantitatea de RNA, spre deosebire de
cea de DNA, variaz de la o celul la alta i chiar n cadrul aceleiai celule, n funcie de
intensitatea proceselor metabolice.
Deosebim 3 tipuri de RNA:
RNA mesager (mRNA) (informaional, matriceal) fiecrei gene i corespunde
molecula sa de mRNA, de aceea acest tip de RNA este foarte heterogen. Conceptul de
mRNA a fost postulat de F. Jacob i J.Monod n 1961. Studiind reglarea sintezei
proteinelor la E.coli, au ajuns la concluzia prezenei unui mesager structural de durat
scurt ce transmite mesajul genetic din nucleu n citoplasm i are urmtoarea caracteristic:
1. acest intennediar trebuie sa fie polinucleotid;
2. componena nucleotidic trebuie s corespund celei din DNA ce o codific;
3. este foarte heterogen dup lungime. Savanii nominalizai au presupus c trei
nucleotide codific un aminoacid i au constatat c masa mesagerului nu e mai mare de
500 kDa;
4. e asociat temporar cu ribozomii loc de sintez a proteinelor;
5. se sintetizeaz i degradeaz foarte rapid.
Savanii au demonstrat experimental cele argumentate i, ca rezultat, au mai conclu
zionat: ribozomii sunt structuri nespecializate ce sintetizeaz n anumit moment acca
protein care este codificat de mRNA i se afl n ribozomi.
Folosind metoda hibridizrii propus de Sol Spiegelman (1961), s-a constatat c
secvena bazelor n mRNA e complementar secvenei din DNA matriceal.
Lungimea catenei de mRNA e dependent de lanul polipeptidic ce implic sintetizarea.
mRNA poate s mai conin secvene neinformative la captul 5' terminal de diferit
lungime (lider). Dac mRNA conduce un singur mesaj, e numit monogen, dac mai
multe poligen. Ea poate conine regiuni intergenenetranslabilc denumite linker.
Timpul de supravieuire e variabil (minute- ore). Nucleazele reprezint enzimele ce
degradeaz acizii nucleici.
RNA de transfer (tRNA) reprezint 10-20% din RNA celular, fiind molecule mici
(70-90 nucleotide) cu o mas molecular de circa 30.000 Da. n structura primar, pe
lng cele 4 nucleotide majore (A,G,C,U), se mai ntlnesc pseudouridina, A,G,C metilate.
Pseudouridina (vezi mai sus) -C-l al ribozei este legat n poziia 5 (C5) a uracilului (nu
e legtura N-glicozidic, ci C-C). Sunt prezente dihidrouridina, inozinanucleozidul
ribozei i al hipoxantinei.

NH

HOH2C o N

V?
OH
Dihidrouridina
Inozina

Moleculele de tRNA reprezint o conformaie aidoma foii de trifoi, unde mai mult
de 1/2 din baze sunt complementare. Toate moleculele de tRNA posed particulariti
structurale comune, fiindc toate interacioneaz n acelai mod cu mRNA i ribozomii
cu enzimele ce catalizeaz activarea aminoacizilor i fonnarea legturilor peptidice (fig.
2.10.).
Caracteristica tRNA:
1. Sunt monocatenare cu un numr mic
de ribonucleotide.
2. Conin baze minore (metilate)
metilarea mpiedic mpachetarea unor baze
capabile de alte interaciuni, modific
capacitatea hidrofob a unor segmente de
RNA.
3. Posed 4 zone de perechi comple
mentare i 3 necomplementare, expulzate n
form de bucle:
a) captul 5' tenninal are rest guanilic
fosforilat;
b) captul 3' term inal - secvena
nucleotid CCA. Aminoacidul activat se
leag de '-OH al adenozinei;
c) la captul buclei inferioare se afl
poriunea anticodon compus din 7 baze -
Pir - Pir - X - Y - Z, purin modificat, baz
variabil. Tripletul (XYZ) e complementar F igura 2.10. Structura tRNA atu cu secvena
nucleotidic
secvcnei nucleotidicc din mRNA;
Bucla TtyC Bucla am inoacidic
------------------ _ 1(----- ----------

3'
Captul 3'

Bucla 5'
dihidroU
1 0 -2 5

B ucla
anticodon
A nticodon

F ig u ra 2 .1 1 a . F otografia structurii Figura 2.11b. imaginea schematic a structurii


tridimensionale a tRNA Phe din drojdii tridimensionale a tRNA Phe din drojdii

d) secvenele normale din bucla ^ riboziltimidilat asigur legarea n ribozom a


complexului AA - tRNA sintetazic cu rRNA;
e) secvena de nucleotide din bucla dihidrouridinic recunoate o anumit secven
din rRNA ce se leag cu A A tRNA sintetaz.
Studiile cristalografice au stabilit structura tridimensional a tRNA (fig.2.11. a i b).
1. Are fonna de L.
2. Molecula include 2 segmente de dublu helix situate perpendicularfiecare
helix are circa 10 perechi de baze.
3. Majoritatea bazelor formeaz n afara spiralei legturi de hidrogen deosebite.
Interaciuni teriare apar ntre baze necomplementare (A-A, C-G, A-). Resturile
ribozofosfat pot interaciona cu baze i ntre ele (2-OH pentoza). Multe baze sunt
aranjate n stive. Aceast interaciune hidrofob determin arhitectonica molecular.
Viruii segreg RNA mono sau bicatenar n molecule native mpachetate n membrana
proteic (specificitate).
rRNA (RNA ribozomal) sunt macromoleculc flexibile i deformabile, conin mai
puine baze metilate dect tRNA; zonele duble catenarc sunt ntrerupte de zone
monocatenare, extrem de heterogene dup form i mrime. n funcie de constanta de
sedimentare distingem mai multe tipuri. Fiecarc tip are structura sa tridimensional. Din
totalul de RNA celular rRNA i revine aproximativ 75%. rRNA se leag cu diverse
proteine, constituind o particul ribonucleoproteic denumit ribozom, care este ataat
reticulului endoplasmatic (fig. 2.12).
Ribozomii pot disocia reversibil n 2 subuniti 50S i 30S la procariote (A) i 60S-
40S la eucariote (B). Subunitatea mare integreaz rRNA 23S, 5S i 34 tipuri de
proteine L34 (large-mare). Subunitatea mic - rRNA -1 6S i 21 proteine S21 (small-
mic). La eucarioterespectiv, vezi fig.2.12.
80S

60S
50 S A 2 .5 0 0 .0 0 0 D a X 30S 40S
4 .2 0 0 .0 0 0 Da

1.600.000 Da 9 0 0 .0 0 0 Da 2 .8 0 0 .0 0 0 Da
1.400.000 Da

/ \ / \ \
*''**'**

160 120
120 nuclcotidc
n u cicu u u c --- nuclcotidc
2900 1540 1900 5,8S RN A r f 5S RNAr
nuclcotidc nuclcotidc n u c lc o tid c , r , , nuclcotidc nuclcotidc,
5S RNAr 23S RNAr 16S RN A r 18S RNAr 28S RNAr
34 proteine 21 proteine 45 proteine 33 proteine

Figura 2.12. Structura ribozomului la procariote (A) i la eucariote (B)

n 1987 a fost elaborat harta siturii celor 21 proteine n subunitatea 30S la


E. coli. Modelul tridimensional al proteinelor e practic canonizat i e inclus n manualele
contemporane de biochimie. Utilizarea metodei bombardrii cu tritiu (planigrafii cu
tritiu) a pennis stabilirea perfect a proteinelor expuse la suprafaa subunitii ribozomale
i celor din interior. S-a constatat c suprafeele de contact ale subunitilor la asocicre n
ribozomul integru nu au protein, adic subunitile interacioneaz numai cu RNA-ul lor.
Studiile mai recente (1996) au confirmat conturul subunitii 30 S n corespundere cu
ultimele date ale microscopiei crioelectronice, ceea ce a permis corectarea hrii
tridimensionale a interpoziiei proteinelor n aceast subunitate.
Pe suprafaa fiecrui ribozom se profileaz 2 situsuri: situsul aminoacidic (A) i
situsul peptidilic (P). Experienele efectuate de Masayasu Nomura, prin metoda asamblrii
subunitii mici, au demonstrat c:
1) Toat informaia necesar pentru asamblare se conine n componentele ei structurale.
2) Pentru asamblare nu sunt necesari factorii neribozomali.
REPLICAREA (BIOSINTEZA DNA) DNA parental

Organismele vii trebuie s-i pstreze nu numai


integritatea secvenei nucleotidclor din DNA (repa I
rarea), dar s-i reproduc foarte exact i subtil DNA in 1
p&,. Ml 1
propriu n mitoza celular. Enzimele replicrii acio &-.mi**'
neaz perfect i rapid (la bacterii ntr-o secund se
polimerizeaz pn la 500 nucleotide). Operativitatea
i precizia sunt datorate unui complex multienzima-
ticmecanism perfect compus din diferite proteine. ^ **. V*1
n proccsul de replicare infonnaia codificat n ta Mb
secvena bazelor moleculei de DNA parental este * im^4 \/svr/
||

Ml 4*- I\ I
transferat cu o exactitate maxim cclulei-fiice de III Ml
DNA. Replicarea se bazeaz pe mpachetarea com 1 1> * *

. f mi*"
plementar a bazelor nucleice. Activitatea matricea IM *- AMI .
l a DNA se manifest prin faptul c secvena Ml s' 1 V-**!
mi
nucleotidic se reproduce prin aceast mpachetare \ |, I% I -?
Ml "
111
** M i t
complementar a bazelor (fig. 2.13).
Replicarea const n desfacerea dublului helix / * IM
l \I / J"* * 1 V'Wk
parental i construirea catenelor pe fiecare dintre cele fj m * . m i *- 111 w v
*. M l v r ' \ y m mi yr
2 catene complementare replica cclor dinti. Re 'I * \ / - 4-
zult 2 molecule de DNA identice cu parentala. DNA M olcculc DNA
parental fiicc p a re n ta l
Fiecare dintre ele conserveaz o caten parental
veche. Aadar, proccsul replicrii e semiconserva- F igura 2.13. Replicarea DNA
dup J. Watson i F.Crick
tiv.
Precizrile lui J. Watson i F.Crick au fost confirmate de M.Meselson i F.Stahl,
care au cultivat Escherichia coli n diferite medii cu izotopi marcai. n 1956 a fost
descris prima enzim ce catalizeaz polimerizarea fennentativ DNA -polimeraza.
Procesul de biosintez este deosebit de complex i necesit urmtoarele:
1. Prezena matricei DNA (templat).
2. Prezena celor 4 dRN trifosfai dATP, dGTP, dCTP si TTP.
3. Prezena ribonucleozid trifosfailorATP, GTP, CTP, UTP
4. Prezena ionilor de magneziu.
5. Sistem multienzimatic n baza constituenilor:
a) helicaza enzim ce realizeaz desfacerea dublului helix parental n dou
catene complementare. Desfacerea decurge treptat, n poriuni mici de DNA, pe
msur ce replicarea avanseaz. Cele dou catene vor rmne separate ca urmare a
interveniei proteinelor de stabilizare (SSB) a DNA monocatenare. La desfacerea unei
perechi de baze se utilizeaz minimum 2 molecule de ATP. Un rol important la desfacere
i revine unei enzime topoizomerazei;
b) RNAprimaza sintetizeaz mici fragmente de RNA - primer;
c) DNA polimeraza preia indicaiile dc la matricea care decide-secvena mononu-
cleotidelor n catena nou-sintetizat (o sintetizeaz n direcia 5' 3'). Enzima are
i o aciune exonuclcazic, exciznd nucleotidele de la ambele capetc alccatcnci.
Sunt atestate trei enzime de DNA-polimcraza (I, II, III). Enzima exercit i funcia
de control a replicrii, asigurnd procesului o eficien sporit. Cele expuse sunt confirmate
prin:
1. Sinteza ce evolueaz n prezena celor 4 dezoxiribonucleotidtrifosfai i a DNA
matriceal.
2. Componena nucleotidic a DNA sintetizat, dependent de caracterul matricei, dar
nu de numrul relativ al nucleotidelor.
3. Cea mai convingtoare prob - DNA fagului FX174 replicat in vitro de DNA
polimeraz e complet contagioas erorile la sintez sunt extrem de rare.
d) DNA - ligazaenzima ce catalizeaz formarea legturilor fosfodiesterice ntre 3'-
OH ale unui fragment i 5'- monofosfat ale celuilalt. Reacia necesit ATP sau NAD'
(la procariote). Capetele trebuie s aparin moleculelor bicatenare de DNA, n
cadrul reconstituirii sau splicing-ului catenei de DNA la recombinarea genetic.
Procesul decurge n felul urmtor:
1.E + ATP E-AMP + PP I
(aminogrupa lizinei din enzim se leag cu fosfatul din AMP)
2.E -A M P + P-5'-DNA E + AMP-(P)-5'-DNA.
3. DNA-3'-OH + AMP-(P)-5'-DNA DNA-3'-(P)-5'-DNA + AMP
4. PP I + HOH *- 2P.1
Fora motrice a procesului de sudare a catenei e hidroliza pirofosfatului.
Recent s-a stabilit c sinteza DNA se cupleaz cu desfurarea DNA parental. Lo
calizarea acestui proces e denumitfurc de replicaie. Ea ncepe ntr-un loc anumit cu
extinderea la aceeai vitez n ambele direcii (fig. 2.14).

Topoizomeraza < j

Dna - Helicaza

Proteine de stabilizare
Prim ozom a DnaB
DnaC complex
Primaza
Prim er

rN M P
dNMP

5
Lanul lider
r Lanul succesor
F igura 2.14. Imaginea schematic a proceselor fermentative n regiunea bifurcaiei
DNA templat Enzima helicaza (Dna B), ce desfoar DNA,
conduce la formarea superspirelor (torsiuni
pozitive) ntr-o molecul inelar. In regiunea furcii
DNA parental se rsucete cu o vitez de 100
rotaii pc secund. Continuarea procesului de
S egm ente
replicare implic lichidarea acestor structuri
repetabile -9pb formate de rotaie. Topoizomeraza (DNA
T andem ul A =T (13)
giraza) efectucaz rupturi monocatenare, apoi
sudeaz legtura fosfodiesteric i favorizeaz re
DnaA laxarea structurii teriare a DNA.
Iniierea specific a unui ciclu nou de
replicaie este determinat de complexul de
proteine specifice (Dna A), aductor al complexului
dc protein Dna - Dna la poriunea anumit a
genei, adic punctul (origine) de replicaie(OR).
Timpul de iniiere a replicaiei este o valoare critic
coordonat cu mitoza celulei. Proteinele Dna se
deplaseaz pe DNA, utiliznd energia hidrolitic a
ATP. Enzima servete drept semnal pentru
activarea primazei. n fig. 2.14a este redat iniierea
replicaiei la E.coli.
S-a stabilit c DNA polimeraza nu e capabil
s iniieze sinteza catenei. Ea are nevoie de un
fragment cu grup liber '-OH. Acest fragment
este sintetizat de primaz (Dna G - proteina) -
Replicarea un fragment complementar cuplat la DNA

T andem ul A = T (13) Site-urile dc fixare a Dna A proteine dc segm ente repetabile -9pb
------- ----- \ !-----------------------------------------------r------------- T--------------1
w
&
djGATCTNTTNTTTT TTATCCACA

F igura 2.14a. Iniierea replicaiei (model) la E.coli:


a) Aproximativ 20 molecule proteice Dna A legate cu A TPse fixeaz de cele 4 segmente repetabile ce conin
9 perechi de baze. DNA se ataeaz la acest complex.
b) Tandemul compus din cele 3 segmente A= T (13) cu baze repetabile este denaturat secvenial.
c) Hexamerul DnaB proteine se asociaz cu proteinele DnaC. DnuB helicaza pregtete despiralizarca
DNA pentru sinteza primerului in replicare.
d) Aranjamentul secvenelor n crearea fu rcii replicative ori C.

matrice. Primaza nu solicit iniiator al sintezei. DNAp supravegheaz fragmentul


sintetizat de primaz i nltur toate nucleotidele necomplementare (activitatea
exonucleazic 3' - 5'), posednd funcia de autocorecie, numai dup care ncepe
procesul de sintez catalizat de un complex multienzimatic (holoenzim). Grupa 3'-
OH a ribonucleozidului e un iniiator al sintezei DNA.
Cum se produce elongarea? Se declaneaz un atac nuclcofil al captului '-OH pe
atomul de fosfor (P), n apropierea ribozei din dRNTP ulterioar. Sc formeaz o
legtur fosfodiesteric i se elibereaz pirofosfatul-hidroliza, cruia determin
polimerizarea propriu-zis. Elongarea se produce n direcia 5' 3'.

O'
I
O -P-O '
I
o
0 P-0- 0~
O P-0
o - P -o 0
5 0 3' ; o 5 L o- P-0
5# 6
P r im e r - ' .' I OH 1 OH
te o* I i fc
A $ i t
'a'
@ fi 0 iA- G

D N A tem plat i i m j
si Elongarea catenei de DNA
3 'm "m
D ezoxiriboza

Fenomenul e procesiv, adic enzima adiioneaz multe nucleotide, fiind legat i


dirijat de matrice. Catenele DNA parental nu sunt paralele, adic orientarea sintezei
pentru o caten e 5' 3', iar pentru alta - 3' 5'. Toate DNA cunoscute pn
la moment sintetizeaz numai n direcia 5' - 3'. Cum are loc sinteza celorlalte catene?
R.Okazaki, renumit savant japonez, a determinat c o bun parte a acestei catene se
prezint sub forma unor
segm ente de nucleotide
DNA Lanul lider
g iraza
(100-200 la eucariote i
1000-2000 la procariote)
(fig.2.15).
"DnaB P e rsiste n a lo r e
helicaza frag m en tar, de scurt
DNA SSB RNA prim er durat i se apropie efectiv
primaza RNA n fr.O kazaki
p r im e r dc bifurcaie.
O dat cu avansarea
bifurcaiei, fragmentele se
leag covalent cu ajutorul
DNA-ligazei i se formeaz
Sinteza lanului
succcsor DNAp III catena fiic, catena n care
polimerizarea fragmentelor n
d ire c ia 5' 3' se
produce la nivel atomic, pe
cnd la nivel general se
F igura 2.15. Sinteza fragmentelor Okazaki ex tin d e n d ire c ia
3' -- 5'. Sinteza fiecrui;segment Oka
zaki necesit primer; DNA polimeraza I
sintetizeaz n continuare catena i, avnd
o aciu n e e x o n u c le a z ic , exclude
primercle. In fine, fragmentele vor fi sudate
de DNA ligaze, cu consum de ATP. Dar
fiindc replicarea e bidirecional, pe cea
lalt bifiircaie a replicrii procesul decurge
identic. Datorit fidelitii sporite, se
menine capitalul genetic al speciei (fig.
2.16).
Ce fa c to r i reclam sin te za
primerului? De ce DNAp nu sintetizeaz
catena de novo? S-a stabilit c dac
enzima ar avea o anume capacitate
F igura 2.16. Modelul replicrii n replizont, rezultant, ar fi incompatibil cu fidelitatea
cu replicarea simultan a ambelor catene
nalt a acestui proces. Pentru a forma o
nou legtur fosfodiesteric enzima controleaz perfect geneza perechii de baze
complementare. Funcia de redactor permite reducerea greelilor pn la minimum.
RNAp nu posed o atare funcie i, eventual, apar falsuri de mperecheri. De aceea, se
sintetizeaz un fragment de nucleotide cu o fidelitate joas, dar numai temporar, DNAp
le controleaz i exclude greelile (o eroare Ia 109' 10perechi de baze). Se cunoate c
sistemele enzimatice autocorectoare nu pot iniia
5
sinteza de novo i toate enzimele care iniiaz o astfel
n r
de sintez nu sunt capabile de autocontrol i, n felul 3'
acesta, crete mult numrul de mutaii.
R epararea DNA. Totui, o mulime de reageni
chimici i fizici provoac lezri sttucturale n DNA.
Celulele posed mecanisme specifice de reparare.
Multe modificri pot fi reparate datorit faptului c DNAp
informaia genetic se conine n ambele catene i
poate fi pstrat n secvena de nucleotide, dat fiind
funcionarea unui ansamblu de enzime de reparaie
care controleaz DNA i-l repar. Procesul decurge
conform fig. 2.17. D NAp
1. Una dintre metodele de reparaie o constituie
excluderea dimerului de pirimidin, care apare sub T f r r r m 11
influena razelor ultraviolete:
a) Endonucleozidazele specifice (E) taie catena DNA
ligaza
i fragmentul iese din helix. J i m 11 m
b) DNAp (I) repar, concomitent sintctiznd Figura 2.17. Repararea fragm entului de
normal catena. Ca primer servete '-OH liber al DNA
lanului ntrerupt, iar ca matrice se utilizeaz catena
complementar.
c) Dimerul este exclus sub aciunea exonucleazic a DNAp.
d) Sudarea o execut DNA-ligaza.
Menionm maladia xeroderma pigmentosum n care pielea e deosebit de sensibil
la razele soarelui, la ultraviolet. Epiteliul devine uscat, se atrofiaz, apare cheratoza,
sunt afectai ochii. In consecin, apare cancerul pielii, bolnavii mor de timpuriu.
Studiind fibroblatii pielii, s-a constatat c la aceti
bolnavi nu sunt exclui dimerii pirimidinici. Faptul se expli Rest glucozofosfat
o CT c a c c
c prin lipsa activrii endonucleazei ce hidrolizeaz catena
de DNA n preajma dimerului. G A T A G O

Dimerul poate fi scindat i fotochimic. Toate celulele I D czam inarc


conin enzima fotoreagent, care-1 identific i-l scindeaz, j spontan
G t( u)
utiliznd energia luminii (DNA fotoliaza).
Fluctuaiile termice dezordonate ale moleculelor din ce giis
ia as
G A G GG
lule pot modifica mult starea genelor. DNA al fiecrei ce
U raci!-D N A
lule n 24 ore pierde 5000 de resturi de purin (apurini- glucozidaza
zare), 100 de citozine i pierd grupa NH2(pag.l42 ).
GOT AT
Dimerul de timin (legturile covalente ntre 2T) deja a
fost descris. Cum se menine stabilitatea genelor? 1
GA TAGG
1. n mod analog, cu excluderea dimerului dc timin. Nucleazclc
scindcaz
Alte modificri vor fi excluse datorit funcionrii diverse segm entul n
lor nucleaze de reparaie. care lipsete baza

2. DNA glucozidazele (peste 20) exclud bazele
modificate. S-au depistat multe enzime (circa 50), ce G A G T A G

repar DNA modificat. Care-i cauza c DNA posed ONA-


p o lim craza
timina, dar nu uracilul cu toate c ambele baze se DNA-ligaza
C A. c c
mperecheaz cu adenina. De ce uracilul metilat se identific
numai n DNA? Cert e c metilarea utilizeaz mult energie. CG A C T A G G
S-a stabilit c citozina n DNA spontan se dezamineaz,
fonnnd uracil (proces mutagen). F igu ra 2.18. Uracilul din DNA
Mutatia aprut se repar sub aciunea sistemului de est.e exf ls ?' [nlocult cu hazu
. . . . . _ primara - citozina
reparaie, care identifica uracilul strin (fig. 2.18).
1. Uracil-DNA glucozidaza hidrolizeaz legtura glucozidic a uracilului cu
dezoxiriboza (baza este eliminat).
2. Endonucleaza specific identific defectul i scindeaz scheletul n preajma
bazei n lipsa ei.
3. DNAp sintetizeaz catena include citozina complementar guaninei n catena
intact.
4. DNA-ligaza sudeaz catcna nou-sintetizat.
Prima enzim uracil-DN A glucozidazanu exclude timina, fiindc grupa CH, e
indiccle diferenierii de citozina dezaminal. Dac n-ar fi acel CI L, uracilul adecvat nu s-
ar deosebi de cel format din citozin i defectul ar rmne neobservat, conducnd la o
mutaie.
Sistemul de reparaie solicit un astfel de uracil aprut (mutagen) i las intact timina,
inhibnd mutaiile. Se consider c timina se utilizeaz pentru amplificarea exactitii
informaiei genetice. RNA nu se repar i utilizeaz uracilul ca bloc de construcie mai
ieftin.
Particularitile biosintezei DNA la eucariote
Rcplicarea DNA la eucariote sc desfoar dup un mecanism asemntor cu cel de
la procariote, prezentnd unele particulariti:
1. Replicarea la eucariote este la fel semiconservativ.
2. Complexitatea organizrii materialului cromozomial la eucariote face ca fragmentele
Okazaki s fie mult mai scurte (150-200 nucleotide), fa de procariote (1000-2000
nucleotide).
3. Tot datorit nucleozomilor, furca de replicare se deplaseaz mai lent la eucariote
fa de procariote; la eucariote se adaug lanul de DNA 3.000 nucleotide/min, iar la
procariote 16.000 nucleotide /min.
4. Datorit mrimii moleculei de DNA, la eucariote exist mai multe FR, de unde
sinteza ncepe simultan (~100). Dac ar exista o singur origine de replicare, sinteza
DNA pe un cromozom ar necesita circa 800 ore; dar ntreaga replicare se desfoar n
faza S a ciclului celular, deci n 8-10 ore, ceea ce se explic prin nceperea replicrii
simultan, n mai multe puncte de replicare.
5. Originea furcilor de replicare nu este ntmpltoare de-a lungul unui cromozom; ele
sunt grupate ntr-o anumit zon a cromozomului, alctuind o unitate de replicare sau
replizom.
6. La eucariote DNA-polimerazele sunt de asemenea de mai multe feluri: a, , , 8.
- DNA-polimeraza a este implicat n replicarea DNA nuclear. Este o protein
oligomer alctuit din patru subuniti i se pare c este responsabil de sinteza lanului
succesor.
- DNA-polimeraza are mai degrab un rol reparatoriu datorat aciunii sale
exonucleazice 5' 3'.
- DNA-polimeraza este implicat n replicarea DNA mitocondrial.
- DNA-polimeraza 5 este rspunztoare de sinteza lanului conductor, manifestnd
i o activitate.3' - 5' exonucleazic; este asociat cu o protein numit antigen nuclear,
care-i stimuleaz activitatea.
7. Biosinteza DNA are loc numai n faza S a ciclului celular, separat dc mitoz prin
fazele de gol sintetic G, i Gr n cursul acestei faze DNA nuclear este replicat n ntregime
i o singur dat per ciclu celular; respectarea acestui imperativ este posibil datorit
unor procese de metilare, care marcheaz covalent molecula de DNA ce a trecut prin
experiena replicrii. Metilarea se realizeaz la citozin, formnd 5-metil-citozin i are
loc sub aciunea unor metilaze carc folosesc S-adcnozilmetionina ca donatoare de grupri
metil. Secvcna recunoscut de metilare este: 5-CG-3'
3-GC-5'
La cucariotele superioare un numr restrns de celule se divizeaz activ; cclc mai
multe sunt reinute n faza G(| de nondiviziune. Decizia intrrii din faza G()n G : i apoi S
este luat de proteine cu activitate kinazic, activare prin interaciunea cu diverse cicline,
a cror concentraie sufer modificri profunde de-a lungul ciclului celular.
8. Ritmul sintezei de histone este similar celui de sintez a DNA -ului; n faza S a
ciclului celular cantitatea de DNA i histonele se dubleaz. Cele vechi rmn n nucleozom
pe una din celulele-fiice. Cele noi sintetizate se unesc n nucleozom pe cealalt caten.
Telomeraza
Incontestabil, complexul rcplicativ
se mic pe cafenele antiparalele ale I DNA parental i
dublului helix, simultan n direcii 5------------- I l y L j
diferite. Sinteza unei catene-fiice este
continu, iar cealalt se sintetizeaz 3

sub forma fragmentelor Okazaki, care Replicarea


sunt reparate prin excizie, completate
^ Lanul lider*
cu dezoxiribonucleotide i apoi cusute
Primer
de DNA-ligaz. DNAp pot aduga
nucleotide numai la captul 31 al
catenei crescnde, fiindc nu exist
Prime r
enzime pentru elongarea nucleotidelor
la cap 5'.
Ultima din RNA primer nu poate fi Primerul scurtat
>_3
completat ca replic de DNA, dat
fiind c eventual nu exist ceva ce Gap
necesit prelungire. De aceea, captul
3' al catenei-sens din DNA parental
este nereplicat, iar captul 5' al catenei
antisens-fiic de DNA este mai scurt
i, deci, captul 3' al catenei-sens
parentale este necuplat (fig. 2.19).
Savantul A.Olovnicov (1971) a
sugerat ideea c, potenial, exist un
m ecanism biologic specific, ce
F igura 2.19. Rolul telomerazei n meninerea
prevede efectul dat. Se presupune, de structurii DNA
altfel, c acest posibil mecanism e activ
n celulele sexuale, cancerigene i n celulele organismelor ce se nmulesc vegetativ. Nu
este activ mecanismul n majoritatea altor cazuri i, n particular, n majoritatea celulelor
somatice.
Studiile au confirmat, mult mai trziu, prezena enzimei ce compenseaz scurtarea
DNA n majoritatea celulelor enumerate i ea a fost numit telomeraz transferaz
terminal a telomerei.
Funcia const n creterea unui hexanucleotid repetabil multiplu (TTAGGG) la
capetele DNA nuclear, ce formeaz aa-numita telomer la om. n final, nu se pierde
mesajul genetic i nu e dereglat mecanismul de descifrare a lui. Aadar, problema azi
const n replicarea incomplet a catenei ntrerupte de DNA, ns dac cromozomul
dispune la captul 3' de proeminen unicatenar overheng, apoi are loc o replicare
incomplet i a catenei lider.
Telomeraza prezint o enzim-ribonucleoproteid compus din RNA i protein. Ea
compenseaz marginalitatea replicm obinuite, utiliznd dezoxiribonucleotidc i ca matrice
o parte din succcsiunea RNA, subunitate a telomerazei. Enzima posed funcie de
transcriptaz invers celularrevers transcriptaza.
Telomeraza protejeaz cromozomul de degradare i prentmpin alipirea
cromozomilor ntre ei. E tiut c DNA-polimeraza e capabil s sintetizeze n direcia
5 3', utiliznd RN A-primer ca iniiator, apoi, dup nlturarea lui, captul 5'-terminal
al replicii rmne nereplicat. i, n consecin, la fiecare diviziune celular cromozomii se
micoreaz. Aceste particulariti ale replicrii determin formarea conccptului c
telomeraza posed un mecanism specific deosebit, ce determin longevitatea celulei.
Studiul genelor ce codific subunitile RNA a favorizat aplicarea testelor genetice-
cheie, ce au confirmat c RNA-telomeric dicteaz succesiunea nucleotidelor n
telomerele cromozomiale in vivo.
Subunitatea proteic TRT (Telomerase Reverse Transcriptase) a fost depistat n
organismele filogenetic nenrudite (de la unicelulare pn la om), ce confirm c poate fi
universal pentru eucariote care posed telomeraz.
Unele proprieti ale TRT nu difer de cele ale cunoscutelor revers transcriptaze i
funcioneaz n complexe ribonucleoproteice stabile. S-a stabilit c RT (revers
transcriptaza) SID-ei poate fi transformat n enzima ce funcioneaz ca telomeraz,
preschimbnd simplu ionul Mn~*' n Mg*+. n atare condiii RT (revers transcriptaza) rmne
n complex stabil cu matricea RNA i multiplu copie un fragment mic din lungimea sa.
Aceste enzime posed i unele particulariti ce le deosebesc dc RT cunoscute. Sunt mai
mari, au domeniul N-terminal de baz i o distan neobinuit de mare ntre motivele A i
B. Sunt modificri n resturile aminoacizilor n domeniile RT, care au caracter de
conservatism vdit printre celelalte RT obinuite.
Datele recente pennit reprezentarea schemei construciei moleculare a TRT. Activitatea
catalitic a telomerazei necesit numai 2 componente: RNA i proteina TRT. Un argument
convingtor este reconstrucia activitii telomerazei din subunitile recombinate izolate,
purificate de RNA i TRT. Alte proteine sunt fixate de acest complex i pot avea un alt
rol dect acel de participare la formarea centrului catalitic iau parte la proccsul dc
reglare a activitii telomerazei.
Mecanismul elongrii capetelor cromozomului este redat n figura 2.20. Se alungete
captul 3' al DNA, i datorit lui punctul extrem din replica 51se mic spre dreapta. n
continuare catena complementar se elongheaz, cu implicarea DNA-polimerazci.
Mecanismul sintezei G-catenei de telomeraz se studiaz mult mai intens, dect acel al
sintetizrii catenei complementare C.
Exist, posibil, 2 mecanisme de sintez a catenei C.
a) Prin utilizarea catenei G ca primer, formnd bucle:
Telomeraz RNA templat
B ucla este un su b strat
nefavorabil pentru DNAp care
(a) DNA nu po ate fo rm a p erech i
3'' Watson-Crick; proteinele nu
sunt capabile s se fixeze dc
orice structuri.
b) E mai verosimil mecanis-
IPolimerizarea i hibridizarea mul standard de iniiere a
sin te ze i, cu p a rtic ip a re a
OH<3*> enzimelor care iau parte la
sinteza catenei ntrerupte:
primaza, DNA polimeraza n
complex cu proteinele cores
punztoare:
iTranslocarea i rehibridizarea
-//--------- ------------------------r
--------------------------------------- 5'
5 TTTTGGGGTrTTGGQGTG ;3')^ Analiza telom erelor din
,, diferite organisme denot c
sinteza C-catenei a DNA-
Ic) telomerice are loc la fel ca i la
o replicare bidirecional a DNA
sau, n alte cazuri, fiind rezultatul
Polimerizarea Proteine fixate unei reacii de completare,
de telomere
care substituie fragmentele G-
0 O
CA lant repetabile unicatenare n DNA
(d) TG lant
b ic aten a r telo m eric.
Asemenea reacii de nlocuire
sunt necesare n foarte multe
cazuri de detenninare a lungimii
TRF 1 i TRF2 telomerei. -catena joac un rol
activ n detenninarea numrului
Figura 2.20. Mecanismul elongrii capetelor cromozomiale de repetri pe care telomeraza
le poate aduga la captul
DNA. Replicarea telomerei se afl sub un control complex, implicnd i nucleaze.
S-a confirmat, la mijlocul anilor 1990, c telomeraza ce compenseaz tierea
cromozomilor este o enzim caracteristic pentru celulele cancerigene. n aceste celule
cancerigene telomera este scurt i stabil, iar activitatea telomerazei este foarte intens.
Totodat, activitatea telomerazei nu e detectat n celulele somatice la om, unde DNA
telomeric lung la natere (12-15 mii de nucleotide) se scurteaz cu vrsta, conform
ipotezei expuse.
E studiat suficient telomeraza la Tetrahymena theirnophila care conine peste 40000
telomere la o celul. Aceast enzim e depistat i caracterizat, utiliznd metoda direct,
precum i reacia polimerazic n lan.
Caracteristica fermentativ a telomerazelor (TM):
a) In vitro TM sunt neprocesive, adic alungesc cromozomul numai o singur dat,
cu o telomer repetabil.
Telomeraza la om e un ferment inalt procesiv, ce alungete DNA-primer la sute de
repetri. Procesivitatea e dependent de anumite condiii. S-a stabilit c dac primeml
are o lungime mai mic dect 10 nucleotide, el se alungete o singur dat. Procesul
poate fi intensificat, dac se adaug din abunden oligonucleotide. Dac primeml are
mai mult de 10 nucleotide, procesul devine procesiv i DNA poate conine mii de
nucleotide.
Se presupune c n telomeraz, pe lng fragmentul-matrice al RNA, e prezent i un
alt fragment de fixare ancor- site. E posibil c primerii majori se fixeaz de acest
fragment, ceea ce evit disocierea produsului i-i permite telomerazei s funcioneze
procesiv. Exist modele schematice referitoare la acest proces.
b) Specificitatea de substrat elongaia primerilor netelomerici are loc la o
concentraie de M g^ nu mai puin de 1,25 mM i n lipsa de K.+i Na+. Primar e alungit
captul 3' cu blocul dGGGGT. Eficacitatea e dependent de structura primar att 5', ct
i 3' a oligonucleotidelor. Telomeraza cu aceeai eficacitate utilizeaz n catena
polinucleotidic dezoxi, precum i didezoxiribonucleotid trifosfai. n ultimul caz are loc
finalizarea sintezei DNA.
n calitate de substrat se utilizeaz rGTP i rTTP, procesul e procesiv la concentraii
de 10-100 mkM de rTR. Pot fi utilizai i primere DNA-RNA. Ca substrat, ns, mai
convenabil din punct de vedere termodinamic este duplexul RN A-RNA.
Cele descrise, precum i datele dc secven aminoacidic n proteina telomerazica
p95, confirm c evolutiv tclomerazele au provenit din RNA polimeraze RNA-
dependente.
c) Activitate exonucleazic i permite s hidrolizeze att primerile, ct i produsele
sintezei femientative. Ea nltur toate resturile nucleotidice netelomerice i ncepe sinteza
DNA ntotdeauna cu dG (la procariote, la eucariote date deocamdat lipsesc). Care-i
sensul acestei activiti? Activitatea de corecie determin o sintez corect, aseamntoare
cu RNAp DNA dependent.
Structura i funcia RNA telomerazice. Sinteza la om a acestei subuniti
j determinat dc RNAp III, la eucariotele primare de RNAp II. Conservatismul n
structura RNA e foarte mic, chiar i la organismele nrudite.
Structura primar difer nu numai n succesiunea nucleotidelor, dar i n lungimea
lor, care se mrete spre eucariote.
La majoritatea RNA telomerice regiunea matriceal se afl la o deprtare de 50
I nucleotide de la captul 5'. Omologia e foarte mic i la genele RNA telometrazice
I coincidena la om i oarece este de 65%.
Structura secundar e bine studiat la tetrahimene: compus din 4 bucle i un
I fragment unicatenar, ce conine matrice pentru sinteza DNA tclomcrice. Unele sunt regiuni
I conservative, altele formeaz unghiuri una fa de alta (60), motive ce ar fi recunoscute
I de proteinele telomerazice. Se presupune i prezena ccntrului fermentativ (fig. 2.21).
Un component al centrului activ este regiunea matriceal a RNA telomerazicc. Orice
modificare n aceast secven a RNA
telomerazic conduce la modificri
complementare n structura primar a
telomerei.
A ceste schim bri (m utaii) nu
modific activitatea telomerazei, dar
modific telomera, cu consecinele
respective o mbtrnire precoce sau
moartea celulei. Dac unele mutaii se
ra 2.21. Structura secundar a RNA telomeruzice
manifest imediat, apoi altele acioneaz Flaigu tetrahimene
ca o bomb genetic, ce va aprea dup
600 replicaii, conducnd la o cretere necontrolat.
E clar c, pe lng funcia sa de matrice pentru sinteza DNA telomerazic, RNA
telomerazic ia parte la funcia catalitic a telomerazei.
A fost realizat reconstrucia activitii telomerazei i la om. S-a stabilit c fragmentul
funcional ntre 1-203 resturi; fragmentul 1- 44 spre 5' terminal nu e esenial pentru
activitatea fermentativ, iar mutaiile ntre 170 -199 complet inactiveaz enzim. Posibil
c aceast regiune interacioneaz cu proteinele telomerazice.
Proteinele complexului telomerazic.
Spirala dubl de DNA telomeric umana este fixat de proteina TREI, care modific
conformaia DNA, formnd o
superspiral. n care o rotaie e
format din sute de perechi de
baze. S -a constatat recent c o
alt proteinTRF2, ce se leag
la captul 5'-terminal al catenei C,
fixeaz telom era la baz
(trunchi), cu formarea unei bucle
telom erice gigant (t-bucl)
comparabil cu dimensiunile
telomerei (fig.2.22).
Structura domenic a TRF1 e
redat schematic n desen.
Ca proteina s interacioneze cu
acidul nucleic este necesar
oligomerizarca polipeptidelor
pentru care i servete TRF

o
domenul. Fiecare molecul de
TRF1 am
H,N T~1 TRF 1nfoar DNA sub un unghi
TRF2 coon
H,N-CZ ~n de 120. E x p erim en tal s-a
0 constatat c n prezena TRF1 e
Figura 2.22. Modelul schematic al buclelor telomerice i
facilitat circulaia moleculei
structura domenic a proteinelor telomerice T R F l i TRF2.
Structura domenic a proteinelor telomerice TRFI i TRF2 scurte de DNA, compus din
segmente telomerice repetate, ce confirm rolul proteinei n formarea structurii spaiale
telomerice.
Proteina TRF2 dup structur e asemntoare cuTRFl, dar domenul final nu interacioneaz
cu domeniile omoloage ale reprezentantei urmtoare din familia respectiv i deci ambele
proteine n molecul pot exist n fonn de homodimeri. TRF2, ca i TRF1, n consecina
splaisingului alternativ formeaz dou variante.
S-a constatat c TRF2 se ataeaz n regiunea contactului telomeric cu baza (desenul).
Buclele telomerice s-au depistat n cromozomii celulelor HeLa, n leucocitele periferice la om,
n hepatocitele oriceilor etc. Cele mai mici bucle conin circa o mie de perechi de baze.
Fixarea TRF2 la captul cromozomului necesit un segment de DNA telomeric ce conine nu
mai puin de 6 nucleotide (TTAGGG). Cu ct mai multe sunt segmentele repetabile, cu att
procesul de fixare e mai favorizat. Se consider c n acest ioc DNA unicatenar-3', hibridizat
cu poriunea antiparalel parial desfurat a spiralei duble trunchi, fonneaz aa - numita
bucla-d (displacement loop).
Consecinele fenotipi.ee n modificrile activitii proteinelor TRF. Lungimea
telomerelor este asociat cu vrsta celulelor fenotipice. In celulele somatice, graie lipsei
telomerazei sau a altor cauze, numrul segmentelor repetate telomerice se micoreaz la
fiecare diviziune celular. La fibroblati in vitro, dublarea numrului de celule duce la
micorarea telomerei cu 48-21 perechi nucleotidice. In vivo, la fibroblatii umani valoarea
e de 75 perechi la o mitoz. Telomera celulelor sanguine periferice la copii pierde mai mult
de 1000 perechi nuclcotidicc n an. Sc consider c ntre 4 i 20 ani telomerele se micoreaz
mai ncet, dar la vrst matur i senil se micoreaz cu o vitez constant de 30-60
perechi nucleotide anual.
Cu vrsta, telomerele ating o lungime critic, la fibroblatii omului circa 5-7 mii perechi, la
care apare o mbtrnire replicativ i n consecina inhibiia i stoparea proliferaiei.
Expresia artificial a telomerazei prentmpin mbtrnirea i e posibil de imortalizat celulele
respective, ce ntlnim n celulele cancerigene. n ultimele inhibnd telomeraza, e posibil stoparea
rspndirii celulelor.
S-a constatat c expresia proteinei TRF 1n cultura celular duce la o mitoz prematur i
moartea celulelor. Reglarea expresiei permite celulelor s supravieuiasc, dar dup cteva
cicluri celulare are loc micorarea telomerelor. n condiiile de inhibare a sintezei TRF1 n
celule, ce exprescaz telomeraza, are loc o cretere lent a lungimii telomerelor. Posibil, TRF1
favorizeaz fonnarea t-buclei, mpiedicnd creterea telomerelor din contul activitii
telomerazice. S-a artat c TRF 1 in vitro inhibib lungirea catenei - telomerice.
Inhibiia proteinei TRF2 conduce la o stopare imediat i ireversibil a proliferaiei. La
modificri morfologice n celulele, caracteristice mbtrnirii i induciei markerilor celulari ai
procesului, cromozomii formeaz structuri inelare, neperznd segmentele telomerice. n
telomerele nemodificate dispar segmentele unicatenare, far modificri n activitatea telomerazei.
Se confirm c nu telomera apar cromozomul de nucleaze, de adiie i niperi n mitoz -
asta-i funcia proteinei TRF2.
Creterea concentraiei de TRF2 n cultura de fibroblati conduce la majorarea vitezei dc
micorare a telomerelor n procesul de mbtrnire. Efectul nu duce la o mbtrnire
precoce celulele continu s prolifereze. Dac numrul limit la o mbtrnireede
6-7 mii perechi nucleotide la celule in control, apoi la cele care expreseaz mai mult TRF2
aceast limit e de 2-2,7 mii de perechi mai mic, ce permite ca ele b se divizeze de i 5 ori
mai mult pn la mbtrnire. De altfel, sunt prentmpinate alipirea i ruperea cromozomilor.
Se consider c nu lungimea telomerei e cardinal pentru inducerea mbtrnirii celulare, ci
starea lor, determinat de funcia protectoare a proteinei TRF2.
Experimental s-a demonstrat c inhibiia TRF2 nu numai c conduce la modificri
fenotipice caracteristice mbtrnirii, dar i provoac modificri genetice: alipirea cromozomi lor,
activarea p53, creterea concentraiei p l 6, micorarea nivelului ciclinei A i
hipofosforilarea pRb. Inactivarea simultan a p53 i pRb prentmpin mbtrnirea
celulelor experimentale, determinat de inhibiia TRF2. Proteina p53 are o afinitate major
faa de segmentul unicatenar al telomerei, ctre locul de fixare a t-buclei i favorizeaz
formarea ei n prezena TRF2.
Reglatorii naturali ai proteinelor TRF umane.
Efectul TRF2 asupra telomerei e stabilit cert n condiii de experiment, dar modulatorii
proteinei nu sunt nc identificai. A fost identificat proteina hRapl, care are influen,
fiind fixat pe telomere, dar ea poate interaciona i cu alte poriuni ale cromozomului.
Proteina TRF1 uor modific lungimea telomerei, fiind reglat in vivo diferit.
Proteina TRF 1 poate fi poli-ADP-ribozilat, cu disocierea consecutiv de la DNA. O
aa modificaie spaial e catalizat de tankiraz (poli-ADP-ribozil-polimeraz ankirat
de telomer). Proteina (K.F.2.4.2.30) e partener al TRF 1, care ptrunde n nucleu i n forma
sa neactiv e fixat de proteina telomeric. Dup activare, tankiraz poli-ADP ribozileaz pe
sine, ct i pe TRF 1, ce conduce la disocierea complexului nucleoprotidic i eliberarea
telomerelor. Ultimele sunt disponibile pentru aciunea telomerazelor i a altor enzime.
Tankiraz se consider reglator pozitiv al telomerazei.
La om i la vertebrate sunt depistate dou izoforme ale tankirazei TNKS (1) i
TNKL (2) cu masa molecular, respectiv, de 142 i 127 kDa. Tankiraz posed un
domen enzimatic, alt domen fixat (ankorat) compus din 24 repetri i al treilea domen-
SAM; ultimele particip n interaciuni proteo-proteice. Tankiraz 1, spre deosebire de
tankiraz 2, posed i un domen suplimentar - N-terminal domen, care deocamdat nu-
i asociat cu nici o funcie. Nu are localizaie nuclear i majoritatea enzimei se gsete n
citozol, unde este supus fosforilrii i activrii de MAP-kinaza. Nu e clar dac enzim activ
este transferat n nucleu sau pulul nuclear al tankirazei este activat de M AP-kinaz
(proteinkinaz, activat de mutageni).
Ultima poate fi translocat n nucleu. MAP-kinaza este reglat de insulin i factorii de
cretere i se consider c graie tankirazei organismul menine telomercle celulelor sub controlul
hormonal.
A fost depistat o alt protein telomeric, ce interacioneaz cu TRF1 numit TINF2
(TRF-1-interacting nuclear factor 2) cu o mas molecular aproximativ de 40 kDa.
Structural e asemntoare cu proteinele TRF, avnd la captul C-tenninal un domen fixator
de DNA de tipul Myb. Acest factor favorizeaz scurtarea telomerei i negativ regleaz
activitatea telomerazei, intermediind efectul TRF1. Mecanismul de aciune aTRFl const
nu numai n superspiralizarea DNA i favorizarea formrii buclei t. Graie interaciunii cu
diferite i multiple proteine TRF 1, le poate conccntra n apropierea telomerelor. Ea poate
fixa proteina PinXI-inhibitor, puternic al telomerazei, care acioneaz direct asupra enzimei,
spre deosebire de ali modulatori, care vizeaz disponibilitatea telomerelor.
Recent, s-a depistat o alta protein telomeric - Potl, ce se fixeaz de segmentul
unicatenar. Posibil, funcia proteinei respective const n protejarea acestui fragment de efectul
nucleazelor, agenilor chimici, radiaiei. Pot 1 (Protection O f Telomeres)un polipeptid
de 71 kDa, interacioneaz cu TRF1. Acionnd asupra procesului de fixare a Potl,
proteina TRF 1, concentraia creia este proporional cu lungimea telomerei, transmite
la capetele unicatenare informaia despre mrimea total a DNA telomerice. Toate
proteinele cunoscute i necunoscute ale complexului nucleoprotidic fonneaz telozoma.
E de constatat c numai unele proteine telomerice au omologie la alte eucariote. n
organismele model nu au fost depistate toate proteinele cunoscute n genomul uman. Evoluia
a parcurs alt cale, dar studiind, se poate obine informaie utilizant.
Telomera si sistemul reparativ
Radiaia ionizant i ali factori nocivi provoac rupturi n DNA bicatenar - DSB (Double
Strand Break). De altfel, transformrile n DSB sunt considerate ca metod de reiniiere
a furcilor replicative lezate, ce prentmpin dublarea normal a cromozomilor n faza S.
Deosebim 2 ci concurente de reparaie a DSB: 1) mperecherea cromozomilor omologi,
recombinarea i resinteza catenelor scurte; 2) legarea neomologic a capetelor DNA (NHEJ
- Non-I Iomologous End Joining). Se consider c prima cale predomin n fazele S i G,
ale ciclului celular i la celulele ce se nmulesc activ (drojdiile), a douan fazele Go, si G ,
i la cclulele ce se divizeaz rar (fig.2.23).
C apetele telom erei,
dac nu sunt protejate de t- M - M itoza (diviziunea nuclear) i
bucl, sunt identice cu DSB citokineza (diviziunea celular)
Go - C e l u l e l e
i trebuie s fie reparate G , - Sinteza DNA stopat. difereniate definitiv,
Continu sinteza RNA i
fie p rin fo rm area a proteinelor eite din ciclu l
c e lu la r p e tim p
cromozomilor inelari sau a nedefinit
cromozomilor cu dou sau P - Punctul de reintrare -
celula rentoars din Go
mai multe centromcrc, dup ntr n faz G1
mecanismul NHEJ. Ultima se
G1 - Sinteza RNA i a
observ n celulclc cu proteinelor. Sinteza DNA
telomere scurte la limit. e stopat

Indiferent de mecanismele S - D ublarea DIVA n PR - P unctul de restricie


celul cu sinteza RNA i a celula ce trece acest punct i se
reparative att DSB, ct i permite s treac n faza S
proteinelor
telom erele neprotejate
activeaz proteinkinaza F igura 2.23. Ciclul celular la eucariote (n ore)
ATM, ce succede n activarea
p53 i la blocarea proliferaiei, induciei mecanismelor celulare ale mbtrnirii i apoptoza.
Cnd ns se fonneaz bucla-t, segmentul unicatenar telomeric se mperecheaz cu trunchiul,
tind recombinaia i n anumite condiii stimuleaz reconstrucia catenei DNA.
n componcna complexului nucleoprotcidic la om. ca i la drojdii, e prezent permanent
proteina Ku - o component a cii NHEJ. E compus din dou subuniti diferite cu
masa molecular de 69 i 83 kDa (Ku 70 i Ku 80). Depistat n anii 80 ca autoantigen,
la care, la unii bolnavi cu maladii autoimunc, se formeaz anticorpi utilizai n donare.
Proteina leag rupturile n DNA nu numai n zona telomeric, dar i n orice alt consecuti vitate
cu fisuri uni- sau bicatenare i posibil prentmpin degradarea acizilor nucleici. Isuficiena
proteinei Ku duce la generarea unor compui cu erori (deleia) multiple.
La mamifere, fixarea Ku pe DNA duce la formarea unei proteinkinaze-DNA
dependente (DNA-PK) compus din dou subuniti Ku i a treia subunitate catalitic (DNA-
PKCS), activat graie fixrii celor dou. Participarea Ku n funcionarea telomerelor se studiaz
intens i unele date confirm c durata vieii i simptomele precoce ale mbtrnirii la
oricei sunt rezultatul inactivaiei genelor, ce codific subunitile Ku. Date analogice s-au
nregistrat i pe cultura celulelor de om. Rolul diferii n procesele de reparaie a DSB i n
protejarea telomerei e explicabil, graie faptului c ambele sunt contrare dup sens. Se
consider c Ku are numai funcie de protejare i evaluarea proceselor e n dependen de
proteine specifice fiecrui proces: fie TRF sau sistemele de reparaie i recombinaie. Dup
fixarea proteine Ku i activrii DNA-PK, n reparaie particip multiple proteine. Printre
ele i complexul Rad 50/Mre 11/Nbsl. Aceste proteine sunt implicate att n recombinaii
omologe ct i n meninerea integritii telomerei.
Proteina Rad 50 (Radiation mutant 50) are omologie i la om, dup form seamn cu
miozina. Are aceeai mas molecular 153 kDa. Polipeptidul arc dou domenii ce
leag DNA, aranjate la capetele N- i C-terminale, care posed activitate enzimatic
ATP-azic. Identitatea aminoacidic e de 50%. Domeniile enzimatice sunt legate cu un
segment superspiralizat, aranjat sub un unghi nZ-motiv n centrul moleculei. Domeniul-Zn de
legtur servete pentru dimerizaia Rad 50, ce va menine simultan moleculele de DNA,
aranjate la o distan de 1200.
Mre 11 (Meiotic recombination 11) este o nucleaz, care-i prezent att n drojdii, ct i n
lumea animala i om. hi reparaie, proteina degradeaz buclele i alte structuri incorecte n
molecula de DNA. Complexul Rad 50/Mre 11 posed activitate att endo-, ct i cxonucleazic
n dirccie 3' 5'. Funciile acestci proteine nu sunt identice n reparaie i n meninerea
structurii telomcricc.
Al treilea component ai complexului n-are omologie la drojdii i la om. La om este o
protein - nibrina (Nbs 1 - Nijmegen breakage syndrome), mutaia creia la nivelul celular
provoac modificri asemntoare cu mutaia ATM (Ataxia-Telangiectasia Mutated), dar cu
o clinic diferit. Ambele molecule (Nbs 1 i ATM) iau parte la transmiterea semnalului n
aceeai cale. Nbs 1 moduleaz activitatea enzimatic a Rad 50 i Mre 11 i-i transmite
complexului capacitatea de a relaxa dublul helix de DNA n prezena ATP.
Informaia despre mecanismele n funcionarea complexelor proteice este insuficient, dar
se poate, la moment, clasifica proteinele respective n unntoarele gmpe:
a) proteinele ce menin structura spaial a telomerei (TRF);
b) proteine ce determin i cauzeaz formarea hcterocromatinei telomerice, moduleaz
activitatea genelor, incluzindu-le n hetero-cromatin (Rap, Rif, Sir, acetilazele histonice,
metiltransferazele);
c) proteine ce realizeaz repararea telomerelor distinse, posibil negativ regleaz
mrimea lor nucleazele (Rad 50/Mre 11/Nbs 1 i Ku);
d) proteinele-semnale ce transmit informaia despre starea telomerelor altor structuri
(subcelulare) i iniiaz mbtrnirea celular i apoptoza (PK ATM, p53, pRb), i altele ce
regleaz proliferarea i moartea celulelor.
mbtrnirea molecular i dependent de ea, regenerarea esuturilor sunt probleme,
studiul crora continu intens. Sunt deocamdat cunoscute dou tipuri de mbtrnire rapid
patologic, mecanismele moleculare ale crora fiind studiate. Sindromul Verner sau
progeria btrnilor determinat de mutaia n gena helicazei (112), ce ngreueaz replicarea
DNA i proliferarea celulelor. Bolnavii decedeaz de blrnee la vrsta dc 35-50 ani. Sindromul
Hatcimon-Gilford sau progeria dependent de mutaia laminei A (113), ce ngreueaz
proliferarea, ca consecina a disfunciei membranei celulare, nbtrnirea apare pn la 20
de ani. In ambele cazuri anomaliile genetice duc la inhibiia patologic a rennoirii esuturilor,
care nu este consecina scurtrii telomerelor. Imbtrnirea natural e cauzat de istovirea
limitei I layflick - mrimea telomerei se apropie de limita 1-2 mii perechi nucleotide, necesare
pentru formarea t-buclei. E posibil c mecanismul telomeric al mbtrnirii e cauza
schimbului natural al generaiilor la om.
Sunt depistate proteine noi telomerice (studiu bazat pe omologie cu cele cunoscute);
s-au stabilit i genele ce le codific. Spectrul funcional al acestor proteine e foarte variat:
regleaz nmulirea celular, transcripia genelor, semnalizarea celular, transmembranar,
modificaia RNA-mesager, transportul vczicular, fonnarea complexelor multiproteice.

D uplicrii numeroase ARS Abflp Ttflp


internale fat de X

Asocierea temporal a telomerei


-orin factori SlK 2-4. RAP. etc. /

Recombinare tntra-
i extra grupal
terminal detection

Recombinare teloraeric
X-internal este inhibat

Succesiuni unicale
Centru! X
Factorii silencing

Nuclcu
Factorii de ancorare
RAP1, alii

F igura 2.23a. Schema arhitecturii nucleului


Un numr limitat de organisme nu posed activitate telomerazic i menin lungimea
telomerei prin alte mecanisme: posibil, prin recombinarea sau transpoziia unor fragmente
mici - durata i viteza transpoziiei sunt strict controlate de celul. Se presupune
participarea telomerei, n afar de replicarea i formarea Chep, la organizarea nucleului
i a cromozomilor, segregaia meiotic i mitotic. Se atest c poziia telomerelor n
nucleu e perfect specializat i depinde de interaciunea lor n membrana nucleului; au
tendina de a forma claustru de partea nucleului, contrar cromocentrului (fig. 2.23a).
Telomerele intcracioneaz (claustre), formnd complexe poliproteice direct sau
indirectprintr-un component al membranei nucleare. O astfel de interaciune, posibil
i cu matricea nuclear, are atribuie la represia genelor.
Genele aranjate n vecintate sau la captul telomerei sunt expuse represiei
transcripionale nestabile efect telomeric de poziie. Ultimul e strns legat de procesul
excluderii genelor (silencers - inhibiie) proces transcripional ce determin tipul de
conjugare.
Silencers const n formarea unei structuri cromatinice speciale de represie, cu
participarea unor proteine specifice.
R eglarea telom erazei n celulele som atice normale. La anumite etape ale
dezvoltrii, i unele celule specializate somatice posed activitate telomerazic, care se
regleaz foarte fin i precis. Ca reglatori pot servi unii factori de cretere.
Concluzii:
a) Nu s-a depistat activitatea telomerazei n celulele somatice normale difereniate
terminal. De exemplu: fibroblatii, fie c se gsesc n stare normal sau proliferativ.
Deci, determinanta primar a activitii telomerazice e originea celulei de anumit tip.
Activitatea telomerazei integral e dependent exclusiv de capacitatea celulelor la
autorestabilire.
b) Al doilea factor ce influeneaz asupra activitii telomerazice e activitatea mitotic
celular. Activitatea telomerazei se evideniaz n celulele mai primitive, bazale i
proliferative.
c) Activitatea telomerazei se regleaz n procesul ciclului celular. Un factor decisiv n
reglarea activitii telomerazice ar trebui s fie nivelul expresiei genelor proteinelor ce
fonneaz centrelc catalitice ale telomerazei. Reglarea fin e dependent i de reglarea
sintezei proteinelor asociate cu telomeraza i genele RNA matriceale.
Activatorii i inhibitorii telomerazei. Reglarea sintezei DNA de diferite preparate
vezi fig.2.32.
Dup cc a fost determinat legtura ntre activitatea telomerazic i oncogenez,
senilitate, se exploreaz dou direcii:
a) crearea DNA antisens fa de telo-RNA i
b) studierea inhibitorilor revers transcriptazelor.
Ca inhibitori servesc oligonucleotidele modificate, complementare regiunii-matrice a
RNA-telo. Ele sunt rezistente la aciunea proteinelor i a nucleazelor. Atare nucleotide
se fixeaza n mod specific de matricea RNA-telo a omului, efectiv inhibnd activitatea
telomerazic in vitro. In vivo apare problema transportului inhibitorilor prin membrana
celular i micarea dirijat n nucleul cclular.
3 '-A z id o -2 \3 '- dideoxitimidina (AZTi 2 ,3 - didioxiinozinaD D I)

Ca inhibitori au fost testai i inhibitorii revers transcriptazelorazidotimidina (AZT),


dideoxiguanozina (DDG), 2\-dideoxiinozina (DDI). Efect semnificativ asupra
celulelor imortalizate de om nu s-a nregistrat. Dup micorarea iniial a lungimii telomerei,
dimensiunea se stabilizeaz i efect asupra proliferaiei, morfologiei celulare nu se mai
atest. Studiul, eventual, va continua.
TRANSCRIEREA (BIOSINTEZA RNA)
Spre deosebire de replicare, care antreneaz simultan
ntregul cromozom, transcrierea vizeaz numai anumite poriuni
de DNA, i anume acelea care codific proteinele necesare -c G -
celulei la momentul dat. Structura RNA este concludent, - u A
dictat de structura matricei, ln vivo, transcrierea este asi - u A
metric, adic ntr-o anumit regiune se copiaz o singur A T
catena de DNA, desemnat drept caten sens, spre G -
deosebire de cea netranscris caten antisens. - G -
n 1961, Sol Spiegelman elaboreaz metoda hibridiz IG C
rii, ce const n ncalzirea dublului helix DNA; depind L a T
temratura de topire, el trece ntr-o form unicatenar. La G c-
rcirea lent a soluiei, catenelereasociaz i formeaz dublul
3
helix cu o structur nativ. Dublul helix se formeaz numai n Catena Catena
cazul n care catenele de DNA provin din organismele unei RNA DNA
specii sau ale speciei nrudite. Dac secvena bazelor din
Figura 2.24. Secvenele
mRNA e complementar, apoi n combinarea catenelor de compl ement ar e
DNA i RNA trebuie s formeze fragmente hibrid DNA- formeaz hibridul RNA-
DNA
RNA (fig. 2.24).
Experimentele au demonstrat c succesiunea bazelor azotate n mRNA sunt
complementare succesiunii DNA matrice. n 1960 a fost descoperit enziina ce sinte
tizeaz RNA corespunztor succesiunii din DNA matrice.
Pentru sinteza mRNA sunt necesarc:
1. Matricea DNA de preferin dublu helix;
2. Precursori activai cele 4 ribonucleotide ATP, GTP, CTP, UTP;
3. Ionii de M g^ sau Mn4'*';
4. Enzim RNAp, ca i DNAp, necesit zincul pentru funcionare;
5. Sinteza are loc n aceeai direcie 5' 3'. E analog i mecanismul de elongaie
a lanului nucleotidic favorizant atacului nucleofil al fosfatului intem din unntorul ribonu-
clcotidtnfosfat de grupa '-OH ai catenei crescnde. Fora motrice a procesului e hidroliza
pirofosfatului respectiv.
Particularitile procesului de sintez RNA:
a) RNAp nu neccsit prezena primerului; I
b) DNA matricea se pstreaz intact; fl'v
c) RNAp nu posed proprieti nucleazice.
La eucariote deosebim trei RNAp: RNAp-I ce asigur
sinteza rRNA 28 i 18S; RNAp-II-mRNA i acele RNA care Figura 2.25. Structura
RNA polimerazei !a E.coli
pot fi marcate la capete; RN Ap-III asigur sinteza tP.NA i
5S rRNA. precum i RNA mult mai mici. RNA-polimeraza folosete infonnaia nscris
n DNA matrice, acest fapt este argumentat experimental (succesiunea bazelor n mRNA
e ntocmai copia complementar a succesiunii lor n DNA matriceal).
RNAp este o enzim compus din cteva subuniti (a ,a , !), adic e o
holoenzim (fig.2.25). Sigma subunitatea alege segmentul de iniiere. Enzim fr sigm
poart denumirea decore ferment (ferment minim): a subunitile sunt centrele
catalitice, ' se leag de DNA, iar subunitatea fixeaz substratul
ribonucleotidtrifosfaii. Sinteza decurge n mod similar, implicnd unntoarele etape:
I. Iniierea sintezei ncepe n anumite fragmente de DNA, cu o secven specific
ce poart denumirea de promotor. n promotor particip aproximativ 40 de nucleotide
i deosebim dou locusuri unul de recunoatere, depistat cu ajutorul subunitii sigma,
i o alt secvenlocusul de legare lax a RNA-polimerazei. Sigma amplific afinitatea
enzimei pentru acest locus de IO4ori n raport cu alte locusuri de pe DNA.
1.0 importan deosebit i se atribuie locusului de recunoatere (7 nucleotide) situat
la o distan de 25 nucleotide de locusul de legare i circa 10 nucleotide de punctul de
iniiere (+1). Punctul de start al transcrierii va dicta captul 5' al transcriptului primar
RNA. Promotorii sunt situai n amonte i notai cu minus (convenional). Secvenele n
aval fa de punctul de start sunt notate cu plus.Se considcr c secvena Pribnow la
procariote sau Hogness la eucariotc e responsabil de exactitatea iniierii (fig. 2.26).
Punctul de iniiere
A. Prom otorul procariot -15 bp 9-18 bp i ? i\.

+ 1 T )TR
S ecvene Pribnow ( 5----------- *-
5 Transcript RN A

B. Prom otorul eucariot H o g n ess


Punctul start
(R N A p II) 40-200 bp _________ _ -25-35 bp
1
f f io f i'o n f c r *
G C casete casete TATA casete
54ilJTR,
Transcript RN A

P unctul start
C. Prom otorul eucariot
(5s tRNA )
51--------- ---------------------------------------- Transcript
Figura 2.26. Secvenele tipice n promotor la pro- fi eucariote

2. Sigma activeaz identificarea secvenelor de RNA-polimeraz.


3. De asemenea ia parte la desfacerea dublului helix al DNA pentru ca aceasta s
serveasc drept matrice i conlucreaz la fonnarea primei legturi fosfodiesterice n noua
caten a RNA.
Complexul de iniiere e format, sigma-subunitate e disociat de la holoferment i
cor fermen tul continu procesul de elongare. Sigma se ataeaz la alt corferment i ia
parte la iniierea unui alt ciclu de transcriere (fig. 2.27).
II. Elongarea decurge dup acelai mecanism descris mai sus. O molecul de RNAp
sintetizeaz tot transcriptul fenomenul e procesiv i activeaz cu o vitez de 50
nucleotide pe secund (fig. 2.28). RNAp nu controleaz catcna sintetizat, reduendu-
se precizia. Se comite o greeal la IO40
nucleotide sau de 105 mai multe dect n
DNA.
RNAp III. Finalizarea transcrierii: se reglea
z foarte fin, la nivelul unor secvene nu-
cleotidice specifice de pe catena DNA ce
conin un numr mare de G, C, T, recu
noscute de RNAp. Un rol important l joa
c proteina p (rho), care se asociaz cu
enzim i se mic cu ea. La identificarea
semnaleleor de terminare coboar de
pe matrice, ncetnd aciunea enzimei i
producnd transcriptul cu folosirea ener-
giei ATP. T ran scrip tu l o binut e
autocomplementar i poate forma pe
Q i Enzim cor
rechi de baze, ceea ce genereaz struc
turi simetrice, favoriznd expulzarea lui din
proces (fig. 2.29).
F ig u r a 2 .2 7 . Iniierea transcrierii i fo rm a rea Dac catena se extinde n direcia
complexului de iniiere. Reciclarea factorului sigma 5' 3', este evident c enzim RNA-
polimeraza se mic pe DNA n direcia
3' 5 '(antiparalel).

(b) Dirccia transcripiei

Figura 2.28. Transcripia la E.coli. a) RNAp fi procesele ce sunt cauzate de activitatea ei, b) direcia
elongrii
Dup procesul de transcriere con
tinu fonnarea moleculelor funcional \R N A p \
active de RNA aa-num itu l " 3'
J\ ' aten a
procesing, care const n unntoarele: CTACCCGCTAAGCCCTATCTTAOCOQA/ , _.
IIIHIIUIIIlUinilllllilIllilll tem p lat
1. Cap-area. La captul 5' este ----------G
V
A T G G G e G A T T C G G O A T A G A A C C C C r A A
, -
A A A T -

adiionat guanozina metilat. n c ,


51/ C"> o-o
o-
proces sunt utilizate ca substrat GTP, O (5
0 0
iar donator de grupe C H 3 este O
c -<
o
adenozilmetionina. Sunt implicate >-D
>-=
0*y
enzimele: fosfohidrolaza, guanil
transferaza i metil transferazele. V
F igura 2.29. Terminarea independent de Rho
2.Poliadenilarea. La 3'o secven
mare de A (100-200). Acest fe
nomen are loc pn la terminarea sintezei ntregii molecule (e catalizat de poli-A-
polimeraz). Astfel de coad e necesar pentru exportul moleculelor de RNA din
nucleu.
3. Se modific bazele i resturile glucidice 2'-OH este metilat (1:100) de S+-
adenozilmetionin, la procariote6-dimetil-adenina;se atest n tRNA, dealtfel
i pseudouridilatul, ribotimidilatul.
4. Modificarea intensiv pe care o sufer transcriptul primar const n scurtarea lui.
S-a constatat c mRNA nuclear este mult mai lung dect acelai mRNA ajuns n
citoplasm. S-a ajuns la concluzia c RNAp realizeaz o reproducere primar identic
cu ntreaga gen, apoi intronii sunt excizai i exonii se leag ntre ei, fonnnd mRNA
matur, traductibil (fig.2.30).
Transcripia

DNA V

Kxort Intron
..C a p

Completarea
transcriptului primari
Transcriptul primar Segvene necodificatc

Clivarea, poliadenilarca
i splaisingul

F igu ra 2.30. Formarea transcriptului primar i maturizarea RNAm la eucariote

- 133-
Secvenele intronilor au dimensiuni de 10-100 ori mai mari dect exonii.
Cum se manifest excizia intronilor? Aa-numitul splicing are loc n nucleul celulei.
a) unele enzime specifice identific secvenele de baze la jonciunea intron-exon
(excizia pe introni este o excizie incorect i conduce la generarea unui RNA inactiv ce
conine un intron rezidual. n unele -talasemii are loc descreterea sintezei a lanurilor
-globin);
b) n excizia intronilor un rol important i revine unei categorii de RNA nuclear cu
mas molecular mic, desemnat RNA U (snRNAs), care are o secven a bazelor
complementar cu secvenele de la capetele fiecrui intron. Intronii sunt scoi de
RNA nuclear i capetele exonilor corect juxtapuse, apoi sunt sudate ntr-un aparat enzi-
matic specializat (fig. 2.31);
Intron

Figura 2.31. Sudarea exonilor i excizia intronilor de snRNAs

c) Thomas Cech a stabilit c pentru excizia intronilor i sudarea exonilor n epru-


bet e nevoie numai de RNA, ioni Mg2-*4- i guanozin. Molecula n spaiu ocup atare
poziie, nct capetele secvenei de introni se localizeaz foarte aproape. Excizia i
sudarea decurs n regim autocatalitic, unde singura RNAsegmentul intron - denot
comportamentul enzimei. Guanozina iniiaz procesul, iar Mg2++stabilizeaz structura de
RNA - autosplicing. Astfel de RNA a fost denumit ribozim. Ribozimul de 10ori mai
repede scindeaz legtura fosfodicsteric dect prin hidroliza nefermentativ.
Prezena RNA cataliz e demonstrat n multe studii. S-a depistat, bunoar, o enzim
(Escherichia coli .a.) RNA-aza P cu o funcie specific la maturizarea tRNA taie
din molecula precursoare un fragment la un capt. Enzim e compus din compartiment
proteic i nucleotidic. n unele condiii, enzim este efectiv i fr componenta proteic
i nu contrar, cum era de ateptat. Unele compartimente ale enzimei pot scinda nu
RNA, ci polizaharideceva nou n enzimologie. Demult s-a observat c extragerea
moleculelor mari intacte de RNA e dificil. i numai dup descoperirea ribozimelor,
s-a clarificat c RNA-aza activ este atributul constant al moleculelor de RNA.
Ribozimul scindeaz molecula de RNA conform combinaiei = CUCU =, ceea ce se
poate aplica n practic pentru scindarea RNA virotic i a celei de SIDA.
Transcripia i translaia au loc n diferite compartimente ale celulei. Replicarea,
transcripia pot fi modulate prin intermediul diferitelor substane. Efectul preparatelor
medicinale sunt ilustrate n figura 2.32.

Cronomicina Proflavina
Echinimicina Etidium
Hedamicina Daunomicina
Netropsina Nogalamicina Mitomicina
Distamicina Cloroquina N-gaze
Fleomicina Miracil D Acid nalidixic
Kancanomicina Actino- / Streptonigrina Alcool
Luteoskirina micjna f Bleomicina fenetil 4 /
Antramicina
rS

/
Rifampicin^ Bazeanaloage Azaserina
Streptovaricina Nucleotide Metotrexat
Antibiotice
Figura 2.32. Locul aciunii unor medicamente
1. O fixare noncovalent cu DNA, ce mpiedic replicarea.
2. Se leag rigid n duplex, joncionnd cu guanina i inhibnd activitatea DNA ca matrice pentru RNA
olimeraz.a (inhib transcripia). Acioneaz similar: doxorubicina (adriamicina), cronomicina A i
I distamicina.
3. Se fixeaz de DNA, fr a modifica structura helixului.
4.Medicamente ce rup punile n DNA.
\ 5. Preparate ceformeaz legturi covalente ntre spiralele de DNA.
14 Substane ce Jixndu-se n bifurcaie mpiedic replicarea.
i 7. Inhib sigma i beta subuniti de RNAp, ngreuind iniierea procesului de transcripie.

I S. Inhib RNA-polimeraza I I (o.-amanitina etc.); preparatele ce conin platin (cisplatina i carboplatina)


induc formarea legturilor transversale n DNA.

Structura subnucleozomic a cromatinei se menine n procesele de transcriere i


I replicare.Dret matrice servete complexul DNA histonic, dar nu DNA liber. RNA
sintetizat se mpacheteaz n complexe ribonucleoproteidice.
DNA netranscriptibil (linker) ia parte la procesul de reglare a transcrierii, servind
^pt promotor pentru RNAp II.
Elementele mai importante sunt blocurile TATA i CAAT situate la o distan de 25-
lOOpn dc la punctul de iniiere. Este dcscris prezena unor elemente reglatoare
localizate n diferite regiuni ale DNA, numite enhancers i silancers.
Se presupune o modalitate anume n mpachetarea RNA. Dup cum mpachetarea
DNA n cromatin e menit s determine funcionarea ei normal n celul, procesul
(insuficient studiat) condensrii RNA cu proteinele nucleicee necesar pentru decurgerea
perfect a procesingului primar RNA transcript cu transportul lorn citozol. Se tie
c numai 5% din masa total a RNA transcript prsete nucleul celular. Semnalele
specifice care servesc ca permis pentru prsirea nucleului nu sunt identificate. E do
vedit faptul c astfel dc semnale apar n procesul de splicing al RNA. S-a argumentat c
dac n secvena nucleotidic nu sunt intronii, RNA transcript va rmne n nucleu.
Particularitile transcrierii la eucariote
Procesul de transcriere la eucariotc este foarte complex, dei n principiu dccurgc
dup acelai mecanism ca i la procariote.
a) Dac la procariote toate tipurile dc RNA sunt sintetizate de aceeai RNA-
polimeraz, la eucariote intervin mai multe tipuri, fiecare transcriind seturi diferite de
gene. De asemenea, dac la procariote RNA-polimeraza era format din 5 subuniti, la
eucariote acestea sunt constituite din 9-11 subuniti.
n sinteza RNA la eucariote intervin patru tipuri de polimeraze: trei expuse mai sus i
al patrulea tip - RNA-polimeraza mitocondrial ce sintetizeaz toate tipurile de RNA
mitocondrial.
RNA-polimeraza 11 i RNA-polimeraza III sintetizeaz i RNA nuclear dc mici
dimensiuni. Fiecare tip de RNA-polimeraz utilizeaz promotori diferii, acetea fiind
extrem de variai pentru RNA-polimeraza II care produce sinteza mRNA.
Dac considerm poziia dc start 1 (locul unde ncepe transcrierea genei structurale
RNA-polimeraza II), exist mai multe regiuni care condiioneaz aceast poziie:
- n poziia 35 se afl caseta Hogness care este recunoscut de RNA-polimeraza II i
prin urmare e responsabil de acurateea transcrierii;
- spre captul 5, la o distan mai mare de promotor se afl caseta CAAT, care se
pare c este responsabil de frecvena cu care se transcrie gena structural.
Elementele de control enhancers i silancers i exercit aciunea numai n urma
interaciunii cu nite proteine specificc numitefactori de transcriere, carc induc modificri
n molecula dc DNA, avnd ca rezultat modificarea vitezei de transcriere a genei.
b) La eucariote transcrierea se realizeaz pe DNA complexat n nucleozomi, far s
fie ncccsar desprinderea lui.
c) Frecvcna cu care sc transcrie o gen este foarte diferit i depinde de necesarul
de protein codificat de gena respectiv.
Pentru majoritatea genelor transcrierea se face rar, astfel net transcriptaza parcurge
ntreaga gen naine ca o alt transcriptaz s se lege. Pe alte gene ns transcrierea arc
loc cu frecven mare; este vorba de genele care codific sinteza unor proteine de care
organismul are nevoie n cantitate mare. n acest caz de gen se leag simultan mai multe
transcriptaze, alctuind o aa-numit unitate de transcriere.
d) S-au depistat mecanisme alternative ale procesingului n complexul transcripional
la eucariote (fig.2.32a).
Poli A secven gt Secvcn 3' Secven Poli A secven

A| Transcript primar
Transcript primar |

Cap Cap

Clivarea i Clivarea i Clivarea i poliadenilarea


poliadenilarea A, poliadenilarea A2 (),.

mRNA matur (a) mRNA matur (b)


F igu ra 2.32a. Mecanisme alternative ale procesingului la eucariote

e) RNA nou-sintetizat este mpachetat imediat sub forma unor complexe


ribonucleoproteice, prin asocierea cu proteinele specifice. Aceste complexe sunt similare
nucleozomului, avnd forme globulare.
f) Transcrierea DNA la eucariote, ca de altfel i la procariotc, poate fi oprit; aceasta
se realizeaz (fig.2.32):
- fie prin distorsionarea structurii DNA, astfel nct acesta nu mai poate servi ca matrice;
- fie prin inhibarea RNA-polimerazei.

Sinteza DNA pe m atricea de RNA


n viruii oncogeni s-a identificat o enzim care a completat conceptul exprimat
prin dogma central a geneticii moleculare, n care fluxul de informaie are sensul
DNA RNA proteina. Enzim e revers transcriptaza - i prezint o DNA
polimeraz RNA dependent. Ea posed proprietatea, ptrunznd n celula-gazd, de a
sintetiza un hibrid DNA-RNA, adic pe matricea de RNA a virusului genereaz o
caten de DNA. RNA viral este degradat cnzimatic, iar catena DNA se autoreplic,
dnd natere la dublul helix de DNA, ce conine informaia prezent n RNA viral. DNA
se insereaz n genomul-gazd, avnd capacitatea de a se exprima ca protein. Se
consider c fiecare subiect este purttorul unor gene oncogene neexprimate, fiind un
rezultat al ptrunderii anumitor retro virui n organism ntr-un moment al evoluiei. n
anumite condiii nefavorabile pentru organism, poate avea loc transcrierea, traducerea
i malignizarea celulei. Cu ajutorul acestei enzime se poate construi artificial pe orice
matrice de RNA un DNA complementar, adic se pot obine gene sintetice care, prin
tehnicile ingineriei genetice, produc mari cantiti de protein codificat.
Biosinteza RNA pe matrice de RNA
Materialul cromozomial al unor virui RNA este replicat n celula gazd sub aciunea
unei replicaze RNA polim eraza RNA dependent.
Ca rspuns la infecia viral, ele se sintetizeaz n celula-gazd, au o aciune
surprinztoare, folosind RNA virusului ce se replic. RNA sintetizat nu e complementar,
ci identic cu al virusuluiRNA viral (+).
Catena RNA (-) va servi ca matrice pentru sinteza numeroaselor catene comple
mentare (+) virale, care (RNA viral) vor funciona ca RNA matrice pentru sinteza
proteinelor virale (spre deosebire de RNA al retroviruilor).

+ + . + + + +

RNA RNA M oleculele fiice


viral duplex + omoloage
RNA viral

Francois Jacob Laques Monod Tomas Cech

Paul Zamccnik George Palade


CODUL GENETIC
Noiunea de gen s-a concretizat i am putea afirma c gena este un fragm ent al
DNA, transcris n molecula de mRNA ce codific un lan polipeptidic sau are o
semnificaie funcional particular (tRNA etc). Dup descoperirea din a. 1977 a
intermitenei genelor, noiunea nu s-a schimbat, ns unele fragmente ale DNA, datorit
splicingului alternativ al RNA primartranscript, pot asigura sinteza a mai mult de 2
mRNA i, n consecin, a mai mult de 2 proteine, fiecare cu funcia sa. Rmne admisi
bil ideea c o gen determin sinteza unui lan polipeptidic.
Informaia genetic referitor la biosinteza proteinelor se transmite cu ajutorul
codului genetic ce reprezint fonna de exprimare a relaiei dintre secvena de nucleotide
din DNA i succesiunea dc aminoacizi din lanul polipeptidic.Avnd 4 nucleotide i 20
de aminoacizi, este evident c un aminoacid este reprezentat de 3 nucleotidecodul
este triplet i poate oferi 64 de posibiliti pentru cei 20 de aminoacizi. i toate tripletele
sunt numite codoni. Ei (codonii) sunt identificai consecutiv de moleculele de tRNA,
care ndeplinesc rolul de adaptor n sinteza proteinelor (tab.2.1).

T abelul 2.1. C odul genetic

I II III
(5) A G (3)
UUU'i UCTP U A U'l yr U
Phe
/ ucc UACJ
> Ser
UUA'l UCA U A A 'lC o d o n UGA Cod.ter A
Leu
uugj UCG; UAG > te m i UGG Trp G
CU I P C A U \ U. CGU^ U
c u c > Leu
CUA
CCC
CCA
> Pro
CA J CGC
CGA
> Arg

A
cug J CCG; CAG i CGGJ G

Ue
AAU\ A CU)
Ser
U
AUC ACC A A C / A sn A G C/
> T hr
aua J A A A \ Lys AGA\ A
Arg
AUG M et \C< ,y aag/ AGGJ G
cum GCU^ GAU\ . GGU'' U
G GUC Val GCC
Ala
GAC J GGC
> Gly

GUA GCA GGA A
gugJ GCG-' gggJ G

Proprietile codului genetic


Este un triplet n care 61 codoni codific aminoacizii corespunztori, 3 codific
tenninaia sintezei proteice.
Codul este degeneratunui aminoacid poate s-i corespund mai muli codoni:
Arg, Leu, Ser, fiecare fiind codificat de cte 6 codoni, ns Met i Trp sunt specificai
de ctre un singur codon (tab.2.1 a). Codonii unui aminoacid sunt sinonime. Specifi
citatea codonului e determinat de primele dou litere. Degenerarea se refer la nivelul
nucleotidului 3 din codon. Primele dou baze sunt constante. F.Crick a conchis c
asocierea nucleotidelor 1 i 2 din codon cu nucleotidele 3 i 2 din anticodon este fix,
respectndu-se principiul complementaritii, n timp ce mpachetarea nucleotidelor 3 din
codon i, respectiv, 1 din anticodon este lax. Aceasta se datoreaz particularitii
nucleotidelor 1 din anticodon (5') de a se mperechea i cu alte nucleotide, n pofida
regulilor lui Watson i Crick.
Foarte des nucleotidul 1 din anticodon e inozina, care oscilcaz (este baz
ovielnic) i dispus s ncalce regulile (efectul Wobble).

OH OH

HO
OH
Inozitol
Inozina

Dac toate legturile vor fi de tip W-C, atunci orice aminoacid ar fi acceptat de
un singur codon, iar deblocarea din complexul de sintez s-ar complica, ceea ce ar
micora considerabil viteza procesului de sintez, Anume degenerarea codonului
favorizeaz eliberarea din complex a tRNA.
Degenerarea codului minimalizeaz efectele nocive ale T ab elu l 2.1a. D egenerarea co d u lu i
mutaiilor i permite componenei nucleotidice a DNA g en e tic
s varieze n diapazon larg, nemodificnd secvena
N um rul
aminoacidic n proteina codificat de acest DNA. A m inoacidul
de codoni
Codul nu are virgule sau alte semne de
punctuaie ce ar indica nceputul i sfritul fiecrui Ala 4
codon. Citirea mesajului genetic se face nentrerupt Arg 6
de la codonul start pn la cel final. Asn 2
Asp 2
C odul g e n e tic este u n iv ersa l to ate
Cys 2
vieuitoarele utilizeaz acelai mecanism de a asimila Gin 2
informaia (abaterea prezint codul genetic al Glu 2
mitocondriei). Gly 4
Codul genetic nu este ambiguu (acelai triplet His 2
Ilc 3
nu semnific 2 aminoacizi diferii), nu se suprapune Leu 6
(prezint excepie la virusuri). Lys 2
Codul genetic prezint o structur liniar (este Met 1
coliniar, adic exist o concordan liniar ntre gen Phe 2
Pro 4
i aminoacizii proteinei codificate).
Ser 6
De remarcat c tripletul AUG reprezint Thr 4
codonul de iniiere, iar cei trei UAG, UAA, UGA de Trp 1
terminare (nonsens). Exist unele deosebiri n secvena 2
nucleotidic la DNA mitocondrial. Val 4
Studiile mai recente au confirmat c proprietile chimice ale unor aminoacizi sunt
reflectate n structura codonului: toi codonii cu U (n poziia 2) codific aminoacizi
hidrofobi, iar cei ce au n poziia 2 adenina codific aminoacizii polari sau cu sarcin;
guanina, respectiv, aminoacizi polari sau nepolari, iar uracilul n poziia 1 prezint
codonii nonsens.
Dac n anticodon n direcia (5' 3') prima baz nucleotidice:
a) citozina sau adenina, el va citi un singur R ecunoaterea a unui codon:
codon; Anticodon (3 ') X-V-C (5') (3) X-Y-A (5')

b) uracilul sau guanina, el va citi 2 codoni; Codon (S ') V-X-G (3 ') (5 1 Y-X-U (3 )

c) inozina, respectiv, va citi 3 codoni. R ecunoaterea a doi codoni:


Anticodon (3 ') X Y U (5 ') O ') X Y G (5 ')
S-a demonstrat c codonii sinonimi
Codon (5 ') Y -X -S <3 ) (5') Y-X-S (3')
pentru aminoacid, dac se deosebesc
dup cel puin una din cele dou baze RAnticodon ecunoaterea a trei codoni:
(3') -V- 1(5')
(1-2), au nevoie de tRNA diferite: UUA
Codon (5 ) Y -X- ( 3 )
i CU A codific leucina, dar se atest de
tRNA diferite.
In 1977 s-a stabilit c genele au structur ntrerupt gena lanului al hemoglobi
nei (exonul) este ntrerupt de secvene netranscriptibile numite introni. Gena ovalbuminei
are 8 exoni i 7 introni (fig. 2.33). 50 introni are gena colagenului. Lungimea intronilor
variaz de la cteva nucleotidc pn la zcci de mii de perechi. O proprietate a intronilor
este localizarea conservativ n genele nrudite la acceai spccic sau n aceleai gene la
diferite specii. Dar secvena nucleotidic e puin conservativ. Practic, conservative sunt
primele 2 i ultimele 2 baze n introni (G T ... AG) n locusun de site ai splicingului.

G ena ovalbum inei h- 7,700 bp


1 2 3 4 5 6 7
DNA A f ET" I

Transcript
^ Transcripia (RN A p II) Extra RNA
primar RNA
1 2 3 4 5 6_________________ 7
0 E )
.jF f 7[ G
.
Cap ; !__ ; S p licin g u l, c liv area i
11 - . ~ L poliadenilarea
^ I Extra RNA
L 12 3 4 5 6
Intronii iff AAA(A)n
m RN A
1,872
nuclcotidc

Figu ra 2.33. Structura genei ovalbuminei i modificrileposttranscripionale ale RNA primar transcript cu
formarea unei mRNA mature (zonele haurate prezint intronii)

O proprietate dc expresie a genei este: localizarea exonilor n mRNA i n DNA n


aceeai secven. Intronii confirm caracterul evolutiv al materiei vii formate n urma
evoluiei genei corespunztoare. Fiecare exon corespunde unui domeniu, care apoi,
unindu-se, fonneaz proteine cu proprieti noi. Actualmente, e cert c fiecare domeniu
este codificat de gena sai intronii sunt o dovad concludent a structurii polidomenice
a proteinelor.
S-a subliniat tnai sus c excizia intronilor regleaz torentul de RNA din nucleu n
citozol i, n final, proteina ce va sintetiza celula.
MUTAIILE
Mecanismele de corecie i reparaie ale DNA sunt eficace, dar totui o parte din
leziuni i erori din DNA rmn intacte. Apar modificri n genomul organismului care se
menin i se transmit prin ereditate. Aceste evoluri constante n secvena de
nucleotide transmise ereditar poart numele de mutaii.
n viaa real a unui individ ele se manifest rar cu o probabilitate egal cam cu 10'5.
Mutaiile sunt schimbri intermitente i rare care constau n modificri ale informaiei
genetice i care devin apoi stabile n succesiunea generaiilor.

D ezam inarea p rin hidroliza spontan


(transform area citozinei n uracil)
Uracil
Citozina
O
\ /
N
Lanul DNA

Lanul DNA O
O

Lanul DNA

Lanul DNA Form a tautom eric


OH

Modificrilor pot fi supuse o pereche de baze (mutaii punctiforme) sau un grup de


baze pe una sau pe ambele catene ale unei molecule de DNA.
Mutaiile punctiforme decurg prin:
1. Substituie (misens mutaii), n care deosebim 2 tipuri:
a) tranziie o pereche de purin este nlocuit tot cu o purina sau o baz
pirimidinic, nlocuit tot cu una pirimidinic.
Acidul azotos produce mutaii prin tranziie, dezaminnd adenina (A=T) n hipoxanti-
n care se mperecheaz cu citozina (HX=C); tot acest acid modific guanina la xantin
i citozina la uracil, producnd mutaiile respective.
Apurinizarea prin hidroliza spontan
Lanul DNA
(eliminarea guaninei)
0
O 1
0= p- o - h ,c o
1L0
w
N I
Lanul DNA NH o-
H J\
0
1 H Lanul DNA
o = p- o H,C Guanina
t
o-

Lanul DNA NH,


Guanina
Tranziie provoac i astfel de ageni mutogeni ca 5-brom-uracil, 2-amino-purin,
modificnd legile complementaritii la replicare: 5-brom-uracil, analog al timinei, dar se
mperecheaz cu guanina i 2-amino-purina, analog al adeninei, dar se leag cu
citozina.
Watson i Crick au postulat perfect mecanismul tranziieiatomii de hidrogen din
cele 4 baze i schimb poziiase dispun n forme tautomere care, la rindul lor,
formeaz perechi cu alte baze ca: iminofonna A ce se mperecheaz cu citozina etc.
b) transversie o pereche de baze purinice este substituit cu una pirimidinic sau
viceversa.
2. Inserie. Acest mecanism const n introducerea unei perechi de baze suplimentare
n catena de DNA. Acridina, intercalndu-se n DNA, la replicare pe catena
complementar se mperecheaz cu o baz
suplimentar sau duce la deleia unei baze din
acel lan. Sar Sar
3. Deletia const n excluderea unei perechi L-Pro t.'-meVal L-Pro L-meVal
I 1
J /S o

de baze: posibil la hidroliz, modificri de pH, 1


D-Val D-Val JO
temperatur; unii ageni modific o baz n aa \
L-Thr
L
mod, nct ea nu mai poate fi complementar, /
i la replicare apare golul n ambele catene. C^-0
ft
4. Unele modificri n secvena nucleotidic T H"
pot forma codonul sinonim i succesiunea L .

aminoacizilor nu se va schimba (mutaii


benigne). A ctinom icina D
La afectarea segmentelor mari de gen apar
mutaii extinse. Agenii mutageni pot provoca
att mutaiile spontane, ct i mutaiile induse.
n dependen de consecinele modificrilor,
deosebim mutaie benign, neutr, nociv.
O grup deosebit prezint mutaiile nonsens, A crid in a
unde are loc nlocuirea unui codon cu altul
Dezami narea

N. Al
N"
FI'
//
V

Xantina
O
H
N1/
Nu se supune dezam inrii
N

Timina

nonsens, ce provoac ntreruperea lanului polipeptidic. S-a confirmat existena unor


mutaii supresoare bazate pe funcionarea unor tipuri de tRNA, care, dei poart
anticodonul corespunztor unui triplet nonsens, sunt ncrcai cu aminoacizi. Ca rezultat,
lanul polipeptidic nu se ntrerupe fiind introdus un nou aminoacid. Provocnd n cadrul
investigaiilor experimentale un proces mutaional, regenerm caracterul slbatic n locul
celui mutant. Atare mutaii sunt denumite mutaii inverse - reversii.
n ultimii ani s-au elucidat mutaiile la hotarul exon-intron, unde se inactiveaz site-
ul splicingului, ce nu scindeaz intronul de exon n locul cuvenit. Deseori funcia acestui
site o preia alt locus din secvena nuclcotidic i molecula de mRNA e rar modificat.
S-au depistat i mutaiile punctiforme n introni ce modific splicingul; aa mutaii
au loc la unele tipuri de talasemii, unde dispar mai mult semnalele de splicing
favoriznd sinteza a dou tipuri de mRNA normal i defect (respectiv, 10% mRNA
normal i 90% defect).
Cum se pot depista mutagenii cancerigeni? Examinnd efectul mutagen pe bacterii,
Bruce Ames a elaborat o metod simpl i sensibil pentru a depista mutagenii chimici,
n piulia Petri se aranjeaz un strat subire de agar-agar ce conine 109celule de tulpin
special de Salmonel (tulpin ce nu se dezvolt n lipsa histidinei, fiindc confer
mutaii n gena biosintezei acestui aminoacid). Mutagenii genereaz multe mutaii, iar o
parte din ele conduc la reversii i, ca rezultat, celulele ncep s sintetizeze i histidina.
Aceti revertani aprui se nmulesc n lipsa histidinei exogene i formeaz colonii
aparte. Dup incubaia ce dureaz dou zile la temperatura de 37C, se atest efectul
mutagen al substanelor chimice.
Studiile recente confmn c acumularea catastrofal a erorilor n moleculele de DNA
e cauza mbtrnirii organismului. La cele amintite mai sus se adaug i varianta cu
modificarea tabloului metilrii bazelor nucleice. Savanii de la Institutul de Gerontologie
al Institutului Naional al Cancerului SUA( 1987) au stabilit c la oarecii cu durata
vieii de 42 luni numrul nucleotidelor metilate din DNA la o celul se micoreaz cu
47 mii ntr-o lun. La o alt specie, cu o longevitate de 96 luni, timpul de pierdere e
de 23 mii pe lun adic de 2 ori mai mic. oarecii pier atunci cnd scderea metil-
citozinei ajunge pn la 2 milioane la celul.
S-au studiat celulele omului, constatndu-se c viteza pierderii e mai mic. Celulele
bronhiilor pierd lunar 1,3 mii, avnd acelai numr de baze metilate 13-10 milioane.
Dac admitem c legitatea stabilit la animale valabil i pentru oameni, atunci ci pot
tri circa 125 de ani.
De altfel, este remarcabil c n celulele cancerigene nivelul bazelor meti late se menine
permanent la nivelul standard. E posibil c ceasul metilic e veriga principal n lanul de
cauze i consecine ce determin mbtrnirea i moartea individului.

RECOM BINAREA GENETIC (INGINERIA GENETIC)


Unele modificri n gene i cromozomi reprezint un fenomen normal n viaa celulei -
un schimb biologic adecvat ntre gene sau grupri de gene din diferite focare cu
formarea unui cromozom metamorfozat capabil de replicare, transcriere i translare.
Procesul se numete recombinare genetic.
Recombinarea genetic decurge n toate organismele i, firete, e posibil numai n
cadrul aceleiai specii, constituind n final criteriul de definire a speciei. Pentru
eucariote e caracteristic recombinarea reciproc, unde cantitatea de material
genetic transformat este proporional. Ea presupune segregarea i sinaptizarea regiunilor
omoloage din cromozomi i schimbul reciproc de nucleotide realizai prin ruperea
moleculelor de DNA, translocarea segmentelor rezultante i reunirea lor. Recombinarea
e determinat de un aparat complicat enzimatic ce implic consum de energie enorm.
Modificrile pe care le sufer molecula de DNA reprezint mecanismul principal al
evoluiei i al polimorfismului, de rnd cu selecia natural.
Recombinarea genetic experimental presupune includerea n genomul unui organism
a unor gene ce nu figureaz n patrimoniul ereditar al acestuia. Se atest mai multe tipuri:
1. Transformaia DNA celulei donatoare se implic n genomul recipientului
(implantarea virusului n celula sntoas).
2. LizogenieDNA sc ncadreaz n cromozom, dar nu se manifest. Un fenomen
neordinar stimuleaz mecanismul de expresie a genei mute i n final se formeaz
particule ce vor distruge celula-mam (virusul herpesului).
3. Transducia transferul unei pri de informaie de la DNA (ataat covalent) n
DNA parental celulelor-fiice i replicarea lor n continuare.
4. Conjugaiaproces natural de unire a genelor la eucariote, cu o maxim precizic
far modificri conjugaie sexual.
Unele gene sau grupe de gene la pro- sau eucariote pot abandona poziia iniial,
ocupnd alt loc n genom. Atare elemente genetice flexibile se numesc transpozoni.
Capacitatea de inserie se datoreaz unor fragmente scurte la capetele transpozonului -
secvene inserionale numite IS-elemente. Procesul determinat de un sistem ce recunoate
secvenele i le sudeaz n loc nou.
Un tip neobinuit de recombinare genetic se observ n procesul fonnrii genelor, ce
detennin sinteza anticorpilor imunoglobulinelor produse de limfocite, ca rspuns la
ptrunderea n organism a antigenului. Fiecare antigen capabil s joncioneze cu
imunocitcle unui tip specific, provocnd creterca, mitoza celulelor respective, formnd
clona unical, adic un aliniament de limfocite identice, care vor elabora un tip de
imunoglobuline specifice i vor fixa antigenul care a condiionat nmulirea lor. n inter
aciunea antigen-anticorp se fonneaz complexul n care antigenul i pierde activismul.
E uimitor fptui c organismul nostru poate
sintetiza milioane de anticorpi drept rspuns
la orice macromolecul. Oare e posibil aa
ceva? Celulele noastre nu conin att DNA,
nct s codifice milioane de anticorpi,
nemaivorbindde activitatea individual a
organismului uman.
Rspunsul a fost cptat, studiind structura
anticorpilor i a genelor ce-i codific (fig.
2.34, 2.35). M olecula anticorpilor e
compus din 2 catene lungi (II)cucte446
aminoacizi fiecare i 2 catene scurte (L),
respectiv, cu cte 214 aminoacizi fiecare.
Catenele sunt unite prin legturi disulfidice;
legturile S-S sunt i intracatenare. Fiecare
'ooc: coo-
lan dispune de regiuni segmentare de
aminoacizi constante i o regiune varia
= dom eniul constant
v = dom eniul variabil bilV; -fragment e compus din 3 domenii
H. L = catene lungi, scurte Hi 1 domeniu L. V-regiunile au locusuri
.... 1 de o variabilitate extraordinar de mare, nu-
F igura 2.34. Structura igG mite hipervariabile. Fiecare lan conine cte
trei locusuri centre antigenofixatoare, compatibile cu antigenul. Fixarea e datorat
legturii de hidrogen, punilor saline, interaciunii hidrofobe, legturii Van der Waals.
Localizarea n anticorpi a regiunilor i V ne pennite s concluzionm c DNA
F igura 2.35. Structura domenic conformaional a moleculei de imunoglobulin

ce le codific e rezultatul sudrii a dou gene pentru i V - fragmente. S-a adeverit


experimental aceast ipotez. Ulterior, s-a stabilit c DNA ce codific fragmentele va
riabile att n H, ct i n L-catene sunt compuse din gene de diferite tipuri care-i
schimb poziia i pot forma diverse mbinri. n DNA - V - fragmentele au aproximativ
400 V gene, 12 D (Diversity), 4 J (de legtur) gene. Combinarea acestor gene face
posibil mai mult de 20000 de variante, care, la rndul lor, se modific n secvena
nucleotidic la adiionarea cu fragmentele de DNA ce codific regiunea C. n consecin,
pot fi formate milioane de gene diferite cu circa 1010centre antigenofixatoare responsa
bile de sinteza anticorpilor.
Combinaii noi de gene o recombinaie artificial pot ti create i n eprubet.
Un rol decisiv l-au jucat elaborrile enzimelor de restricie endonucleaze ce recu
nosc n molecula de DNA o secven anumit de baze. Enzimele cliveaz legtura
fosfodiesteric de pe ambele catene ntr-un loc special al secvenei recunoscute
secvenele cunoscute suntpalindroame. Evident, capetele rezultante pot fi nccoezive
sau coezive (conin nucleotide complementare).
Un alt ferment este terminal-transferaza
, o enzim care posed capacitatea de a ad- a g g
uga la capetele '- ale celor dou molecule , , . t. \ > 1
ce trebuie sudate cozi homopolimerice - A t g t g g a t t
Palindrom
plementare (poli G, poli C) (fig.2.36).
Enzim revers transciptaza permite
sinteza unui DNA recombinat pe mRNA, adugind poli T i dezoxiribonucleotidele
respective, apoi se nltur mRNA i cu ajutorul DNAp I reconstruim catena comple
mentar.
Genele recombinate se includ ntr-un vector potrivit (o molecul de DNA), care se
introduce ntr-o celul, unde se produce replicarea i exprimarea genotipic. Ca vector
se folosescplasmidele (DNA bicatenar din citozolul majoritii bacteriilor). Ele se
deplaseaz uor de la o celul la alta. Aceste molecule mici trec prin membrana celulei-
gazd i pot asimila cu uurin gene strine (2.36.a). Ele se replic autonom i rapid,
fapt ce pennite amplificarea genei incluse. Selecionarea lor prin screening ne permite
s identificm genele respective (fig. 2.36).
Figura 2.36. Ingineria genetic: donarea genelor

Clonarea genelor a rezolvat problema insulinei, interferonuhn i a multor alte


substane biologice activc ca hormonul somatotrop etc.
Interferonul reprezint o glicoprotein cu 160 aminoacizi; fiecare specie produce,
n unna infeciei virotice, cel puin 3 tipuri de
Eco R1
interferon n: l)leucocite; 2)T-limfocite; 3)
fibroblatii esutului conjunctiv.
Fixndu-sede membran, interferonul sti
muleaz sinteza enzimelor specifice, care-s
capabile s lezeze RNA - virale i s inactiveze
factorii de iniiere a sintezei proteice n
ribozomi. n 1980, n SIJA a fost identificat
i separat gena interferonului leucocitar al
omului, inclus apoi n E.coli pentru a o sinte
tiza n cantiti substaniale.
Se preconizeaz ca celulele modificate
prin metoda ingmeriei genetice s fie inocu
late i n organismul uman. Se procedeaz
la ncorporarea genelor funcionale n locul Figura 2.36a. Plasmida pRR322: conine 2 gene
celor defectate sau pierdute de organismul cu rezistena programat la tetraciclin (tet) i
ampicilina (bla)
um an, ca metod de tratam ent -
genoterapia.
Adaosul de material genetic este
cficient cnd defectul const n insufi
ciena sau lipsa com plet a unei
proteine. Nu se consider raional cnd
mutaia conduce la surplus de protei
ne sau sinteza unor substane nocive
precum are loc la anemia falciform.
Corecia unor atare tulburri necesit
nu numai ncadrarea unei gene func
ionale, dar i a unei gene capabile
s inactiveze gena mutant. Savanii
studiaz posibilitile inoculrii genei
funcionale n celulele separate ale pa
cientului, reincluse apoi n organism. "'v^oiuT3
Sperm c n viitorul apropiat va de- F igura 2.37. Ciclul vital al retroviruilor
veni posibil tratarea bolnavilor prin
metoda integrrii genelor legate cu substane, ceea ce ar pennite o fixare direct a genei
n celulele-int. Azi integrarea n genom a genei dorite e nesemnificativo celul la
IO3'6. Se constat c integrarea n genom nu e ntotdeauna necesar la expresia
genei, doar e limpede c gena integrat se va pstra mult mai mult n celul. Apoi ea e
apt de a se replica cu DNA cromozomial, se va transmite la alte generaii de celule i va
determina sinteza produsului n dccursul vieii pacientului.
Pentru ncorporarea genei se utilizeaz capacitatea natural a viruilor de a ptrunde
n celule i de a-i aduce materialul genetic propriu. Cel mai promitor sistem de transfer
al genelor n celule o prezint retroviruii, ei sunt vectorii cardinali, dar tot ei sunt
capabili s se nclud n DNA cromozomial al celulelor apte de reproducere activ. Un
minus extrem de mare comport pericolul provocrii cancerului i, deci, apare o sarci
n importantposibilitatea de a stopa reproducerea acestor virui. n figura 2.37 e
redat ciclul vital al retroviruilor.
S-a elaborat o metod efectiv de recepionare a retroviruilor, care posed att o
membran extern normal, ct i toate proteinele virale. ns RNA viral nu conine
informaie de sintez a acestor proteine i locusurile secvenei nucleotidelor corespun
ztoare sunt ocupate de gena ce are a fi introdus n celul (fig. 2.38).
Dac bolnavului i se integreaz celule proprii ale sistemului imun preventiv, cultivate
i prelucrate cu interleukina-2, se produce ptrunderea limfocitelor n tumoare, se
nregistreaz regresia celulelor cancerigene. Din 15 bolnavi tratai (dup Rozenberg), la
9 (melanom n stare grav) s-a stabilit regresic vdit, la unul - complet.
n apropierea de Edinburg exist o stn cu oi transgenice (100), laptele crora
conine o cantitate suficient de proteine ce favorizeaz coagularea sngelui. Laptele
acestor oi e suficient pentru toi bolnavii de hemofilie din Europa.
La Institutul de Fiziologie din Cambridge se experimenteaz nite purcelui neobi
I . Crearea unui provirus ce ducc o gen curativ nuii. Lorii s-au introdus gene ce codi
nlocuirea genei virale fic hormonul somatotrop al animalelor
cu cea curativ
mari comute folosit n tratamentul diver
selor patologii ale omului.
G ene virale
In baza investigaiilor efectuate, ame
Provirus
ricanii au obinut porci ce cresc foarte
repede, iar carnea lor n-are slnin.
2. Inseria n celul, unde sc form eaz vccto
Aceste animale sunt slab rezistente la
P rovirus curai NA auxiliap temperaturi joase. S-au cptat cartofi
cc nu se foarte rezisteni la fiig etc.
include n
RNA cu gen particule no n perspectiv se va modifica i sto
curativ cc sc virale
include n noi matologia: se concep dini naturali n caz
particule
virale
4 dac gena omului va fi introdus n
genomul bacterii lor care vor sintetiza dinii
respectivi.
Deocamdat transferarea mai multor
Celula n carc si gene e imposibil, deoarece organismul
form eaz viru:
v c c to r nu recepioneaz mai mult dect o sin
gur gen. Savanii modific forma i
dimensiunile multor animale. Se poate
schimba i omul. Lui i se pot conferi pro
prieti noi, pozitive, dar i dimpotriv
negative. E un domeniu interzis de
experimentri. Azi nu sunt cunoscute
genele ce detennin capacitile mintale,
dar unele informaii referitoare la omul
bolnav sunt elucidate. Includerea gene
lor ar modifica vdit annonia organismului
uman.
C clula-int disponibil pentru im plantare La Institutul de Studii Biomedicale de
F igura 2.38. Vectoriiretroviruilor inofensivi pe lng Universitatea Washington, din
se form eaz n celule 1991 se studiaz tripanosoma, un
m icroorganism ce paraziteaz n
organismul omului i al animalelor.Savanii examinau proteina (III) i mRNA respectiv.
RN A s-a descoperit, dar gena nu. ns copie far original nu exist. Dup analogie
cu organismele nrudite, au stabilit DNA care potenial ar trebui s conin gena i au
comparat-o cu RNA iniial. S-a dovedit complementar dup toate bazele, cu excepia
U. Gena exista, dar RNA era modificat cam de 60%. S-a constatat c asemenea
modificri nu sunt un original, fiindc sc nregistreaz i copii precise.
Carc este, totui, cauza? Se consider c n celul are loc o transferare efectiv a
informaiei de pc DNA, ulterior, un redactor face unele corecturi n textul mRNA.
direcionat specific. Evident c n gene, copiile crora se corecteaz iniial, lipsete
semnalul de asamblare a proteinei. Rezultatul redactrii e apariia lui n mRNA.
astfel proteina poate fi sintetizat. Redactorul tie ce face. Acelai lucru s-a stabilit i
la speciile superioare. Funcia respectiv o ndeplinete RNA de corecie, care nu numai
c determin locul inciziei nucleotidelor, dar i prezint materialul respectiv. Enzimele
favorizeaz acest proces datorit prezenei unei gene informative (1991). Principiul
transmiterii mesajului genetic se complic ntructva (fig. 2.39).
M etoda ingineriei genetice e
R cplicarca _ . . R eplicarea
utilizat pentru crearea vaccinei T ra n sc rip ia ^__i -
contra SIDA, maladie provocat de T ra n sc rip ia )
7nversa* RNA
o familie de virui ce conin RNA. DNA
Viruii posed revers transcriptaze i
T ran slarc a
sunt foarte instabili. Sistemul imun
Polipeptid..
reacioneaz la proteinele superficiale
ale virusului care se m odific
permanent, modificri legate de
P roteina biologic-acliv
deriva genei. Pentru crearea vacci
F ig u ra 2.39. Dogma de transmitere a informaiei
nei e folosit virusul varioleica vector
genetice
incluzndu-se gena SIDA.
Moss a obinut o atare vaccin. La maimue apar anticorpi, dar rmn neprotejate de
SIDA. Efectul imun e de fa, ns nu i de protejare. Capacitatea de aprare este
detenninat de alte caracteristici ale antigenului. D.Zaguri a creat o vaccin pentru o alt
variant a SIDA, dar cu acelai impact. Pentru diagnosticul SIDA e utilizat metoda de
amplificare enzimatic a genei SIDA. Se confirm prezena virusului dup o or de
infectare, dac din 5000 de celule e afectat mcar una. Dup 12 ore de la contaminare,
diagnosticul se confirm la afectarea unei celule din 500.000. La tratamentul efectiv al
SIDA contribuie azidotimidina i 2'- 3' - dezoxicitidina nucleozide ce inhib revertaza
virusului.
S-au sintetizat i alte preparate asemntoare dup structur cu tranchilizanii, ce
sunt inhibitori activi ai revertazei la HIV-1 i nu la HIV-II (virusul african).
n omida fluturelui Hyalophora cecropina s-a descoperit o substan peptidic
cecropina B, ce lezeaz bacteriile i infecteaz omida. Biochimitii de la Universitatea
din Louisiana (1990) au sintetizat un ir de peptide cu o structur identic, deosebindu-
sedupciva aminoacizi. Una din aceste peptide are o for distrugtoare fantastic
i a fost numit Siva-1 (dup numele divinitii indiene, ce nu-i crua niciodat dumanii).
Peptidele contribuie la formarea porilor intracelulari i, n consecin, apa ptrunde
n celul, distrugnd-o. Siva-1 acioneaz i asupra membranelor celulelor mamiferelor,
dar celulele nu mor, fapt determinat de prezena citoscheletului ce pstreaz forma
celulei. n celulele cancerigene i n cele afectate de virusul SIDA citoscheletul e lezat.
Secvena aminoacizilor din aceste peptide e identic cu fragmentele semnale din
fibrinogenul omului protein cauzat de stres, rni. S-a stabilit c aceste fragmente
sunt mai efective dect iva-1, la distrugerea celulelor cancerigene. Aadar, organismul
uman n stare de stres elimin activ substane anticancerigcnc, antistresante i, deci,
este concludent c rezervele proprii ale organismului sunt deosebit de efective n lupta
cu factorii nocivi, rezerve care necesit o studiere ampl i profund.
BIOSINTEZA PRO TEIN ELO R
Mecanismul biosintezei proteinelor, cu diversitatea activitii biologice, s-a impus drept
problem dintre ccle mai dificile n istoria biochimiei. Azi, n temei, el este studiat, dar
posibil c aceasta e o mic parte din acel ntreg, care trebuie cunoscut. Evident, meca
nismul biosintezei e unul din celc mai complcxe procese n natura vie, implicnd conlu
crarea a peste 300macromoleculc specifice, reprezentate deproteinenzime, diferite
tipuri dc RNA cu funcii distinctive. Sinteza, cu o complexitate vast, decurgc cu o
vitez rapid: pentru sinteza lanului polipeptidic din 100 resturi de aminoacizi ribozomului
E. coli i sunt destule 5 secunde.
Sinteza n fiecare celul conlucreaz cu metabolismul. Procesul de biosintez presupune
traducerea limbajului de 4 litere al acizilor nucleici n limbaj de 20 de litere (aminoacizi) al
proteinelor.
Baza cunotinelor noastre de azi au fost cimentate de trei mari descoperiri ale anilor
50 din secolul precedent:
1. Paul Zamecnik (1950) stabilete c locul sintezei proteice e ribozomul.
2. Paul Zamecnik i Mahlon Hoagland (1957) au demonstrat c activarea
aminoacizilor i adiionarea lor la tRNA e catalizat de aminoacil-tRNA-sintetaze.
3. Francis Crick a expus ipoteza transferului mesajului genetic codificat n acizi
nucleici cu 4 litere n limbajul celor 20 aminoacizi, concluzionnd: tRNA ndeplinete
funcia de adaptoro poriune racordeaz aminoacidul specific, iar alta identific n
mRNA o secven mic de nucleotide ce codific acest aminoacid.
Biosinteza proteinelor include 5 etape:
I. Activarea aminoacizilor. Procesul are loc n citozolul celulei, n care cei 20
aminoacizi adiioneaz la tRNA prin legtura esteric. Procesul e catalizat de enzime
diferite numite aminoacil-tRNA-sintetaze. Ele sunt caracteristice fiecrui aminoacid i
tRNA, corespunztor. Activarea are loc n anumite faze:
a) n centrul activ (CA) al enzimei decurge unntoarea reacie:
AA + ATP + E -=^= E-AAAdenilat + PP.I
Legarea aminoacidului (COOH) are loc la gruparea 5'-fosfat a AMP din molecula
enzimei.
b) Transferul de la E-AAA pe tRNA specific a restului de aminoacid:
E-AAA + tRNA = s = AAtRNA + AMP + E
Adiionarea aminoacidului are loc la grupele de OH n poziia 2' sau 3' a restului de
adenozin n molecula tRNA (legtura e macroergic). Hidroliza ulterioar a
pirofosfatului, sub aciunea pirofosfatazei, face reacia ireversibildeplaseaz echilibrul
spre dreapta. 2.
Aminoacid + tRNA+ATP ' ^ AAtRNA + AMP + 2Pi
A A tR N A s , , T, .
Pirofosfataza AG ~ - 29 kJ/mol
Enzimele sunt foarte specificeau 4 locusuri care particip la identificare, cataliz,
posednd capacitatea de autocontrol: 1)AA; 2) tRNA; 3)ATP; 4) IIOH ultimul e
indicat pentru hidroliza aminoacidului impostor. Specificitatea e detenninat exclusiv
de structura tRNA (1 eroare la 400 resturi dc aminoacid).
Sigurana procesului de traducere n mare msur e condiionat de capacitatea de
autocontrol a sintctazelor. Activarea necesit ATP i ioni de magneziu.
Deosebim 2 clase de aminoacil - tRNA-sintetaze:
Clasa I - Arg, Cys, Gin, Glu, Ile, Leu, Met, Trp, Tyr, Val (OH-2' terminal tRNA).
Clasa II - Ala, Asn, Asp, Gly, His, Lys, Phe, Pro, Ser, Thr (OH-3' terminal tRNA).
Structura general a unui aminoacil-tRNAs e redat mai jos. De asemenea sunt ilustrate
i conformaiile celor dou sintetaze - tip 1i tip II.

O Aminoacidul

Structura general a AA -tRNAs Aminoacil- tRiSA sintetaza.


a)Gin -tRNAs, b)Asp -tRNAs

Sinteza lanului polipeptidic ncepe cu captul N-tenninal, la care adiioneaz ulterior


resturile de aminoacizi spre -terminal. Aminoacidul iniiator la procariote este N-
formilmetionina, la eucariote - metionina. N-fonnilmetionina se fonneaz n dou etape:
1. Met + tRNAfmcl + ATP ^ Metionil-tRNAfmel + AMP + PP
2.N l0-fonniltetrahidrofolat + Met-tRNAfmel *- N-formilmet- tRNArmel + FH4
(tetrahidrofolat).
Reacia este catalizat de transformilaza specific. Sunt 2 tRNA specifice la met-
I tRNA' i N-fonnilmet-tRNA^. Prima conduce la includerea metioninei n lanul polipeptidic,
a II - la legtura cu un anumit locus n ribozom.
11. Formarea complexului de iniiere decurge n 3 etape (fig. 2.40). Sunt necesare:
I 1) subunitatea mic a ribozomului; 2) mRNA ce codific pol ipeptidul necesar; 3)N-
I fmet tRNAfmcl; 4) 3 proteine-factori de iniiere-IF-1, IF-2, IF-3; 5) GTP.
Etapa 1. Subunitatea mica leag IF-3 i previne reasociaia subunitilor ribozomiale.
La subunitate adiioneaz mRNA astfel codonul de iniiere AUG sc fixeaz ntr-un loc
specific al subunitii. Fixarea lui corect e de
terminat de un fragment al mRNA aranjat la
cap 5' tenninal adiacent codonului AUG (com
pus din 6-8 resturi de A i G). Acest fragment
Shine-Dalgarno este perfect complementar
cu o succesiune de nucleotide de la cap 3'-
OH al rRNA 16 S (fig.2.41). Sensibilitatea ri-
bozomului la semnalul de iniiere moduleaz
Codonul de inicre
viteza traducerii. Semnalul indic locul de fixa mRNA

re a N~fmet-tRNAf,"et.
Etapa 2. La complexul format adiioneaz
IF--2 legat de GTP i fmet-tRNAfme, care se
fixeaz n centrul peptidilic (P).
Etapa 3. Complexul interacioneaz cu
subunitatea 50S, implicnd simultan hidroliza
GTP pn la GDP i Pi, care se elimin din
complex. Prsesc ribozomul IF-1,1F-2 i
3 ' UAC 5
IF-3. n consecin, se formeaz complexul
Anticodonul
de iniiere, alctuit din ribozomul 70S, 6'
funcional activ, i mRNA, N-frnet-tRNAfmet.
Fixarea corect a ultimei e determinat de
formarea perechii complimentare dintre tripletul
anticodon i codonul mRNA ct i de fixarea
tRN A de locusul P al ribozomuiui.
Aceast etap la eucariote este mult mai com
plex i include o mulime de factori (fig.2.42).
III. Elongaia lanului polipeptidic
Ea reprezint un proces repetat. Pentru
realizarea lui sunt ncccsare: complexul meni
onat deja, urmtorul AA-tRNA corespunz
tor tripletului ulterior al mRNA, trei proteine
solubile citozolicc, factori ai elongaieiTu,
Ts, G i GTP.
Procesul decurgc n trei faze: F igura 2.40. Formarea complexului de iniiere
a) Aminoacidul unntor activ (A A,-tRNA) rR N A 16S

se fixeaz cu Tu i GTP, formnd complex ce


adiioneaz la complexul de iniiere. Simultan,
are loc hidroliza GTP, rezultnd abandonarea
complexului Tu-GDP de ctre ribozom.
Ultimul e reactivat cu GTP iTsnTu-
GTP. AA,-tRNA se fixeaz de locusul mRNA
aminoacidic datorit interaciunii complemen F igura 2.41. Segmentul complementar
tare antiparalele ntre anticodon i codonul Shine-Dalgarno
C om p o nente iniiale Procariote
Subunitatea?
m ic

Factorii
deiniere Gp
ATP
Subunitatea fM ct-
m are
IS S tR N A

30S com plcxul de iniiere

GD P
70S/80S

<S>

GDP
ADP
F igu ra 2.42. Formarea complexului de iniiere la pro- i eucariote

mRNA. Fixarea adecvat e determinat i de interaciunea n locusul A ntre tRNA i


rRNA. S-a stabilit perfect c n bucla W C se localizeaz unele fragmente ce
formeaz perechi cu bazele din 16S rRNA - la fixarea anticodonului. n 16S rRNA
secvena C-C-A-A este complementar T ^ C din tRNA (fig.2.10). Legarea se
marcheaz numai dup interaciunea corect dintre codon i anticodonefect alosteric
al fixrii (fig. 2.43).
b) Elongarea continu prin fonnarea legturii peptidice ntre aminoacizi din locusu-
rile P i A. Complexul de iniiere cu N-formilmetionina de la tRNA este propriu-zis
transferat pe grupa aminic a noului aminoacid n centrul A. Reacia catalizat dc
peptidil transferaz, ce intr n compoziia subunitii 50S i n final se formeaz
dipeptidil-tRNA, iar n centrul P rmne tRNA liber (fig. 2.44).
c) n faza urmtoare ribozomul parcurge pe mRNA spre captul 3 'o distan egal
cu un codon, cu transferarea dipeptidului tRNA n centrul P, iar tRNA (hidroliza liber)
abandoneaz ribozomul i se permut n citozol. n centrul A se afl al treilea codon al
mRNA. Micarea, alunecarea ribozomului se numete translocare. Procesul este ca
talizat de o translocaz i presupune hidroliza unei molecule dc GTP Procesul e
condiionat de existena factorului de elongarc. n aceast faz au loc modificri
confonnaionale a ntregului ribozom. El e gata de urmtorul ciclu de elongare.
La legarea n lan sunt antrenate dou molecule dcGTP (fig. 2.44a).
F igura 2.43. Etapa I a elongrii F igura 2.44. Etapa I I a elongrii, formarea legturii peptidice

IV. Finalizarea sintezei lanuluipolipeptidilic (fig. 2.44b). Procesul se oprete


atunci cnd ribozomul ntlncte unul dintre codonii nonsens, ce semnific finalizarea. n
ansamblu, acioneaz i factorii de finisare R, i S care efectueaz urmtoarele
operaii:
a) detaarea hidrolitic a polipeptidului de la tRNA i eliminarea lui (hidrolaza);
b) eliminarea tRNA, purttor al ultimului aminoacid din locusul peptidilic;
c) disocierea ribozomului n subunitile respective, apte s resintetizeze un alt lan
polipeptidic.
Biosinteza proteinelor cere un consum substanial de energie minimum 4 legturi
macroergice sunt necesare pentru formarea unei legturi peptidice, ce asigur ireversi
bilitatea procesului i stabilitatea lui. Lanul de mRNA poate reine mai muli ribozomi
mpreun, fonnnd polizomi ce accelereaz considerabil sinteza i eficacitatea matricei
(fig. 2.45).
Factorii de
Uf \ finisare
Dipcptidil

5 -

Hidroliza
polipeptidului
sintetizat
<:oo

Micarea ribozomilorv '

F igura 2.44a. Etapa III a elongrii, translocarea F igura 2.44b. Finalizarea sintezei proteinei

Dac sinteza proteinei nu e necesar, nucleazele deprim mRNA.


n procesul de sintez sau imediat dup ea, proteina se autoasamblcaz, formnd
conformaia nativ structura tridimensional. Probabil lanul polipeptidic sintetizat
sufer modificri covalente, numite modificri posttranslaionale (prelucrri posttra-
ucere faza V), ce constau n:

r 1) modificarea captului N- i C- terminal, N - mai frecvent se acetileaz;


2) ndeprtarea secvenei semnalizante cu ajutorul unor peptidaze;
3)ataarea unor grupri funcionale fosfat, biotin, glicozil pentru formarea
fosfoproteinelor, carboxikinazelor, glicoproteinelor etc.;
4) clivarea unor oligopeptide (preproinsulina);
, 5)metilarea(lizmanmuchi); iodurarea reziduului de tirozina n tircoglobulin;
-----------------------------------------------------------------------
7) formarea punilor disulfidicc; Subuniti ribozom iale

8) modificarea unor aminoacizi lipsii de cod


(hidroxiprolina, hidroxilizina etc.).
In ce mod proteina sintetizat se locali
60S
a
r

f 40S

zeaz n celul?
La captul N-terminal se pstreaz secven
e specifice- lider 15-30 de aminoacizi. Ei
sunt sintetizai n primul rnd i sunt identificai
de locusurile receptoralspecifice de pe
suprafaa exterioar areticululuiendoplasmatic
adiacent sintezei complete. Aceast poriune-
lider, de obicei, e hidrofob, liposolubil, uor
ptrunde prin membran in interiorul cisternelor
reticulului endoplasmatic i trage dup sine restul
lanului. Ideea original i aparine lui George
Palade, laureat al Premiului Nobel, original din
Moldova.
n cisterne, o peptidaz specific o cliveaz.
Proteina matur n aparatul Golgi este
incapsulat, apoi prsete celula n forma unei
bule secretoare (fig. 2.45a).
n ultima perioad se postuleaz dou
concepii de asamblare a proteinelor n forma
nativ , stru c tu r unic trisp a ia l :
cotranslaional i p o sttra n sla io n a l .
Confonn concepiei cotranslaionale, proteinele
se aranjeaz spaial n procesul sintezei lanului
polipeptidic n ribozom, iar potrivit concepiei

S ccvcn sem nai


C itozol

R ibozom ial receptor

F igu ra 2.45a. Compartimentalizarea proteinelor n reticulul endoplasmatic


posttranslaionale- forma nativ apare numai n urma eliberrii complete a lanului
polipeptidic din ribozom.
Sunt rezultatele unor experimente biochimice in vivo i pe sisteme-inodel, care confinn
conccptul cotranslaional de asamblare.
De regul, foldingul proteinelor are loc n compartimentele corespunztoare ale celulei
- mitocondrii, reticulul endoplasmatic, citozol ribozomial. Proteinele penetreaz mai multe
membrane n calea spre locul de asamblare. Unele se pot asambla alturi de membranele
corespunztoare.
In citozol i n plasma organitelor celulare, unele proteine se asambleaz cu participarea
complexului ciaperonic.
Azi se pot evidenia trei cazuri de asamblare a proteinelor, n dependen de localizarea
acestui proces: lng ribozom, n apropierea membranei sau cu participarea ciaperonilor.
Asamblarea proteinelor lng ribozom. tim c lanul polipeptidic prsete
ribozomul ntr-un anumit mod: ncepnd cu captul N-terminal i, consecutiv, parcurge,
segment dup segment, lanul din centrul polipeptidilicprin canalul ribozomial ngust
spre suprafaa ribozomului, cu ieirea cotraslaional n citoplasm.
Dac lanul polipeptidic nu are secvena-lider, el nu este transportat i se asambleaz
n citoplasm lng ribozom. n ce constau mecanismele de asamblare, ce reprezint
acest model? Asamblarea ncepe cu momentul translocrii primului rest terminal-N al
lanului din ribozom n citozol (de la acest moment au loc modificri confonnaionale sub
influena forelor moleculare, ce cauzeaz asamblarea proteic). n continuare, asamblarea
are loc simultan, cu translocarea lanului, i se finiseaz dup ieirea ultimului C-rest
terminal din ribozom.
- Asamblarea are loc n etape consecutive, analogice cu ciclurile de translocaie a
lanului din ribozom. Numrul de etape e identic cu fenomenul de translaie la sinteza
lanului.
- La fiecare etap se formeaz o confonnaie a captului N-terminal al lanului ce iese
din ribozom. Aceasta este o structur iniial n formarea confonnaiei unui lan mai lung
n etapa unntoare a foldingului (are loc scindarea unor legturi moleculare, cu fonnarea
altora).
- Elementele de structur secundar (a - spaial, - lan, domeniile) formate n
fiecare etap a foldingului se distrug, se modific sau pot rmne nemodificate n etapa
urmtoare.
- Fonnarea unei conformaii a lanului sintetizat la toate etapele foldingului, precum i
a conformaiei native a proteinei la ultima etap, dureaz nu mai mult dcct este necesar
ribozomului pentru realizarea unui ciclu de elongaie. Durata foldingului este egal cu
timpul sintezei lanului polipeptidic de ribozom.
Sunt propuse i cteva concepii referitoare la mecanismul asamblrii cotranslaionale:
a) dctenninat de viteza de translaie a diferitelor segmente ale lanului polipeptidic;
b) e determinat dc viteza de translaie a diferitelor segmente din mRNA, cauzat de
clasterele codoanelor rar ntlnite, ct i dc codul degenerat;
c) alt concepie susine c modificrile confonnaionale temporare sunt detenninate
de codoanele aminoacizilor iniiatori i terminali pe suprafaa a-spiralei.
Cu alte cuvinte: structura secundar, teriar proteic nu e dependent de resturile
aminoacidice dm lanul polipeptidic.
Asamblarea lng inembran.Trans\ocaha lanului polipeptidic prin membran are
loc prin canalul respectiv membranar i coincide cu periodicitatea ciclului de elongaie
ribozomial. Sc presupune c procesul de asamblare lng membran pe partea opus a
organitelor celulare este analogic cu schema propus la asamblarea proteinei lng
nbozomi. Se consider c regiunea suprafeei respective, unde arc loc asamblarea lanului
polipeptidic n structura nativ, conine resturi de aminoacizi polari i e foarte hidratat.
Acest fapt protejeaz lanul de interaciune cu complexul translocaional proteic.
Schema propus presupune c asamblarea proteinelor este un proces dinamic de
autoorganizare a structurii spaiale a lanului polipeptidic, ce ncontinuu se alungete, n
funcie dc etapele de timp. n compartimentele celulei ndeprtate de ribozom, lanurile
polipeptidice se vor asambla posttranslaional, adic dup finisarea sintezei lor n ribozom
(cu excepia acelor proteine care se sintetizeaz n ribozomii alturai la membrana
reticulului endoplasmatic).
Conform acestei ipoteze, asamblarea cotranslaional a proteinelor indic faptul c
asamblarea lanului n structur nativ are loc simultan cu translocarea lui n locul de
asamblare.
Foarte multe aspecte sunt neelucidate. Unele proteine, primar fiind native, pierd
structura teriar rigid la interaciunea cu membranele. Asemenea modificri sufer
toxinele, diversele proteine de transport. Datele confirm c membrana poate servi ca
factor denaturant n celula vie, cauzat de prezena n membran a sarcinii negative. Acest
potenial electrostatic al suprafeei membranare manifest o atracie a proteinelor din
soluie, cauznd micorri locale de pH pe suprafaa ei, cu formarea unui gradient de pH
n microspaiu. Se consider c acest fapt, n ansamblu cu micorarea permeabilitii
dielectrice a mediului, poate transforma molecula proteic n stare denaturat cu
proprietile caracteristice globulei nfuziunestarea a treia termodinamic a moleculei
proteice.
Una din caracteristicile moleculei proteice nenative este proprietatea ei major de
asocierc. n procesul dc renaturare, proteinele sunt capabile s formeze asociaii de
intermediate.
Anionii sunt capabili s induc n proteinele globulare, parial denaturate, asociaii,
care se amplific odat cu diminuarea coninutului dc structur secundar.
Se consider c asocierea proteinelor o problem cardinal n biomedicin i
biotehnologie, fiind cauza unor astfel de maladii ca: boala Down, mieloma, cataracta,
afeciunile prion.
n condiii extremale, adaptarea e cauzat de mutaiile la nivelul DNA i al proteinei
cu participarea unor grupe prostetice, care pot stabiliza att starea nativ, ct i
intennediatele foldingului. S-a constatat experimental c:
a) glicozilarca majoreaz mult stabilizarea i solubilizarea proteinelor;
b) glicozilarea nu modific mecanismul foldingului i al asociaiei proteice;
c) componenta glucidic, graie capacitii solubilizante, protejeaz partea proteic
de agregare termic, manifestndun efect ciaperoninic.
n diferite situaii extremale, datorit reglrii sintezei polioxizii a compuilor, se produc
concentraii locale mari ale grupelor glucidice, ce posed efect de protejare. Asemenea
fenomene sunt nregistrate la bacterii, plante i animale mici.
La plantele rezistente la secet proteinele nviate sunt bogate n lizin, serin, treonin,
ce joac rolul de imitatori ai apei intracelulare, n condiii extremale.
Organismele pot anihila stresul prin neutralizarea acidittii anormale sau echilibrarea
concentraiei mari de sruri, graie concentraiei izoosmotice de substane corespunztoare
sau a mutaiilor respective. Organismele termofile i barofile sunt capabile de adaptarea
celulelor cauzat de mprejurrile extremale pe parcursul ntregului ciclu vital. La
hipertermofile limita creterii optime este de 80-110, presiunii hidrostaticepn la
120 mPa, pil - de 0-11. Hipertennitele posed o strategie de protejare puin cunoscut
azi. Foarte puin se cunoate i despre degradarea hidrotermal a aminoacizilor. Degradrii
oxidante sunt supuse cisteina, metionina; dezamidrii asparagina i glutamina.
Ionii, cofactorii, metaboliii conjugai cu componentele neproteice modific esenial
stabilitatea proteinelor i denaturarea termic, ce poate ti permutat spre limita maxim
pn la aproximativ 120C.
Particularitile biosintezei proteice la eucariote
Procesul biosintezei proteice la eucariote se desfoar confonn unui mecanism similar
procariotelor, dar cu unele particulariti:
a) Aminoacidul iniiator nu esteN-fonnilmetionina, ci metionina.
b) Pe molecula mRNA, la eucariote, exist un singur semnal de iniiere, reprezentat
de 7-metil-guanozin trifosfat, legat printr-o succesiune de nucleotide metilate de codonul
iniiator AUG; deci, mRNA la eucariote este monocistronic. Este singura succesiune de
nucleotide AUG apropiat de 7-metil-guanosin care servete drept codon de iniiere;
aceasta este posibil datorit exigenelor de legare a ribozomului. La procariote muli
mRNA suntpolicisronici, codificnd sinteza a dou sau mai multe proteine. Pe un astfel
de mRNA exist multiple semnale de iniiere, care vor codifica sinteza a tot attea proteine.
c) Ribozomul eucariot nu sare peste codonii tenninali ca cel procariot. i acest fapt
pledeaz pentru caracterul monocistronic al mRNA la eucariote.
d) Viteza procesului de traducere este mai mare la eucariote; n plus, pentru creterea
eficienei traducerii, mai muli ribozomi se angajeaz simultan n citirea mRNA, toi ncepnd
citirea de la captul 5'.
Asocierca mai multor ribozomi, ce traduc simultan aceeai molecul dc mRNA, se
numete poliribozom sau polizom.
Inhibitorii sintezei proteinelor
Majoritatea toxinelor bacteriene se comport ca inhibitori ai biosintezei de proteine.
Aciunea specific a antibioticelor este incontestabil. Aproape fiecare etap a sintezei
proteinelor e inhibat de un anumit antibiotic i aceast inhibiie se poate ntlni n orice
moment al transferului de mesaj. S-au stabilit urmtoarele (vezi fig.2.46):
1. Streptomicina produce erori n reproducerea mesajului genetic; interfereaz n
locul de iniiere, cu legarea fmet.-tRNAfmcI. De asemenea, ncomicina, kanamicina,
gentamicina produc erori n reproducerea codului genetic.
2. Mitomicina, acyclovir (acelai mecanism) mpiedic separarea catenelor
com plem entare ale DNA, acidul E ritrom icina
nalidixic inhib DNA helicaza (giraza), sacptogramina Peptidii
Purom icina
actinomicina D se leag trainic de DNA,
Cloram fcnicol
mpiedic transcrierea. S parsom icina
3. Tetraciclin blocheaz A situs n 50S
ribozom (iniierea). T hiostrepton
4 .E ritro m ic in a se leag de
subunitatea 50S i inhib translocarea. 30S Strcptomicina
mRNA'
5. Puromicina blocheaz elongarea,
e analoag cu captul '-OH al AA
Acid Aeid fuzidie Tetraciclin
tRNA i formeaz peptidii puromicin, aurintricarboxilic
aa nct nu mai adiioneaz nici un F igura 2.46. Site-urile le aciune ale antibioticelor
aminoacid.
6. Toxina difteric inhib translocaza.
7. Cloramfenicolul inhib peptidii transferaza.
8. Ciclogeximida inhib sinteza n ribozom 80S (translocaza).
9. Tunicamicina inhib ataarea catenelor oligozaharidice. Rifampicina i amanitina
s-au descris mai sus (RNA-polimeraza).
10. Spiramicina previne fixarea n site-ul P ribozomial.
11. Acidul fuzidie sechestreaz G-factor i GDP n site-ul GTP-azei.
12. Acidul aurintricarboxilic previne fixarea RN Am n subunitatea 30S ribozomial.
13. Thiostreptona interacioneaz cu factorii G i T n site-ul GTP-azei.

H3CX y C lh
N

c=o
I c=o
Hc R
NH2CH C H f" \ -0 -
. NH2
A m inoacil-tR N A Purom icina
REGLAREA BIOSINTEZEI PROTEINELOR
Graie procesului de reglare a sintezei, n celule se stabilete un complex adecvat de
enzime ce asigur activitatea normal a fenomenelor celulare. Dei fiecare celul conine
un set de genom caracteristic acestui organism, celulele lui exprim numai o parte din
genele structurale. Toate celulele conin un set de enzime de baz, necesar pentru
manifestarea metabolismului. Diferite celule, ns, conin structuri proprii numai lor i
ndeplinesc anumite funcii biologice. Biosinteza diferitelor tipuri de proteine specializate
sunt programate strict n timp i consecutivitate, ceea ce permite o adaptare biochimic
la aciunea diverilor factori.
Celulele dispun de trei tipuri de enzime: 1. enzime inductibile; 2. enzime represibile;
3. enzime constitutibile. Ultimele se reprezint n cantitate constant, indiferent de sta
rea metabolic a organismului (glicoliza). n alte celule reglarea e asigurat de cele induc
tibile i se sintetizeaz numai atunci cnd este necesar, sub influena inductorului. Induc
torul poate determina sinteza unui grup de enzime inducie coordonat, ceea ce
permite o adaptare imediat i econom n utilizarea substanelor nutritive. Concentraia
enzimelor represibile depinde de prezena sau absena din mediu a unui compus
denumit corepresor. Enzimele acestea sunt implicate n cile anabolice, cele inductibile,
respectiv, n catabolice. Ne confruntm i cu represie coordonat, represieprin produs
final.
Represia, ca i inducia, e reflectarea principiului economiei celulare. Explicarea pro
ceselor de inducie i represie enzimatic se datoreaz lucrrilor lui EJacob i J.Monod
(1961) teoria lac-operonului , adic reglarea la nivelul transcripiei.
Utilizarea lactozei la bacterii implic creterea sintezei -galactozidazei necesare pentru
hidroliza lactozei cu scop energetic, enzim codificat de gena Z. -galactozidele (-
galactoza i oc-glucoza) sunt transportate prin membrana plasmatic printr-un proces
cuplat cu gradientul dc protoni. Proteina implicat n acest proces este -galactozid
permiaza cu o mas molecular de 46,5 kDa; sinteza ei este codificat de gena Y. Unele
-galactozide sunt acetilate sub aciunea transacetilazei, care vor traversa membrana
plasmatic, ieind din celula. Enzim este un dimer i este codificat de gena A. Genele
structurale care codific sintez celor trei enzime sunt controlate de alte dou gene: gena
reglatoare Lacl i gena operatoare O. Ultima, mpreuna cu genele structurale, alctuiete
operonul lactozei (Lac - operon) (fig. 2.47).
Gena reglatoare se afl la distan mic de operon i detennin sinteza unei proteine
numit represor, care, legndu-se de gena operatoare, mpiedic transcrierea genelor
i structurale. Inductorul (metabolit) se leag de proteina represor, modific conformaia,
blocnd fixarea ei de gena operatoare. n acest caz are loc transcrierea genelor i sinteza
enzimelor codificate de ele.
Teoria modernizat const n urmtoarele (fig. 2.47a).
n lipsa glucozei sau la concentraiile mici ale acesteia (ca rezultat al activitii
I adenilatciclazei i inhibrii fosfodiesterazei), apare AMPc, concentraia cruia crete,
I reprezentnd astfel semnalul foamei pentai bacterii. n consecin, se formeaz complcxul
I cu proteina receptoare, cu legarea acesteia de promotor (p-locus). Proteina receptoa-
i r e e numit proteina activatoare a genei catabolice (CAP). Acest proces favorizeaz
a . R epresia
p la c I la c Z lac Y lac A

T ran scrip ia
T ran slarc a

R c p rcso r T e tra m e r

. Inducia
p lac I p lac Z lac Y lac A

T ran scrip ia
T ran slarc a

in activ
In d u cto r

. S tim ulare +
P Ia ci ^ p o lac z lac Y lac A

CRP<'< i

D im cr
cA M P
F igura 2.47. Reglarea activitii Lac - operonului (CRP-protein receptor penru AMPc)

ptrunderea RNA-polimerazei n locusul de reglare. CAP dispune de dou centre


pentru AMPc i pentru DNA.
Proteina represor a fost izolat. Ea are dou centre pentru a se lega de locusul ope
rator i de inductor. Atunci cnd concentraia glucozei e mare, concentraia AMPc e
mic. Lipsete i complexul CAP-AMPc. n final, RNA polimeraza nu se leag de pro
motor, iar genele Lac nu sunt transcrise, indiferent dac exist sau nu lactoza, adic
indiferent de faptul dac operatorul este sau nu ocupat de represor (fig. 2.47a).
Aceast dubl modalitate de reglare (de CAP-AMPc i represor-inductor) confer
organismelor o mare flexibilitate metabolic, permindu-le s-i rezolve problemele de
adaptare n diverse medii nutriionale.
Promotorul e localizat n apropierea regiunii codificate. In anii 80 au fost depistate i
alte elemente reglatoare, denumite e n h a n e r s (activatori), localizate la mii de
nucleotide de la promotor sau regiunea codificat. Sunt depistate i elementele
reglatoare s i l a n c e r s , carc servesc ca inactivatori.
Posibil c astfel se regleaz i aceste structuri. Promotorii i enhancersele sunt compuse
din cteva subiecte secvene de nucleotide scurte care formeaz locusuri de fixare a
proteinelor reglatoare. Proteinele se ataeaz de subiecte bilateral simetric.
Glucoza ( -) \

cA M P (+) /
/

Glucoza ( +) L a c to z a

...........
cA M P (- )
Lac represor

Figura 2.47a. Efectele combinate ale glucozei i lactozei n expresia Lac - operonului

Enhancers prezint un puternic reglator pozitiv, efectul lui nu depinde de localizarea


fa de gena reglat. Fiecare gen poate avea unul sau mai muli enhancers.
Proprietile acestor elemente sunt:
1) cis-elemente active, numai dac se afl n structura anumitului DNA cu gena reglat;
2) n-are polaritate, direcia sa poate fi reorientat, far a diminua practic activitatea
lor;
3) localizarea poate fi schimbat fa de gen, mai des e precedent lui, la sute
sau mii dc nucleotide. S-a determinat prezena lor i n introni;
4) indiferent dc gena pe care o regleaz, schimbnd-o pe alta, o activeaz pe ultima;
5) posed o slab pronunare de specie, ns n celulele sale acioneaz mai efectiv;
6) muli i manifest o exprimat specificitate de esut. Enhancers genei FIb sunt
maximum activi n celulele eritrocitare; enhancers ale H catenelor imunoglobulinei
sunt activi n celulele liinfocitare. Enhancers prezint factori primordiali ai diferenierii;
7) o gen poate avea mai muli enhancers;
8) enhancers sunt reglai de factorii celulari, de glucocorticoizi. Exist mai multe
secvene ce sunt identificate dc receptorii glucocorticoizilor. Eliminarea lor inactiveaz
enhancers, fapt argumentat la virusul cancerului glandei mamare.
9) hotarele enhancers nu-s strict delimitate, dar aflm regiuni discrete, n carc
mutaiile brusc micoreaz activitatea. Aceste regiuni corespund unor zone omoloage
ntre enhancers; spre exemplu, blocul izolat - activ (GCTGTGCAAAG). Se nregistreaz
i alte zone conservative;
10) un enhancers are mai multe zone de acest tip premergtor. ntre blocuri se
manifest sinergismul n aciune;
11) enhancers (unii) activeaz transcripia genei, dar nu o menin. Gena mutanilor
I celulari cc au pierdut enhancers, i pierde activismul n alte celule. Activitatea se
prestabilete numai dac sc ataeaz enhancers corespunztori.
Silancers constituie elemente de control negativ, cu aceleai proprieti. Expresia
genei va fi suficient numai n cazul n care cu toate motivele n promotoare sau enhancers
se vor fixa proteinele corespunztoare. De aceea, expresia genelor va fi pronunat
doar n acele celule care sunt apte de sinteza unui complet de proteine reglatoare, capa
bile s recunoasc anumite motive. Se cunoate c albumina se sintetizeaz numai n
hepatocite, ns celulele creierului, ale splinei conin proteine care pot idcntifica elemen
tele reglatoare ale genei de albumin, dar nu sintetizeaz albumina. Concluzia e unic:
activarea genei e un proces mult mai complex.
S-a dovedit c proteinele ce se ataeaz de DNA trebuie s corespund dup
structur proteinelor fixate n vecintate. Fiecare promotor i enhancers este capabil
s reacioneze cu cteva combinaii diferite de molecule proteice, dar numai o singur
combinaie activeaz gena. Proteinele reglatoare formeaza homodimere (perechi de
proteine identice) sau heterodimere. Ultimele confer organismului unele avantaje
(identific 2 secvene nucleotidice diferite n acelai subiect de DNA) i lrgete spectrul
de reglare.
E argumentat i faptul c activarea genei poate ti realizat de ctrc fragmentele pro
teice reglatoare, care n-au nimic n comun cu locusurile responsabile de fixarea DNA
- aceste domenii activatoare ntr-un mod anumit interacioneaz cu RNA-polimeraza.
Domeniile active pot servi ca locusuri de contact cu alte proteine i, n consecin, cercul
de interaciune se lrgete, ndeosebi la heterodimere.
n ce mod interacioneaz proteinele ataate la DNA ?
Parial rezolv problema aa-numitele fermoare de leucin (fig.2.48 a, b, c).

F igura 2.48a. Fixarea ferm oar a dou molecule proteice F igura 2.48.b. Fermoarul
prin leucin. Ea favorizeaz fixarea proteinelor reglatoare leucin (fiecare al aptelea
cu DNA, modificnd activitatea genelor aminoacid) n -elicea proteic
F ig u r a 2 .4 8 e . M odelul F igu ra 2.48d. Fermoarul leucin contacteaz cu DNA, favoriznd
com puterizat (im aginea fixarea. Asparagina i ali aminoacizi n aceste fragm ente sunt
m ai n ch is indic invariabile
resturile de leucin)
n proteinele vizate aminoacidul al aptelea este Ieucina aminoacid hidrofobce
permite moleculei de protein s se asocieze n perechi cu locusurile lor, formnd astfel
dimere - superspiral. Fragmentele sunt aranjate paralel, ca-n colagen, determinnd du
ritatea spiralei. Pot asocia diferite proteine, dar la fixarea DNA nu particip.
n apropierea acestor fragmente sunt situate secvene bogate n arginin i lizin, care
contacteaz cu DNA. Poziia adecvat a fragmentelor de arginin i lizin, ce
determin fixarea cu subiectele bilateral simetricc din DNA, este asigurat de asocierea
a 2 molecule de proteine (fermoar (g )-picioaiul - fermoar; umerii-aminoacizi bazici).
Spirala e deformat dc asparagina, cc-i permite spiralei s contactezc cu DNA. Aceste
fragmente au un grad mare dc conservatism, un rezultat evident evolutiv i posibil
relev formarea heterodimerilor din proteinele neidcntice(fig.2.48.d).
Reglarea fin a biosintezei proteinei necesar pentru funcionarea normal att
a celulei, ct i a ntregului organism. Generarea insuficient sau excesiv mcar a unei
proteine poate conduce la consecine nefaste. Surplusul unor factori de evoluie provoac
tnalignizarea celulelor.
E clar c durata sintezei fiecrei proteine e direct proporional cantitii de
mRNA. Factorii ce regleaz cantitatea dc mRNA, n final, determin i nivelul de
sintez a proteinei. Cantitatea de mRNA i protein corespunztoare din celul era
determinat, dup presupuneri, numai de durata procesului de sintez. Recent, s-a
I stabilit c un rol important l joac i durata de degradare a mRNA. Producerea protei-
I nei depinde nu numai de intensitatea sintetizrii mRNA, dar i de durata scindrii lui.
Ce determin durata degradrii tnRNA?
mRNA degradeaz n citozol sub aciunea enzimelor denumite ribonucleaze, carc
I activeaz sub influena unor factori ce se fixeaz de moleculele de mRNA. Unul dintre
I factorii principali este structura lor proprie (fig.2.49.a,b).
Semnal slart Semnal stop Poli A

Ii i i I I I il
( ............ I 11 I I i i
I 1 1I IIII 11 I I I i i I I I li I I 11

5 netranslabi! Secvena 3 netrans labil


codificat
F igura 2.49a. Molecula de mRNA
S cgm ant
netraslabil
Pentru sinteza proteinelor rolul pri
mordial l are secvena codificat, unde
acioneaz ribozomii. Acest proces
este influenat efectiv de celelalte
fragmente.
a) Lipsa 5'-fragment netranslabil n
Stop
- ----- ;C^ ..... i
- rfaIQ' gena C-myc (gen protooncogen, ce
codific proteina necesar pentru mi-
toza normal. Dac, ns, proteina e
S tart Stop modificat saue n exces, celula nor
mRNA stabil
mal se malignizeaz) mrete perioa
mRNA nestabil da de njumtire (P 1/2) a mRNA,
genereaz surplus de protein n
m RN A hibrid nestabil
3' celulele ganglionilor limfatici i
mRNA hibrid stabil fenomene de anomalie exprimate n
celule cancerigene.
Figura 2.49b. Influena diferitelor poriuni de mRNA la
n 1984, K .D ani i F.Janter
stabilitatea m o lecu lei proprii. M o d ific n d p oziia (Frana) au demonstrat c mRNA
semnalului stop, se mrete sau se micoreaz zona normal la transcripia genei e relativ
codificat, ce conduce la majorarea P 1/2 mRNA, cu
creterea numrului de ribozomi fixa i (2,3). Modificnd stabil i are o perioad de njumtire
n mRNA stabil cap.3 netranslabil cu fragm entul analog egal cu 10 minute. Tot ei au stabilit
din 5, hibridul devine foarte nestabil (6) i invers, la
modificarea n mRNA nestabil (5) a segm entului 3 c n c elu lele can cerig en e ale
netranslabil cu cel din molecula stabil, durata vieii e ganglionilor limfatici mRNA e mai
prolongat (7) scurt, fr segmentul 5'-netranslabil
i, deci, au un P 1/2 mult mai mare.
b) S-a dovedit c modificrile din dimensiunule fragmentului de codificare a
mRNA deregleaz P 1/2 i influeneaz mult degradarea mRNA.
c) S-a studiat P 1/2 al mRNA la i 8 globine n celulele mduvei osoase a omului,
gene ce codific compartimentele proteice ale moleculelor din dou variante de hemo-
globin. S-a stabilit c mRNA la 8 degradeaz dc 4 ori mai rapid dect mRNA la
globin. Ele, ns, se deosebesc dup fragmentul '-netranslabil. Savanii n materie din
Cambridge (SUA) au determinat c viteza de degradaie depinde de coninutul de
adenin i uracil n acest segment. Cu ct e mai mare coninutul lor, cu att mai rapid
degradeaz mRNA.
d) Un anumit mesaj l confer i poli A. Se consider c coada poli A trebuie s fie
nlturat anterior degradrii mRNA. E posibil c nu singurul poli A, ci o protein
ligand sporete stabilitatea mRNA. Aceast protein (PABP) se racordeaz la coad
de 100 ori mai puternic dect la alte poriuni de molecula mRNA. Anume aceast pro
tein stabilizeaz mRNA, durabil protejndpoli A de invazia ribonucleazelor (fig. 2.49c).
Este elocvent i faptul c n cadrul stabilitii legturii proteina poli A influeneaz i
cclelalte segmente ale mRNA. Prin urmare, nu numai fiecare segment influeneaz
stabilitatea mRNA, ci, n unele cazuri, stabilitatea e determinat i de combinarea pro
prietilor acestor segmente, n ansamblu.
Dar care sunt mecanismele anume,
SSg mai concret va arta viitorul.
RNA
Putem, totui, afinna c:
tra n sc rip t p o lim e ra z a 1. Stabilitatea mRNA depinde i de
m RNA m atur
\w
Nucleu virui. Ei grbesc degradarea mRNA
Membrana nuclear
celulare, activnd ribonucleazele i po-
lizomii liberi, sintetizeaz proteine
virotice proprii.
2. Estrogenii mresc stabilitatea, la
fel ca i hormonul de cretere, cortizonul
etc.
3. n unele cazuri, proteina i
regleaz coninutul propriu al mRNA.
Autoreglarea de tipul dat e descris la
compartimentul sinteza histonelor
(fig.2.49d,e).
V J
Histonele libere, nelegate cu DNA,
Figura 2.49c. Ciclul vita! al mRS'A
favorizeaz scindarea mRNAhistonice,
probabil legndu-se cu fragmentul 3'-
netranslator, care se scindeaz primul.
Histonele iau parte la activarea genelor, reglarea transcripiei. Pentru iniierea tran
scripiei e necesar o interaciune direct sau indirect a proteinelor activatoare, cu o
poriune din coada histonei H4 pe TATA-bloc al DNA n promotor. Ca urmare, are loc
o disociaie menajat a octamerului histonic, prin detaarea histonelor H2A i H2B.

Gl G2 M

mRNA pentru
h isto n e
Viteza dc scindare
N ivelul m RN A pentru
relativ h isto n e
H istonele n
cito p lasm

Histona iRibonuclcaza
activ

F igura 2.49d. Ipoteza autoreglrii coninutului de histone la diferite fa ze ale ciclului celular
F igura 2.49e. Mecanismul induciei lizei mRNA propriu de tuhulin (a) i histone (b)

n consccin, TATA-bloc e disponibil pentru asocierea cu factori bazali (inclusiv i


RNA- polimeraza) i fonnarea complexului preiniial i nceputul transcripiei cu o vitez
mic.
Sunt cunoscui civa factori sus-menionai, dar mecanismul de reglare a biosintezei
proteinelor rmne a fi, n multe cazuri, neclar. Cnd savanii vor putea modifica intenio
nat stabilitatea mRNA, posibil vom stvili nmulirea celulelor anomale, vom reduce sau
complet vom suprima incidena cancerului.
n calea de la DNA la protein, controlul se poate realiza, practic, la fiecare faz. Se
remarc urmtoarele puncte de
G en e
control: una-
1) control la nivelul transcripiei
T ra n s c rip ia
timpul i caracterul transcripiei
T r a n s c r ip t
genei respective; p r im a r < v v w V- N u c le o tid e
2) co n tro l la nivelul / D egradarea
P ro c esin g u l
p ro c e sin g u lu i carac te ru l p o s tt r a n s c r ip io n a l| m P \!

procesingului al transcriptului RNA


mRNA W A / W
primar;
3) control la nivelul de trans
port selecia n nucleu a mRNA
mature, menit exportului n citozol;
4) control la nivelul translaiei
selecia n citozol a mRNA, menit
translrii n ribozomi;
5) co n tro l la n ivelul de
degradaie a mRNA stabilizarea
D eg rad area
specific a unor tipuri de mRNA n
P ro te in a a c tiv p ro te in e i
citozol.
Succesiunea proceselor n
stabilirea concentraiei de proteine,
S e c re ia i tra n sp o rtu l p ro te in e i
ct i punctele poteniale de control i
sunt redate n fig, 2.50, F igura 2.50. Punctele poteniale de control n
reglarea echilibrului proteic
c a p ito lu lu i. BIOENERGETICA
ASPECTE GENERALE
ntreaga biosfer desfoar o lupt continu pentru meninerea structurii
proprii i a funciilor inerente acestora. Pentru a exista i a supravieui, organis
mele vii se afl ntr-un schimb permanent de energie cu mediul nconjurtor.
Energia chimic a substanelor nutritive, dup transformarea ei ntr-o form
convenabil, este utilizat pentru efectuarea de travalii specifice vieii - cretere, reparaii
tisulare, activitate contractiv, osmotic. Organismele vii posed dispozitive de
transformare a energiei, deosebit de subtile i eficiente.
Care sunt legile fundamentale ce guverneaz procesele nsoite de schimbri
energetice? tiina care studiaz transformrile i utilizarea energiei se numete
bioenergetic. Obiectul ei de sidiu sunt sistemele termodinamice care constituie poriuni
din Univers, separate real sau imaginar. Ceea ce nu face parte din sistemul considerat
(restul Universului), constituie mediul nconjurtor. ntre un sistem i mediul nconjurtor
se efectueaz schimburi de energie. Ca sisteme termodinamice pot fi cercetate (n
cadrul schimbului de energie) att indivizii unei specii, celulele izolate, ct i reaciile
biochimice. Organismele vii sunt sisteme deschise, traversate de un flux de energie i
materie, adic o dat cu mediul nconjurtor se schimb att substana, ct i energia.
Termodinamica clasic studiaz sisteme nchise (nu pierd i nu ctig nimic n cazul
transformrilor ce le sufer). Legile tennodinamicii (TD) sunt deduse din dou principii
fundamentale:
1. Principiul conservrii energiei const n faptul c energia Universului este
constant. Energia nu poate fi creat i nici distrus, e posibil doar transformarea
ei dintr-o form n alta n cantiti echivalente, energia nu se pierde.
2. Principiul evoluiei stabilete posibilitatea i sensul transformrilor nsoite de
schimburi de energie. Procesele asociate de transfer de energie se desfoar de la
1 sine numai ntr-o direcie i numai pn la o anumit limit (de exemplu, cderea unui

corp; revenirea la iniial a unui arc ntins etc).


Care este factorul ce determin spontaneitatea unei transformri, de ce la
; o anumit limit procesul nceteaz?
Putem prevedea sensul i limita desfurrii libere a unui proces cu ajutorul
I entropiei (S), definit ca grad de dezordine a unui sistem. Ea reprezint micarea
dezordonat, haotic a particulelor, atomilor care alctuiesc acest sistem. Cu ct
libertatea de micare a acestor particule este mai marc, au o distribuie mai dezor
donat, cu att entropia sistemului este mai mare. Moleculele organice complexe,
proteinele, acizii nucleici sunt compui cu entropii mici. Celulele vii,
organismele pluricelulare sunt de asemenea sisteme naturale cu entropii dintre
[cele mai mici.
Principiul al doilea al termodinamicii atest c entropia Universului crete.
I Ordinea se poate transforma spontan n dezordine. ns procesul inversdiminuarea
I dezordinii nu poate avea loc dect dac sistemul absoarbe energie din mediu i
I diminueaz entropia. Ultima (S) poate fi msurat (n calorii /grad/ mol.). Modificrile
entropiei sunt greu de evaluat, de apreciat, n foarte multe cazuri. S-a definit o alt
funcie termodinamic legat de entropie, care servete drept criteriu de manifes
tare liber a proceselor energia liber.
Totalitatea factorilor (nucleul, electronii, rotaia, translaia, legturile)
determin energia intern (E) a sistemului. Energia intern a substanelor simple nu
se supune calculelor sau msurrilor. Termodinamica opereaz cu valori ale modificrilor
n cursul unor transformri pe care le suport sistemul.
Avnd n vedere c reaciile biochimice au loc n soluii apoase, n care variaiile de
volum, presiune, T sunt neglijate n cursul transformrilor, n bioenergie pot fi efectuate
diferite simplificri ale modului de evaluare a schimbrilor energetice i sensului n
care transformarea poate decurge liber, spontan. n reaciile biochimice efectuate n
condiiile sus-numite, modificrile energetice sunt datorate exclusiv unor transformri
intrinseci ale sistemului: formare sau desfacere de legturi covalente, transfer de electroni,
schimb de protoni, interaciuni hidrofobe, formare de asociaii intermoleculare etc.
Dac n starea iniial sistemul a avut o valoare energetic egal cu E i n final cu
E,, apoi diferena E, - B] = indic variaia energiei interne a sistemului, modificrile
energetice totale ce nsoesc acest proces. Dac AE este negativ, sistemul are energie
intern, n final, mai mic. Dac AE are valoare pozitiv, sistemul capteaz energie din
mediu, n decursul transformrilor.
O poriune din energia intern depinde de entropie i atest produsul ei (S) i
temperatura absolut (ST), aceasta fiind componenta energetic ce nu poate fi
transformat n travaliu, n lucru util (la T constant). Un anumit lucru nseamn o
micare ordonat, iar factorul TS este o energie de calitate inferioar, o energie degradat
a sistemului. Componenta energiei sistemului, convertibil n lucrul util (la T
constant) poart denumirea de energie liber (G). E = G + TS. Rezult c
variaia energiei interne () ntr-o reacie este determinat de variaiile energiei sale
libere (AG) i de variaiile entropiei (AS):
AE = AG + TAS.
Reaciile au loc spontan, cnd entropia sistemului n stare final este mai mare, respectiv
energia sa liber scade. Oricc reacie chimic sau proces are loc n sensul n care
energia liber a sistemului diminueaz capacitatea sa de a efectua travaliul. Fora
motrice a reaciilor este tendina sistemului att de a-i spori gradul de dezordine, ct i
de a-i reduce coninutul de energie liber, ordonat.
Energia liber a unui compus depinde de cantitatea de substan, ceea ce
constituie o valoare extensiv. Energia a 2 molccule este de 2 ori mai mare dect a unei
singure molecule. Energia liber este o mrime aditiv: Gs = Ga + Gb+ Gc.
Variaia energiei libere ntr-o reacie n care un mol reactant s-a transformat
ntr-un mol rezultant fiecare n stare standard poart denumirea de energie
liber de reacia standard i se noteaz cu AGn. Ea se calculeaz confonn formulei:
(1) AG= -2,303 X R X T X lg K; = -1,36 X IgK
(R - constanta gazului = 1,987 cal/mol, T = 298K).
Dac: l ) K e q = l , atunci A G = 0;
2) Keq > 1, AG este negativ;
3 )K e q < l, AG este o valoare pozitiv.
Keq = IO'1, AG = 1,36; Keq =10, A G = -1,36.
Spre exemplu: n amestecul echilibrat G -l-P ===== G-6-P concentraiile sunt egale
respectiv, cu Keq, = 0,001(lm M )i K eq,= 0,019 (19 mM).
0,019
Keq = --------- = 1 9 ; lg 19 =1,28.
0,001
AG = -1,36 X 1,28 = - 1,74 kcal/mol.
n concluzie, transformrile G -1-P n G-6-P la conccntraii iniiale de 1,0 mol decurg
cu pierderea energiei libere.
Formula precedent (1) ne permite s determinm constanta reaciilor n condiii
standard (2):
lg K e q = 10'AGo/(2'303RT) = 10'AGo/1*36. Dac AG=- 1,36 kcal/mol, apoi Keq=10.
Aadar, energia liber standard i constanta de echilibru a reaciei sunt legate printr-
o formul simpl. Corelaiile dintre constanta de echilibru i valorile modificrilor energiei
libere standard ale reaciilor chimice la T = 25C sunt redate n tabelul de mai jos:

Keq AG, kcal/mol Keq AG, kcaFmol


10'5 6,82 10 -1,36
IO'4 5,46 IO2 -2,73
io-3 4,09 103 -4,09
io-2 2,73 IO4 -5,46
io-1 1,36 105 -6,82
1 0
Valorile modificrilor energiei libere standard caracteristice unor reacii chimice sunt
urmtoarele:
ATP + H20 ADP + Fosfat AG =: -7,3 kcal/mol
Glucozo-6-fosfat + PI20 - Glucoza + Fosfat A G : : -3,3 kcal/mol
Maltoza + H20 - 2Glucoz A G : : -3,7 kcal/mol
Lactoza + H ,0 - Glucoz + Galactoz A G : : -3,8 kcal/mol
Glucozo-1 -fosfat - Glucozo-6-fosfat A G : -1,74 kcal/mol
Fnictozo-6-fosfat Glucozo-6-fosfat A G: -0,40 kcal/mol
Malat Fumarat + H ,0 A G: +0,75kcal/mol
Glucoz + 6 0 , 6C O ,+ 6H70 A G : ; -686 kcal/mol
Acid palmitic + 230., 16C02+ 1 6 H 20 A G0= -2338kcal/mol

Studiind biochimia, ar trebui s rezolvm dou probleme principale: 1) n ce


mod celula recepioneaz energia i capacitatea reductoare din mediul ambiant i 2)
Cum celulele sintetizeaz blocurile de construciebaza macromoleculelor?
n general, aceste procese au loc datorit prezenei unor sisteme superintegrate de
reacii chimice denumite metabolism.
METABOLISMUL
Metabolismul este o activitate celular concordat, determinat de participarea
multor sisteme multienzimatice strns legate ntre clc.
Care sunt funciile metabolismului?
1. Aprovizionarea cu energie chimic, carc se formeaz la scindarea substanelor
nutritive bogate n energie sau ca urmare a transformrii energiei radiaiei solare.
2. Transformarea moleculelor substanelor nutritive n blocuri de construcie necesare
pentru sinteza macromoleculelor.
3. Asamblarea proteinelor, acizilor nucleici, polizaharidelor, lipidelor i a altor
componeni celulari din aceste blocuri.
4. Sinteza i catabolismul biomoleculelor necesare pentru activitatea specific a
diferitelor celule.
Un organism simplu ca E.coli produce cel puin o mie de reacii chimice diferite.
Sistematizarea lor la prima vedere pare imposibil, dar la o analiz mai profund se
dovedete a fi mult mai simpl metabolismul reprezint un sistem coordonat cu
motivaii comune. Numrul de reacii n metabolism e mare, dar numrul de tipuri
de reacii e relativ mic.
Rolul primordial n toate formele vieii i aparine unui grup de molecule, num
rul total al crora nu depete 100. De remarcat c exist mecanisme comune ale
reaciilor cilor metabolice. Cu alte cuvinte, cile metabolice centrale sunt reduse i
identice aproape la toate vieuitoarele.
In procesul metabolismului o parte din energia captat se pierde, iar cantitatea
energiei neutilizate crete. Cldura i alte fonne de energie se eman n mediul
exterior, trec ntr-o fonn nesistematizat i inutil pentru organismele vii. Torentul
de energie n biosfer e un proces direcionat, neciclic, cheltuindu-se o energie
anumit pentru activitatea n cile metabolice, deoarece energia utilizabil nu poate
fi regenerat din cea inaccesibil, disipat. i dac elementele C, O, au rotaiile lor,
sunt antrenate n cicluri noi, atunci energia util degradeaz ncontinuu, se transform n
una inutil.
Fiecare tip de celule se caracterizeaz printr-o solicitare specific de sursele
O,, N, C, ct i de surse corespunztoare de energie. Metabolismul celular e un sistem
de modificri fennentative ale substanelor i energiei provenite din produsele iniiale
i pn la biosinteza materiei vii. Produsele intermediare a cilor metabolice sunt
numite m e ta b o lii.
La diferite etape au loc modificri chimice neeseniale adiia, deleia, transferul
atomilor, moleculelor, grupelor funcionale. n urma acestor modificri reglementate pe
etape, molecula iniial se transfonn n metabolitul rezultant. Unele ci metabolice
se expun liniar, altele ciclic.
De obicei, cile metabolice au diferite ramificri, de unde circul produsele
reaciilor. ntr-un sens mai ngust, prin metabolism se subneleg transformrile
substanelor n celul de la momentul iniial pn la formarea produselor finale.
Evideniem dou faze ale metabolismului catabolism i anabolism.
Catabolismul constituie faza degradrii compuilor preluai din exterior, a propriilor
constitueni ca rezerve la compui simpli. Procesele catabolice sunt nsoite de
degajarea energiei libere, ncadrat n structura complex a substanelor organice. La
o anumit etap a proccsului energia liber se acumuleaz pe durat scurt graie
reaciilor fermentative cuplate n form macrocrgic ATP. Poate fi acumulat i n
intermediari (o parte) bogai n energieatomii de hidrogen ai coenzimei NADP n stare
redus NADPH.
Anabolism ul sau biosinteza este faza procesului de sintez a diverilor com
pui organici (proteine, acizi nucleici i alte blocuri macromoleculare) constituii
din mici blocuri de construcie. Procesul necesit utilizarea energiei libere. Drept
surs servete scindarea ATP. Biosinteza solicit i atomi de H, donatori fiind NADPH.
Catabolismul i anabolismul decurg simultan n celule, ns viteza lor se reglea
z independent. Hans Krebs a descris trei etape de generare a energiei laoxidarea
substanelor nutritive. Aceste ci catabolice joncioneaz, converg, dnd natere
unui numr redus de metabolii.
Etapele catabolismului aerob sunt urmtoarele:
a) Macromoleculele alimentelor se scindeaz n componente mici: proteinele n 20
aminoacizi, polizaharidele n hexoze i pentoze, lipidelen acizi grai i glicerin.
La aceast etap nu are Ioc eliminarea energiei biologice utile.
b) n faza a doua, din moleculele primei faze (numeroase) se formeaz cteva
componente simple, ce joac un rol primordial n structura metabolismului, i anume
pimvatul un compus intermediar, ce se transform n component acil al acetil-
coenzimeiA, ultimul ncheind etapa a doua.
c) n etapa a treia, graie ciclului acizilor tricarbonici i fosforilrii oxidative, ce
finalizeaz cile de oxidare a moleculelor nutritive, se formeaz FLO, CO,, NFL
(sau alte substane azotoase). Generarea energiei arc loc, mai cu seam, la aceast
etap. Cile catabolice, n fine, fuzioneaz fenomenul de convergen.
Anabolismul decurge la fel n trei etape, ncepnd cu moleculele mici de
precursori. Spre deosebire dc catabolism, cile metabolice la anabolism se ramific
(fenomen de divergen). Dintr-un numr mic dc precursori se formeaz, n final,
un complex de macromolecule de structur vast.
Cile centrale conin multe ramificri, facilitnd astfel sintetizarea a sute de com
ponente, reaciile biochimice fiind catalizate de sisteme multienzimatice. Succcsiu-
nea modificrilor chimice n aceste ci este n principiu identic la toate
organismele vii. De exemplu, scindarea glucozci decurge n acelai mod la toate
organismele.
Coincide oare direcia cilor catabolice i celor anabolice?
Datele confmn c ea nu este identic. Or, acest factor e favorabil celulei?
Exist cauze serioase ce determin necoincidcna cilor metabolice:
1. Calea de scindare a biomoleculei poate Ii incompatibil cu cea de biosintez
din considerente energetice (e clar, dac procedm n analogie cu cderea unei
pietre dc pe munte i intenia de a o urca n vrful lui). Calea de biosintez necesit
energie suplimentara, cheltuicli enonne.
2. Neidentitatea const i n faptul c succesiunea reaciilor trebuie reglat separat.
Dac ar exista aceeai cale, ar avea loc o simpl inversare a succesiunilor de reacii.
Inhibarea catabolismului ar conduce i la inhibarea proceselor anabolice. Pentru ca
sinteza i scindarea unei molecule s fie reglate independent, aceste ci trebuie s
fie diferite. Dac, ns, posed faze fermentative comune, apoi viteza procesului
este reglat de acele enzime care n cadrul succesiunii reaciilor cilor contrare nu
particip.
3. Este exclus identitatea i din motivul c difer (cele antidirecionale) i dup
localizare (catabolismul acizilor grai are loc n mitocondriibiosinteza lor n citozol.
n aceste structuri este situat un complet de enzime specifice).
Nefiind identice, cile menionate sunt legate prin etapa a III-a ce include ciclul
acizilor tricarboxilici i fosforilarea oxidativ. Aceast etap e numit J'aza
amfibolic a metabolismului, ndeplinind un rol bifuncional. Catabolismul finalizeaz
cu scindarea i formarea moleculelor relativ mici; anabolismul furnizeaz molecule
miciprecursorii biosintezei.
Ciclul ATP. Reaciile metabolice sunt indispensabile, constituind o reea de reacii
fermentative corelate necesitilor urgente ale celulei; decurg foarte econom, cu
minimum consum energetic. n procesul de oxidare se elimin o cantitate enorm de
energie nevalorificat, utilizat ulterior pentru ndeplinirea unui lucru la T i P constante.
Ea se fixeaz i se conserveaz. Energia termic e necesar pentru meninerea T
constante a corpului. Sistemul universal de transfer al energiei n toate celulele vii este
ATP - ADP i P. O mare parte a energiei libere se pstreaz n baza sintezei cuplate a
ATP din ADP i P..
Energia chimic ncorporat n ATP este utilizat drept:
1. Surs dc energic n micare, contracie i transfer de ingredieni prin membra
ne contra gradientului de concentraie etc.
2. Surs de energie n biosintez. Sub aciunea enzimelor respective fosforul (P)
terminal este transferat moleculelor mici, activndu-le i folosindu-le ulterior la asamblarea
macromoleculeior.
3. Mobilizator al mecanismelor fine ce determin transmiterea informaiei genetice.
n reaciile cuplate cu utilizarea energiei celulare ADP se ncarc. ATP joac
rolul de expeditor al energiei i cupleaz procesele active, cu eliminarea i utilizarea
energiei.
NH2

HOp o PO Po 0
OH OH OH

ATP OH OH
Fiind depistat ATP n extractul din muchii scheletali, n 1929, de ctre
K.Lohmann (Germania) i C.Fiske, i J.Subbarow (SUA), abia n 1941, Fritz Lip-
mann a naintat conceptul care prevedea existena n celul a ATP - ciclului, n care
ATP joac principalul i universalul rol de remitor al energiei chimice. Prezena ATP,
ADP, AMP este determinat la toate vietile i ndeplinesc aceleai funcii. Se conin
n toate compartimentele celulei, cota ATP fiind 80% din coninutul total.
La hidroliza ATP, n condiii standard, se elimin energie:
ATP + HOH ADP + P. + H+ + 7,6 kcal/mol
ATP + HOH AMP. + pp. + H- + 7,6 kcal/mol
; + ===== 2P. + H++ 6,9kcal/mol (dup alte date (-7,3-8,0)kcal/mol)
ATP + 2HOH AMP + 2. + 1-+ 14,6 kcal/mol
Energia liber constituie diferena dintre energia liber a substanelor iniiale i
cea a produselor rezultante n condiii standard (T = 298K, P = 1atm., concentraie
= 1,0 mol, pH = 7,0). Se noteaz prin AG n cal/mol sau J (joule);
leal = 4,184 J i se calculeaz conform ecuaiei descrise mai sus.
ATP este principalul donator al energiei libere n sistemele biologice, ceea ce nu
egaleaz cu forma de rezerv a energiei. n celul molecula de ATP se utilizeaz timp de
un minut dup sinteza sa. Omul n repaus utilizeaz n 24 ore circa 40 kg de ATP; la
exerciii intensive viteza utilizrii de ATP ajunge la 0,5 kg/min. Turaia ATP e foarte
mare.
Unele reacii biosintetice sunt iniiate de ctre alte nucleotide, n care GTP, UTP, CTP
servesc drept tumizori de energie.
La hidroliza unor compui fosforilai se elimin mai mult energie liber dect la
scindarea n condiii standard a ATPului:
fosfoenolpiruvatul -14,8 kcal/mol
carbamoilfosfatul -12,3 kcal/mol
3-fosfogliceroilfosfatul -11,8 kcal/mol
creatinfosfatul -10,3 kcal/mol
acilfosfatul - 10,3 kcal/mol
ATP, ADP ocup o poziie intennediar, care are o importan primordial pentru
funciile lor biologice - 7,6 kcal/mol.
AM P - 3,4 kcal/mol
G -l-P - 5,0 kcal/mol
G-6-P - 3,3 kcal/mol
F-6-P - 3,8 kcal/mol
GA-3-P -2,2-kcal/mol
Ocupnd acest loc n scara termodinamic, ATP servete la remiterea grupelor fosfat
de la substanele supermacroergice la acceptorii de fosfat, compuii crora se
caracterizeaz prin valori mici dcAG0 la hidroliz. n procesele de catabolism se
_ formeaz substane supermacroergice (X - P). Cu ajutorul enzimelor specifice din gmpa
kinazelor grupa fosfat este transferat la ADP, cu formarea ATP.

I
X - P + ADP - - ^ X + ATP

- 177-
La etapa a doua, o alt kinaz specific transfer P terminal din ATP pe molecula
acceptomlui de fosfat (Y), mrind energia lui.
ATP + Y *. ADP + Y -P.
ATP ndeplinete funcia de remitor al energiei chimice, deoarece celula nu conine
kinaze specifice, ce ar transfera grupa fosfat de la substanele supermacroergice la
acceptori.
Ce particulariti determin molecula de ATP, la hidroliza fosfatului terminal,
s elimine energie?
Efectul e determinat de trei factori structurali:
1) gradul de disociaie a ATP i a produselor hidrolizei la pH = 7,0
ATP4' + HOH ^ ADP3' + ,2" 4
+ 1
ionii de hidrogen deplaseaz reacia de hidroliz spre dreapta;
2) repulsia electrostatic: cele 4 sarcini negative sunt situate foarte aproape n spaiu
la hidroliza ATP tensiunea intramolecular scade, produsele reaciei posed sarcin
negativ, se resping reciproc i nu pot forma molecula de ATP;
3) gradul de stabilitate, cu rezonana mai mare a ADP +P. dect pentru ATP; primele
au forme structurale mult mai stabile. Stabilitatea e determinat de faptul c o parte
din electroni sunt dispui n configuraii cu energie mult mai mic dect n configuraiile
caracteristice pentru ATP. Cu alte cuvinte, electronii n ADP i P. se situeaz la niveluri
energetice mai joase i conduc la micorarea rezervei de energie liber;
4) prezena ionilor de Mg++afinitatea ADP de Mg2+, este de 6 ori mai mare dect
a ATP, reacia de hidroliz este mpins spre fonnarea ADP i P..
Energia nu se afl n legtur macroergic i contrar se utilizeaz pentru scindarea ei.
La hidroliza esterilor acidului fosforic energia este condiionat nu de ruperea legturii,
dar de reducerea energiei din produsele iniiale. Sistemul dc generare a ATP n cclul
menine raportul ATP/ADP x P. la nivel nait-circa 500. Hidroliza unei molecule de ATP
deplaseaz raportul concentraiei produselor la concentraia substanelor iniiale n
reaciile cuplate = 10s ori. Succesiunea de reacii imposibile, din punct de vedere
tennodinamic, devine posibil, se realizeaz prin cuplarea hidrolizei unui numr mare de
molecule de ATP.
De exemplu: AG transformrii substanei A n este egal cu 4 kcal/mol.
Astfel de transformare devine imposibil far surplus de energie. Fiind
Keq = 10'^ G'1,36, obinem egal cu 1,15 x 10"3, adic, dac relaia molar e egal
sau mai maredect 1,15 x IO'3, substana A nu poate fispontan transformat n B.
Acest lucru va fi posibil numai dac reacia se va cupla cu hidroliza ATP.
A + ATP + H20 + ADP + P. + H
AG - -7,3 + 4 = - 3,3 kcal
Keq = 10'3-3/!36 = 2,67 x 10"2
[B] [ADP] [P ]
Keq = X---------------- -- 2,67 X IO'2
[A] [ATP]
[] [ATP]
= K eq -------------= (2,67 x IO2 ) x 500 = 1,34 x IO5.
[A] [ADP][P. ]
Aceasta nseamn c hidroliza ATP asigur posibilitatea transformrii A *-
atta timp, ct raportul B/A va atinge valoarea 1,34 x 105. Fr ATP, valoarea e egal cu
1,15 X 10 3; hidroliza ATP modific raportul B/A aproximativ de 108ori.
La utilizarea a dou grupe fosfat se formeaz AMP, care se rentoarce n ciclu sub
aciunea unei enzime prezente n toate esuturile - adenilatkinaza.
M g2+
ATP + AMP ^ ADP + ADP
Enzim are i funcia de a menine ATP n celule, cnd reacia catalizat va decurge
n direcie invers.
Metabolismul celular e bazat p e o economie maxim. Viteza metabolismului e
determinat de necesitile n ATP i NADPH. Celula utilizeaz la moment acea cantitate
de substane nutritive, care-i permite satisfacerea necesitilor energetice, precum i
viteza de sintez a blocurilor de construcie i macromoleculelor celulare.
Substanele din multe organisme i plante nutritive trec n rezerv i servesc drept surse
de energie i de carbon (glucidele, lipidele), cu excepia proteinelor i acizilor
nucleici.
Procesele catabolice sunt foarte sensibile i reacioneaz fin la modificrile i
necesitile energetice ale celulei. La musca domestic, bunoar, utilizarea 0 2 i a
surselor celulare n timpul zborului n decurs de 1 sec. crete de 100 ori.
M ECANISM ELE DE REGLARE ALE METABOLISMULUI
Mecanismul cardinal este indispensabil de efectul enzimelor alosterice. In calitate
de inhibitor servete ATP, iar de modulator pozitiv ADP i AMP. Pot participa i alte
rezultante finale sau intermediare ale altor ci metabolice.
Multe reacii sunt reglate de starea energetic a celulei. Indicatorul ei e sarcina
energetic care se detennin: (ATP conine dou legturi anhidrice, ADPuna):
Viteza
s _ 1 + 1/21ADP1
C [ATP]+[ADP]+[AMP]

Valoarea oscileaz de la 0 (n sistem numai


AMP) la i (numai ATP). Daniel Atkinson a
demonstrat c toate cile metabolice, res
ponsabile de sinteza ATP, sunt inhibate de sar
cina energetic nalt, pe cnd cile de utilizare
ale ATP sunt simultan stimulate (fig.3.1).
Reglarea menine sarcina energetic ca i pH-
ul celulei n oscilaii limitate (0,80-0,95).
Un indice reglator al metabolismului celular Sarcina energetic
e potenialul fosforilrii - PF. El e depen- Figura ' Reglarea metabolismu,ui
dent de fosforul compartimentai i e direct de
pendent de energia liber degajat la scindarea ATP:
[ATP]
PF = ----------------- = 500.
[ADP] X [P.]

Mccanismclc ce regleaz metabolismul sunt dependente de homionii care accele


reaz activitatea enzimelor (adaptare imediat) sau de viteza sintezei enzimelor (adaptare
de lung durat), respectiv, adrenalina i steroizii.
Sunt mecanisme legate de modificrile concentraiei enzimelor n celul, detenninat
de relaiile sintez-scindare. Inducia enzimatic condiionat de concentraia substanelor
particip activ la reglarea metabolic (vezi cap. I).
Distingem i metabolism secundar, care i are funcia sa aparte la formarea
substanelor specifice necesare celulei n cantiti mult mai micicoenzime, hormoni.
Sute de biomolecule absolut specifice se produc n aceste ci metabolice, studiate
insuficient pn n prezent.
Toate animalele i celulele plantelor, n condiii normale, sunt aerobe i combustibilul
lor organic i-l oxideaz complet pn la , i I f O-Energia biologic liber accesibil
este eliminat din substane organice numai n cazul n care toi atomii de hidrogen,
legai de atomii de carbon din molecul, vor fi substituii de oxigen, formnd ,.
Cantitatea de energie liber, ce se elimin la arderea total a oricrei substane
organice, e aproximativ proporional cu raportul dintre numrul de atomi de hidrogen
legai de carbon i numrul total al atomilor de carbon: CH4(4); CH.011(3); CHOH( 1);
CH20(2); CO,(0).
DECARBOXILAREA OXIDATIV A PIRUVATULUI
Procesul de respiraie studiat n biochimie se refer la mecanismele moleculare de
utilizare a O, i formarea , n celule. Unul din produsele principale ale procesului de
catabolism este piruvatul (la scindarea glucozei, n primul rnd). Dup transformarea
sa n acetil-CoA, va fi utilizat n ciclul acizilor tricarboxilici (ciclul Krebs sau ciclul
acidului citric) etap final de oxidare a moleculelor substanelor nutritive.
n ce const procesul de oxidare a piruvatului n acetil-CoA ?
Cum se scindeaz alte molecule pn la fonnarea acetil-CoA se va studia n alte teme.
Piruvatul se oxideaz pn la acetil-CoA i C 0 2, cu participarea mai multor enzime
unite structural n complexulpimvat-dehidrogenazic. Sistemul multienzimatic n cadrul
eucariotelor se afl n mitocondrii, al procariotelorn citozol, cataliznd urmtoarea
reacie sumar:

CH3 CH3
I
COOH + NAD++ CoA-SH C~SCoA+ H+ + NADH + ,
II II
O o
(-8 kcal/mol)

n procesul comun de dchidrogenare i decarboxilare a piruvatului se includ


diferite enzime: E^piruvat-dehidrogenaz, E,-dihidrolipoil-transacetilaza i E3-
dihidrolipoil-dehidrogenaza, K-E, kinaza specific, F-fosfo-E, fosfataza, X-proteina
ligand n Er
Particip, de altfel, i 5 coenzimeTPP - tiaminpirofosfatul (E,), FAD, NAD+, CoA-
SH (E3), acidul lipoic(E2). Cu alte cuvinte, pentm funcionarea acestui sistem multienzimatic
sunt necesare 4 vitamine , B PP, acidul pantotenic i acidul lipoic.
Lister Rid, savant de la Universitatea din Texas, a cercetat minuios acest complex
la E.coli, stabilind c e compus din 48 de lanuri polipeptidice, neesenial depind
mrimea unui ribozom. Nucleul l ocup E2(transacetilaza), E si E3se leag n exterior
de nucleu. Lanurile polipeptidice sunt consolidate de fore necovalente. La pH alcalin
sau neutru, n prezena ureei, complexul disociaz n componentele sale. Complexul
nativ enzimatic se formeaz prin autoasamblarc.
Fiind un complex multienzimatic, actualmente se confinn c n centru (nucleu) se
afl componenta E2alctuit din a , monomeri aranjai la suprafaa lui; n anumite
proporii E, ( - tetramer), E3(,- homodimer), (oc2, - heterodimer) i F (a
-heterodimer). Proteina X ( -monomer) are o aranjare nestabil la moment posibil
ocup o poziie integral n autoasamblarea complexului sau se ataeaz periferic dup
asamblare. Dealtfel, recent s-a constatat, c la un complex structural stabil revin 60
componente E 20-30 molecule E,, 6 molecule Ev 12 molecule proteina X, 3-15
molecule i mai mult de 3 molecule de fosfataz (F). Proteina X un component
lipoil auxiliar, ce particip la transferul electronilor.
Complexul determin o cataliz coordonat, n care produsele intermediare sunt
fixate rigid de el, iar formarea produselor auxiliare fiind redus la minim. Ea accelereaz
viteza reaciei, exclude hazardul coleziunii substanelor cu enzimele respective potenial
existente n stare liber. Produsele intermediare se permut de pe un centrul activ (CA)
pe altul - de grupe prostetice E, (grupa lipoamidic). Acidul lipoic se ataeaz de grupa
aminic a restului de lizin din ,. n fiecare lan polipeptidic, la 2 resturi de acid lipoic se
ataeaz 2 resturi de lizin, ce realizeaz un bra flexibil de aproximativ 14 . Acest bra
efectueaz o micare tur-retur ntre grupele prostetice ale sistemului multienzimatic.

.C H , O NH
/ \ = I
H2C CH H2 (CH2)2 H2 C i- N CH2 (CH2)3 CH
oxidat !
t
Acidul lipoic Lizina
I
.C H , ! I NH
,/ \ II I I
H2C CHCH2(CH2)2C H ^ G r N CH2 (CH2)3 CH
\-i-S redus i 0
(H ): (H) .. V

Componenii lipoamidici interacioneaz. Sarcina lor n procesul de modificri n ciclu


se schimb de la 0-1 pn la 2, la o ionizare complet a grupelor sulfhidrilice. Anume
modificrile de sarcin reprezint fora motrice a micrii coordonate a gmpei lipoice.
Procesul decurge pe etape. n etapa I piruvatul adiioneaz la TPP, dup care are loc
decarboxilarea lui. Este catalizat reacia de E , rolul hotrtor revenind particularitilor
TPP exponentul acid al atomului aranjat, ionizeaz ntre atomii N i S ai inelului
tiazolic, el formnd un carbanion, uor adiionnd la grupa carbonil a piruvatului.

H
NH, I
c s
n ^ y ~ c h 2- n ' 0 ?
u r _U C=cCH2 CH2 O P O P 0
3 ^ N ^ ! II II
TPP CH, o o

Azotul cu sarcina pozitiv (+) adiioneaz electroni, stabiliznd constituirea sarcinii


negative necesar decarboxilrii. Protonarea fonneaz hidroxietiltiamino pirofosfatul.
ir
V
<V *
cn S N - c
H O -C -^-C
S -C I
CH3
4 S\
a CO-,
Ri Ri
Piruvat C arbanion - TPP Produs interm ediar

R CH3 R ch R CH3
U I 3

H N -C
N -C N -C
- c c
I

\
I
CH3
s-c 1
CH3
s-c ++ I
CH3
\ s_ c
I I I

Ri R, Ri
Form e rezonante Hidroxietil - TPP

In etapa unntoare grapa hidroxietilic legat de TPP se oxideaz o dat cu fonnarea


acetil radical i simultan se permut pe lipoamid. Ca oxidant servete grupa disulfidic,
care se transform n sulfhidrilic. Reacia e catalizat de E2(dihidrolipoiltransacetilaz)
cu formarea acetillipoamidei.

R CH3 CH3 R CH3


I U !
c H 2- s ?H N CH2 S ~ C = 0 N -C
/
H2C + -c-c ^ II H2C
+ C\
\
C H -S CH3
S-c C II SH S-c
r2 R, r2 R,
Lipoamid H idroxietil - TPP A cetillipoam id Carbanion - TPP
(forma ionizat)

La etapa a III-a grupa acetil se translocheaz pe CoA, formnd acetil-CoA. Procesul


Ie catalizat similar de E2, translocarea fiind nsoit de meninerea legturii macroergice
oesterice.
r2
Acetillipoamid Dihidrolipoarnid Acetil-CoA

n etapa a IV-a are loc regenerarea formei oxidate a lipoamidei. Reacia e catalizat
de E3 Oxidantul e NADf, i rolul prostetic i revine FAD.

C H .-S H /C H -S
/
H2C H2C
2 \ CH s
CH SH
I I
r2 r2
Dihidrolipoarnid Lipoatnid

Procesul e ireversibil, avnd =-8 kcal/mol. Etapa descris este cheia ireversibil
a metabolismului. Animalele nu sunt capabilc s transforme acetil-CoA n glucoz.
Acetil-CoA se ncadreaz n ciclul Krebs sau n sinteza lipidelor. Reaciile pot fi reproduse
schematic n felul unntor:

FA D H 2 FAD

NAD+ NADH+ H +

Complexul fermentativ descris mai sus se regleaz prin:


1. Inhibarea prin rezultantele reaciei (retroinhibiie) de acetil-CoA, NADHprimul
compus inhibnd E?, NADH-E.. Efectul este reversibil la aciunea NAD+i FISCoA.
Inhibiia alosteric este amplificat de acizii grai macromoleculari.
2. Reglarea nucleotidic, prin sarcina energetic. Este inhibat complexul de GTP i
activat de AMP. Activitatea complexului se reduce atunci cnd celula conine energic
accesibil i se amplific, n caz contrar.
3. Complexul piruvat dehidrogenazic (CPDH) i pierde din activism la fosforilarea
serinei de ATP (modulator pozitiv pentru kinaza piruvat dehidrogenazei) o dat cu
fonnarea fosfopiruvat dehidrogenazei (reglarea covalent). Dac ATP se micorea
z, are loc scindarea hidrolitic a fosfatului de CPDH. Reacia este catalizat de
fosfataza piruvat dehidrogenazei. Att kinaza, ct i fosfataza persist n complexul
piruvat dehidrogenazic.

c h 2- o - po 23
Complexul PDH Complexul PDH
activ inactiv
c h 2- o - po 23

Acetil-CoA, NADH
CoA, NAD, piruvat

Reglarea covalent a complexului piruvat dehidrogenazic

Fosforilarea se amplific la raportul nalt dc ATP/ADP; acetil-SCoA/HSCoA;


NADH/NAD+, iar defosforilareala concentraii nalte de piruvat i ioni de Ca2+.

CICLUL KREBS
Reprezint un ciclu primordial pentru funcionarea sistemelor vii. Sistemul enzimatic
acioneaz cu o finee deosebit. Ciclul ncepe cu retrocedarea de ctre acetil-CoA
oxaloacetatului grupei acetil, cu formarea compusului de 6 atomi de carbon - citrat.
Prima reacie este catalizat de citrat sintaz ferment reglator. Produsul interme
diar l constituie citril-CoA. Reacia sumar deviaz spre dreapta (AG = -7,7 kcal/
mol), rezultant a hidrolizei.

H2C C O O ' CH2 C O O '


I I
- C O O ' + H3C ~ SCoA + H20 - H O - C - C O O ' +H S-C 0 A +H +
II II I
O o CH2- C O O
Oxaloacetat Acetil-CoA Citrat

Enzima, aconitaza, catalizeaz transformarea reversibil a cifratului n izocitrat prin


formarea produsului intermediar cis-aconitat, ce nu deviaz de la centrul activ al enzimei.
Izomerizarea se realizeaz prin dehidratare, succedat de hidratare. Coninutul izocitratului
e mai mic de 10%,reacia evolueaz de la stnga spre dreapta, i produsul ei se ncadreaz
rapid, succesiv, n celelalte stadii ale ciclului. Aconitaza reprezint o enzim compus, ce
conine fier i sulf acidolabil, formnd centre fiero-sulf.
2- ' 20 CH COO* 2 0 00 C H -H
H O -C -C O O ' X " i 'O O C - C - H
I E2 I I
CH2C O O ' CH2CO O ' 2coo
Citrat cis-aconitat IzDcitrat

Decarboxilarea oxidativ a izocitratului, catalizat de izocitrat dehidrogenaz-


(ICDH), este prima reacie de oxido-reducere din ciclu, cu formarea ulterioar a a-
cetoglutaratului.

OH O
I + II
O O C -C H N A D +(P) NAyDH^ +H o o c - c
I . I
o o c CH " ------------------ o o c CH
I I
CH2CO O ' CH2COO CH2 c o o
Izocitrat O xalosuccinat a-ceto g lu tarat

ICDHeste o enzim de dou tipuri NAD+ i NADP+ dependent: NAD+d


localizat n mitocondrii;NADP+d localizat att n mitocondrii, ct i n citozol.
Modulator pozitiv al reaciei este ADP, enzim practic nu funcioneaz fr ADP;
reacia necesit ioni de Mg2+sau Mn2+.
A doua reacie de oxido-reducere (a patra n ciclu) este decarboxilarea oxidativ a
a-cetoglutaratului, catalizat de complexul a-cetoglutarat dehidrogenazic cu forma
rea succinil-CoA i a C 0 2, NADH+H+. Mecanismul acestei reacii e asemntor cu
transformarea piruvatului n acetil-CoA. Sunt utilizai aceiai cofactori ai trei enzime: a-
cetoglutarat dehidrogenaza, (A'), transsuccinilaza (B') i (C') dihidrolipoil
dehidrogenaza. Miezul complexului e subunitatea B', iar subunitatea este identic
pentru ambele complexe. Aceste dou complexe reprezint asociaii omoloage de enzime.
CH2- C H 2- C - C O O H HSCoA C02 CH2- C H 2- C ~ S C o A
I II V I II
COOH O ---- - COOH o
a-ceto g lu tarat NAD+ NADH+ H + Succinil-CoA

Hidroliza succinil-CoA d aproximativ 8 kcal/mol. Scindarea e cuplat cu fosforilarea


GDP, catalizat de succinil-CoA sintetaza i formarea GTP.

CH2- C H 2- C ~ SCoA + GDP + Pi CH2- C H 2 + GTP + HSCoA


I II I . I .
COOH o coo coo
Succinil-CoA Succinat
Enzima nucleozidfosfo kinaza transfer grupa fosfat de Ia GTP la ADP cu fonnarea
ATP. Ea este unica reacie a ciclului, fiind nsoit de formarea direct a compuilor
macrocrgici fosfai. E ofosforilare la nivel de substrat drept izvor de energie servete
oxidarea unei substane organice.
GTP + ADP ATP + GDP
Succinatul este dehidrogenat, cu fonnarea lumaratuluireacie catalizat de succinat
dehidrogenaza (SDH), avnd ca acceptor H,-FAD. n molecula de SDH inelul
izoaloxazinic a FAD-ului e legat covalent de partea proteic cu restul histidinei din centrul
activ (CA) al enzimei. Molecula conine 4 atomi de fier i 4 atomi de sulf, formnd proteine
ficro-sulf.

FAD FA D H 2 H
OOC CHo C O O ' 'oocc=cCOO'
Succinat
I
Fumarat H

SDH conine dou componente:


1. 70 FAD kDa i dou clastere de FSP (proteine fiero-sulf);
2.27 kDa claster proteic.
Enzima SDH este o protein integral a membranei interne din mitocondrii, iar
inhibitor concurent al SDH este malonatul. FADH, format nu se desprinde de enzim,
electronii sunt direct transferai pe Fe3+al enzimei. Acceptor fmal poate servi 0 2
molecular.
Urmtoarea reacie const n hidratarea fiimaratului cu formarea L-malatului catalizat
de enzima stereospecific fumaraza (are loc o transadiionare de H i OH). Enzima e
compus din 4 subuniti identice (4LPP).
H H 20
OH H
oocCCCOO. x. b. - 'ooccccoo
H H H
Fumarat
L m alat

L-malat dehidrogenaza, componenta matricei mitocondriale, catalizeaz dehidroge-


narea L-malatului (NAD+), cu fonnarea oxaloacetatului (OA). Echilibml e deplasat (la pH
=7,0, concentraie -1,0 M) spre stnga, ns n celulele intacte spre dreapta, oxaloacetatul
se asimileaz rapid i concentraia real e foarte mic n celule (10'6mol).

_+ +
HO NAD NADH +H
I \ E A O-C-CO O -
ooc - C H - CH2- C O O
(ti
: h 2- c o o
L-malat Oxaloacetat
n urma acestui ciclu de reacii are loc: 1) regenerarea oxaloacetatului, care
interacioneaz cu o nou molecul de acetil-CoA; 2) gruparea acetilic se asimileaz n
dou molecule de ,; 3) sunt captai ionii de hidrogen, bogai n energie.
Stoichiometria ciclului:
Acetil-CoA + 3NAD+ + FAD + GDP + P. + 2 H ,0 - - - 2 C 0 2+ 3NADH
+ FADH2+ GTP + 2 FT + HSCoA.
Reacia descris confirm c O, molecular la ciclul Krebs (CK) nu particip nemijlo
cit, ciclul fimcionnd numai n condiii aerobe, deoarece NAD+i FAD n mitocondrii pot
fi regenerate numai dup transferul electronilor pe 0 2 molecular. Ciclul manifest
caracter aerob, spre deosebire de glicoliz, ce decurge att n condiii aerobe, ct i
anaerobe. Cauza const n faptul c la transformarea piruvatului n lactat n cadrul glicolizei
are loc regenerarea de NAD+.
o

II
CHj ~ SCoA
A cetil- A i H,
Condensarea CoASH
>000 C il* -C O O "
Citrat simaza
I
HOc coo"
I
ch2coo
Dehidrogenarea Citrat

Aconitaza V

cis-A conitat

,
Hidratarea

OOC-CH-OiI
I
O O C -C -H

CH>QOO'

Decarboxilarea
oxidativ

a-cetoglutarat
GTR/ \
F osforilarea la
nivel de substrat ATP GDP
(A D P )
Decarboxilarca
oxidativ
+ Pi
F igu ra 3.2. Ciclul acizilor tricarboxilici (Ciclul Krebs)
Care-i esena biologic a prezenei ciclului acizilor tricarboxilici? Care-i cauza
c oxidarea grupei acetilice solicit un ciclu att de complex?
Molecula acidului acetic, cu dimensiuni mici i o structur relativ simpl, are o
particularitate deosebit: grupa sam etilice foarte rezistent la oxidarea chimic.
Pentru o oxidare direct pn la , sunt necesare condiii rigide, incomparabile cu
cele din celul. n timpul evoluiei celulele se conform cilor din cele mai adaptabile, ce
nu comport energie mare de activare. Celulele ataeaz acetatul la OA, cu formarea
cifratului care se dehidrogeneaz i se decarboxileaz cu mult mai uor dect acetatul.
La aparen, unele reacii sunt foarte complicate, dar studierea principiilor ce stau la
baza acestor mecanisme ale reaciilor organice atest descoperirea celei mai rezonabile
ci chimice ce asigur atare transformare.
Ciclul acizilor tricarbonici (CAT) e calea principal de scindare comun
a glucidelor, proteinelor, lipidelor ce asigur generarea ATP.

Reacii anaplerotice
Ciclul Krebs ndeplinete i alt rol furnizeaz produse intermediare pentru
procesele de biosintez. Utilizarea lor pentru biosintez trebuie s fie nsoit obligatoriu
de compensarea lor, n caz contrar funcia ciclului se va sista. Reaciile fermentative,
ce asigur completarea produselor intermediare ale ciclului, se numesc reacii
anaplerotice sau reacii de completare.
Reacia de carboxilarc a piruvatului cu , i formarea oxaloacetatului are o
nsemntate primordial. Ea este catalizat de piruvat carboxilaz i decurge intensiv
n ficat, rinichi. Ca modulator pozitiv servete CH3CO~SCoA

CH3 , CH2COO'
I I
C=0 + A T P - C 0 2 + H 20 C = 0 + Pj + ADP + 2H +
I I
COOH COO
Piruvat Oxaloacetat

Enzim catalizatoare de reacie este complex, conine 4 grupe prostetice (4


biotine). Vitamina H este covalent legat de aminogrupa restului de lizin din centrul
activ al enzimei. Reacia decurge n dou etape:
1. Oxidul de carbon n primul rnd se fixeaz de atomul azot din biotin, se activeaz
cu utilizarea ATP (covalent).
ATP + ,2 + E-biotin + HOH E-biotin-CO,2 + ADP + P.I + 2H+
2. Apoi are loc transferul de piruvat pe enzim cu formarea oxaloacetatului.
E-biotin-CO, + Piruvat E-biotin + Oxaloacetat
Piruvat carboxilaza reprezint o enzim reglatoare. CH3COSCoA asigur, cnd
e n surplus, cu combustibil ciclul Krebs (CK), stimulnd i reacia piruvat carboxilic.
n final, se formeaz surplus de oxaloacetat, deci rezult c i ciclul n ansamblu va
utiliza mai mult acctil-CoA n reacia de sintez a citratului. Diminuarea de vitez la
formarea oxaloacetatului e cauzat de mica convertire a acetil-CoA n ciclurile respective.
n miocard i muchii scheletali reacia anaplerotic principal e catalizat de
fosfoenolpiruvatcarboxi kinaz. Are loc scindarea fosfoenol piruvatului produs ma-
croergic format n procesul de glicoliz. Energia eliberat se utilizeaz pentru carboxila-
re cu formarea oxaloacetatului, restul de energie se depoziteaz n GTP.

COOH CH2- COO


-o P 0 23 + C 0 2 + G D P C=0 + GTP
Mn I
CH2 COO
F osfoenolpiruvat O xaloacetat

Produsele unui tur al ciclului citric sunt reprezentate n fig.3.3.


A cetil-C oA

NADH

F igura 3.3. Produsele unui tur al ciclului citric

R eglarea ciclului Krebs


Procesul e coordonat perfect cu necesitile de ATP n celul. Urmtoarele reacii
sunt reglate:
1. Sinteza cifratului:
a) e dependent de concentraia de substraturi oxaloacetat i acetil-CoA, ce
servesc ca modulatori pozitivi;
b) e dependent de activitatea citrat sintazei, ce e inhibat de succinil-CoA; acizii
grai; NADH; citratultimele 2 substane au efect numai n unele celule.
2. Reacia catalizat de izocitrat dehidrogenaz:
a) este activat de ADP se confirm efectul cooperativ ntre legarea izocitratului
cu Mg2+i ADP;
b) este inhibat de NADH i NADPH.
3. Reacia catalizat de complexul a-cetoglutarat dehidrogenazic. Complexul
enzimatic este inhibat de succinil-CoA i NADH, produsele reaciei. De altfel, este
inhibat i de sarcina energetic mare.
Patologiile medicale
Deficitul enzimelor implicate n ciclul Krebs (fumaraza, a-cetoglutarat dehidrogenaza)
este frecvent pe parcursul unor afeciuni ereditare, caracterizate prin:
a) acidoz lactic, produs n urma acumulrii piruvatului rezultat din glicoliz, care nu
poate fi metabolizat prin conversia n acetil-CoA i este transformat n acid lactic;
b) deficit energetic marcat, cu repercusiuni asupra dezvoltrii neuromotorii, manifestat
prin retard mental, hipotonie i apariia encefalopatiilor severe;
c) amplificarea excesiv a cetogenezei, pe baza moleculelor de acetil-CoA, care nu
pot fi degradate prin ciclul Krebs.
Formele cele mai severe se manifest nc n perioada perinatal, prin leziuni neurologice
i musculare. Aceste afeciuni sunt rare, deoarece funcionarea nonnal a enzimelor din
ciclul Krebs este esenial pentru dezvoltarea organismului i desfurarea nonnal a
activitilor celulare. Deficitul energetic marcat conduce la degenerarea i moartea rapid
a celulelor afectate.
Deficitul piruvat carboxilazei sau al uneia din subunitile piruvat dehidrogenazei se
manifest prin reducerea semnificativ a funcionrii ciclului Krebs, ca urmare a
imposibilitii fonnrii substanelor sale principale. Consecinele pe plan clinic sunt datorate
deficitului energetic i acumulrii de acid lactic, piruvat, a-cetoglutarat (n cazul deficitului
dihidrolipoil dehidrogenazei din structura CPDH, subunitate comun tuturor a-cetoacid
dehidrogenazelor). Alanina i acizii ramificai prezint niveluri plasmatice nalte, ca turnare
a blocrii catabolismului lor n condiiile reducerii fluxului intermediatorilor n ciclul Krebs.
Situaiile caracterizate prin scderea marcat a oxigenrii tisulare (hipoxie sau anoxie)
intervin n cazul insuficienei cardiorespiratorii acute, al strilor de oc .a. Aportul
insuficient de oxigen cauzeaz ncetinirea fluxului metabolic la nivelul lanului respirator
mitocondrial i, implicit, inactivarea ciclului Krebs. Rezult un deficit energetic important,
deoarece ATP nu poate fi regenerat dect n baza glicolizei anaerobe, a crei randament
energetic este sczut (2ATP). Acumularea piruvatului rezultat din glicoliz conduce la
apariia acidozei lactice.
OXI DAREA BIOLOGICA - RESPIRAIA TISULARA
Oxidarea biologic reprezint totalitatea proceselor de oxido-reducere ce decurg
n celule i esuturi. Cum se oxideaz moleculele cu rol de combustibil? Oxidarea
are loc prin dehidrogenare, adic prin donarea atomilor de hidrogen. Ei sunt
transferai n form de protoni (H+) i electroni (e), cu ajutorul coenzimelor specifice,
dar nu direct Ia O,. Forma redus transmite pe lanul respirator n membrana intern
a mitocondriilor electroni cu un mare potenial energetic. Acest transfer este
nsoit de formarea ATP din ADP i P.. Procesul e numit fosforilare oxidativ
sursa de baz a ATP la organismele aerobe. De altfel, electronii cu nalt potenial energetic
pot fi utilizai i n procesul de biosintez, ce necesit ATP i echivalente reduse.
Acceptorul principal de electroni este NAD+. Inelul nicotinamidic activ adiioneaz
ionul de hidrogen i doi electroni, constituind echivalentul hidridionului.

H H
I
-CONH,
CONH2 + H + 2'e

N r N
I I
R R
NAD4 NADH

NAD+servete ca acceptor n reacii de tipul:

RC H Rj + NAD+ NADH + R -C R, + H
OH &
Al doilea H+rmne n soluie.
Alt acceptor principal este FAD i particip n reacii de tipul:

FAD + R CH2 CH R , ^ = FADH2 + R C H = C H R


Poriunea activ e inelul izoaloxazinic, unde se adiioneaz protonii i electronii.

O
II
N
" ^ 'N H + r f + 2e -

(CHOH)3CH2OH (CHOH)3- C H 2OH


R ib o fla v in a ox id a t R ib o fla v in a redus
Compuii ce joac rol de precursori n biosintez sunt oxidai mai puternic dect
produsele reaciei. De aceea, pentru realizarea procesului sunt necesare, n afar
de ATP, i echivalente reductoare. Rolul dc donator l are forma redus a
N ADP+ NADPH. Difer de NAD+prin prezena fosfatului conjugat cu legtura
esteric prin 2'-OH a adenozinei, utilizndu-se numai n procesele dc biosintez, pe
cnd NADH preponderent la generarea ATP.
Culminarea respiraiei tisulare o reprezint transportul de electroni i fosforilarea
oxidativ. Omul cu o greutate medie de 70 kg utilizeaz pe zi circa 2800 kcal. Pentru a
recepiona aceast energie din ATP n condiii standard e nevoie de 2800 :7,3 = 384
mol ATP sau 190 kg dc ATP. Organismul uman conine 50g de ATP. Pentru satisfacerea
necesitilor de ATP, ea trebuie s fie scindat i sintetizat de mii de ori. n limite foarte
mari se modific viteza sintezei ATP n organism: minimumsomnul i maximumla
eforturi intensive, ceea ce denot c fosforilarea oxidativ (FO) este nu numai un
proces primordial i ncontinuu, dar i un autoreglator foarte fin.

Lanul respirator
Este un ansamblu de proteine aranjate ATP sintaza
ntr-o anumit succesiune cu grupe ( F F ,) M em b ran a extern
p e rm e a b il p e n tru
prostetice fixate rigid, care posed m o le c u lc le i io n ii
capacitatea de a adiiona i a dona electroni m ic i
i protoni saturai de energie. Electronii, M em b ran a intern
transferndu-se de la o protein la alta, i im p e r m e a b i l p e n tru
m a j o r i t a t e a m o le c u le lo r
pierd energia liber. O parte considerabil m ic i i io n i, i n c lu s iv i
a ei se acumuleaz n ATP, prin intenncdiul cei de H*
C o n in e :
mecanismelor moleculare. - L a n (u l r e s p i r a t o r ;
Fiecrei perechi de electroni, transferai A D P -A T P tra n s lo c a z a ;
de la NADH la O, pe lanul respirator, i - A T P sin taza;
A li tr a n s p o r to r i
se sintetizeaz 3 molecule de ATP. m e m b ra n a ri
Locusurile, unde energia se elimin n
M atricea
cadrul proceselor de oxido-reduccre, cu C o n in e:
formarea de ATP, se numesc puncte - C om plexul
p iru v a t
de fosforilure. La o rotaie a ciclului dehidrogenazic;
Krebs dehidrogenazele specifice scindea - E nzim ele
c ic lu lu i
z de la substraturi 4 perechi de atomi acid u lu i citric ;
de H, care ntr-un locus anumit i doneaz DNA, rib o zo m i;
- -o x id a re a
electronii lanului respirator i se acizilor grai;
transfonn n H+, cu deplasarea n mediul M u lte a lte
R ibozom i c n z iin c ;
apos. Electronii parcurg pe lanul respirator - ATP, ADP, Pi,
pn la 0 2 acccptorul final al electroni C an alele poroase C a !>, K*;
- A li in te r m e d ia r i
lor la organismele aerobe. m e ta b o lic i
Fosforilarea oxidativ e localizat n s o lu b ili

mitocondrii (fig.3.4). Aceste organite ovale


conin enzime ale ciclului Krebs i enzime F igura 3.4. structura m itocondrm
ale oxidrii acizilor grai. Mitocondriile posed dou sisteme de membrane: extern i
intern, ultima are o suprafa foarte mare i formeaz cristele. O parte indispensabil
a membranei interne reprezint ansambluri respiratorii i enzime ce catalizeaz
sinteza ATP.
Membrana intern are o structur complex i-i impermeabil pentru majoritatea
ionilor. Membrana extern, dimpotriv, are o permeabilitate major pentru ionii i
moleculele mici. Ea conine monoaminoxidaza.n spaiul intennembranar se afl
enzim adenilatkinaza, n matrice (compartiment determinat de membrana intern) sunt
localizate dehidrogenazele specifice ciclului Krebs, precum i enzimele oxidrii acizilor
grai.
n ce const esena reaciilor de transfer al electronilor?
Acestea sunt reacii de oxido-reducere. n calitate de donatori servesc reduc-
torii, drept acceptoroxidanii. n comun funcioneaz ca redox-pereche.
^ e+A
Fe2+ e' + Fe34
Fe24 i Fe:,+ sunt redox-pereche.
Distingem 4 modele de transfer al e' de la o molecul la alta:
1) Transfer direct al electronilor:
Fe2+ + Cu2+ Fe3+ + Cu+
2) Transferul n componena atomului de H (H+ i e'):
AH, A + 2H+ + 2e'
AH, + - A + BH,
3) n form de hidrid ion (:H+) n cazul transferului de NAD dehidrogenaze.
4) Transferul la interaciunea dircct a reductorului organic cu 0 ce conduce
la formarea unui produs care include O, legat covalent:
R - CH,3 + 1/20,2 ^ RCH,OH 2
Toate modelele de transfer al electronilor sunt proprii celulelor vii. Capacitatea de a
dona reversibil electroni se exprim cantitativ prin potenialul redox-standard. Eo -
mnme egal cu fora electromotoare exprimat n voli, ce apare n semiconductor,
n care donatorul de electroni i acceptorul cuplat cu el acioneaz n concentraii de 1,0
mol la T = 25 i pH = 7,0, formnd un echilibru cu electrodul ce adiioneaz ede
la donator i-i transfer la acceptor. n calitate de semielement standard se ia
electrodul de hidrogen. Fora electromotoare la concentraia ionilor de H+ 1,0 mol
(pH = 0) i T = 25Ce egal cu zero. Pentru pH = 7,0 potenialul standard eegal cu
0,41V. E acceptat formula potenial de reducere. Dac potenialul sistemului e negativ,
rezult o capacitate mai mare de a elibera electroni. Cu ct valoarea lui e mai pozitiv, cu
att e mai mare capacitatea de a adiiona electroni. tiind mrimea Eoa diferitor redox-
perechi, se poate pronostica direcia torentului de electroni de la o pereche la alta.
Torentul de electroni e orientat n direcia micorrii energiei libere a sistemului.
(tig.3.5.)Cu ct mai mare e diferena potenialului dintre dou redox-perechi, cu att
mai mare e diminuarea energiei libere la transferul electronilor. Trecnd prin lanul
respirator de la NADH(-0,32V) la O, (0,82V), electronii pierd o cantitate suficient
de energie liber.AG poate fi calculat dup formula:
AG = -n X FAE7, unde n este numrul de electroni;
F - indicele Faraday egal cu 23062 cal V '1 mol1;
AEo - diferena de potenial.
AG = -2 X 23062 [0,82-(-0,32)] = -52,6 kcal m ol'1 = -220 kJ m ol'1. Energia
respectiv este efcctiv suficient pentru sinteza a 3 mol de ATP (3 x (-7,3) = -21,9 kcal).
n lanul respirator se pot identifica uor trei segmente, n care transferul electronilor e
nsoit de scderea brusc a energiei libere: locusuri de sintetizare ATP. Fora motrice
a fosforilrii oxidative reprezint potenialul de transfer al electronilor inereni NADH
sau FADHr

Succinat Fumarat N A D H +H N A D +( - 0,32 V)

A m obarbital
P iericidina A

Complex III cit b5(p


I
Kb2
Coenzim Q H T
Citocrom C ltb 566
A ntim icina A
reductaza r
FeS
t
cit Ci

1
Citocrom ( + 0,25 V )

Complex IV
Citocrom c,t a
oxidaza \
cit a 3

jf ---------- A zida.C O

1/2 0 2 H , 0 ( + 0,82 V)
Figura 3.5. Lanul respirator mitocondrial
Caracteristica complexelor lanului respirator
Complexul I. NADH-Q-oxidoreductaza.
Torentul de electroni din lanul respirator n mare msur este detenninat de activitatea
dehidrogenazelor NAD* sau NADP+ dependente i doar foarte puine dintre ele
semnificativ (GDH) pot s interacioneze cu
ambele coenzime.(fig.3.6).
Unele dehidrogenaze sunt localizate n
mitocondrii, altele n citozol, dar semnificativ e
c dehidrogenazele din citozol ct i cele din
mitocondrii interacioneaz cu NAD+, respectiv
Membrana mitocondrial e impermeabil
pentru aceste coenzime. Coenzima NAD are
M atrice (N ) funcia de colector, adunnd H2 de la diferite
substraturi (NADPH, izocitrat, a-ceto-glutarat.
piruvat, lactat, malat, -oxibutirat, -hidroxiacil-
CoA) (fig.3.7.).
F ig u r a 3 .6 . N A D H : u b ic h in o n
oxidoreductaza (Complexul I)
Glicerol 3-fosfat biiccroi 3-tostat
Ulterior perechea de echivaleni redui S p a iu (citozolic) lehidrogcna/a
e transferat pe flavinproteide (FMN in term em b ra n a r
dependente), iar electronii sunt preluai de
complexele fiero-sulf cu rol de grupe
p rostetice. F lavinm ononucleotidul
formeaz cu aceti compui un complex
enzimatic NADH-Q-reductaz. Fierul nu f ETF:Qj^jp
NADH NAD Succinat oxidorcducta:
e de natur hemic i rezult c proteinele
poart denumirea fiero-proteine nehemice
sau centre fiero-sulf. Se atest trei tipuri A cil-C oA
de centre FeS:
1. A tom ul de Fe e tetraedric M a trice (N)
coordonat cu SH grupe a patru resturi de
cistein proteic, FeS 4 ( fig.3.8. (a)).
2. Fe 2 -S 2 conine 2 atomi de Fe i doi Figura 3.7. Transferul electronilor de la NADH,
disulfizi neorganici adiionai la 4 resturi de su ccin a t, a cil-C o A i glicerol-3-fosfat pe
ubichinon
cistein (fig.3.8 . (b)).
3. Fe4 -S 4 - 4 atomi de Fe i 4 disulfizi neorganici adiionai la 4 resturi de cistein
( fig.3.8. (c)).
S-a confirmat c NADH-Q-reductaza conine dou centre: Fe 2 -S 2 i Fe4 -S4.
De la Fe-S al enzimei electronii i H+sunt transferai la coenzima Q.
Reducerea de potenial constituie 0,42V, = - 19,4 kcal/mol i e suficient pentru
sinteza a 2 mol de ATP, dar se sintetizeaz un singur mol de ATP, restul energiei
risipindu-se sub form de cldur. Enzim NADH-Q-reductaza e compus din 16
subuniti polipeptidice.
F igura 3.8. Centrele ero -su lf

Coenzim Q sau ubichinona are o rspndire vast n sistemele biologice. Coada


izoprenic determin capacitile hidrofobe ale Q, ce permit o difuzie rapid n membrana
intern a mitocondriilor.

CH-, ? H

CH 3 + 2H + 2e v c' CH,

^ (fcH2 - C H = C - C H 2) 10H (CH 2 - C H = C - C H 2),H


CH 3 O Fonna oxidat CH 3 CH 3 OH Forma redus CH 3
Coenzim Q

Coenzim Q, unicul translator al electronilor fixat nerigid de protein, nu adiioneaz


covalent la ea. Ea ndeplinete funcia de colector, adiionnd echivalentele reduse de la
NADH i de la complexul succinat-Q-reductaz (dependent de FAD), electronii
fiind transferai spre proteinele Fe-S, apoi spre Q. Complexul enzimatic ( I I ) e
component integral al membranei interne a mitocondriilor.
Transferul electronilor de la QH 2 mai departe e realizat de proteinele Fe-S i de
citocromi (1925, David Keilin). Citocromii sunt proteine ce transfer electroni, molecula
lor coninnd hemul ca grup prostetic. n procesul de transfer al electronilor atomul de
Fe se afl fie n stare redus (Fe2+), fie oxidat (Fe3+).
Grupa hemului, asemntoare cu Fe-S centre, transfer numai un electron. Aadar,
molecula de QH 2 transmite 2 electroni ai si saturai de energie la 2 molecule de
:itocrom b. Citocromii br b, cl i proteina Fe-S reprezint complexul QH,
'.itocrom reductaza (III) (fig.3.9.). Valoarea de potenial n cadrul acestui transfer
este de 0,21V (AG = -7,75 kcal), ceea ce asigur sinteza unui mol de ATP.
Citocromul transfer electronii de la acest complex la complexul citocrom
dazic (IV), ce conine citocromii a i a v Citocromul joac acelai rol ca i coenzim
Q. adic asigur transferul electronilor din diferite complexe ale lanului respirator
8*3 .1 0 ).
Citocromii difer dup structur i proprieti. Grupa prostetic a citocromului b,
:romului c;, citocromului este protoporfirina IX, hemul constituind aceeai grup
S p a iu in te rm em b ra n a r
C ito c r o m .
C e n tr u l
2 F e -2 S C ito c r o m
P r o t e in a f ie r o - s u lf
C ito c r o m b C ito c r o m c, a lu i R ie s k c

M a trice (N)

Figura 3.9. Complexul QH 2 citocrom reductaza (III). Complexul este uit dimer compus din
monomeri identici, fiecare cu I I uniti diferite. Structura unui monomer (a). Unitatea funcional este
dimeric (b). Citocromul ( i proteina fiero -su lf a tui Rieske proiectat p e suprafaa P poate interactiona
cu citocromul n spaiul memhranar. Complexul are dou situsuri distincte pentru fixarea ubichinonei,
QKi Qf, ce corespund situsurilor de inhibiie a dou substane ce blocheaz fosforilarea oxidativ. Antimicina
A blocheaz flu x u l de electroni de la hem ft(/ la Q, se leag la Qv aproape de hem ul bu n locusul
N(matrice) al membranei. M yxothiazolul previne flu x u l electronilor de la QH2 la proteina fiero -su lf a lui
Rieske, se leag la Qp, lng centrul 2Fe-2S i hem bLp e partea P a membranei. Structura dimeric este
esenial pentru funcia complexului III

F igu ra 3 .10. Calea electronilor


p rin co m p lexu l IV. Cele trei S p a iu /4 C ite '
proteine implicate n transferul
in te rm em b ra n a r 1 46 *
electronilor su n t I, I I i III.
T ra n sfe ru l de electro n i p rin
complexul IV ncepe cnd dou
m olecule de citocrom redus
doneaz fiecare cte un electron
centrului binuclear CuA. De aici
electronii trec prin hem ul a ctre
centrul Fe- (citocromul a, i
). O xigenul legat la hem ul
a , este redus la derivatul lui
peroxid ( O f) de doi electroni de
la centrul Fe-. Primirea a nc
doi electroni de la citocromul
convertete O f n dou molecule
de ap, c o n s u m n d p a tru
substrat protoni din matrice.
In acelai timp, nc patru protoni
sunt pompai de la matrice printr- M a trice (N)
un mecanism nc puin elucidat
4H +
(substrat)
prostetic ca i la mioglobin i hemoglobin. n citocrom b hemul nu e legat covalent
de protein, n citocromii i c; covalent cu legturi tioestcrice (grupele sulfhidnlice
a 2 resturi de cistein la grupele vinii ale hemului).
Citocromii a i a ; au alt grup prostetic (ficroporfirinic), ce se deosebete dc
citocromii i cr avnd grupa fonnil ( n loc de metil) i un lan hidrocarbonat (n loc de
vinii). Complexul final mai este denumit i citocrom-oxidaza.
Citocrom oxidaza prezint dimer proteic asimetric, n care fiecare monomer e
compus din 13 subuniti diferite. Ca componeni ai subunitilor I sunt 2 heme A, trei
atomi, cu raportul Fe/Cu 2:3, un atom de Mg i Zn i cteva molecule de fosfolipide.
Se observ c partea intern a scheletului de oc-atomi de carbon a structurii
cristalice e compus dintr-o cantitate vdit de a spirale, ce sunt aranjate n 2 suprafee
paralele, la deprtarea de 50 . Acest sector a spiralat prezint partea proteic trans-
membranar situat n membrana intern mitocondnal.
E stabilit c primele trei
subuniti codificate de genele
mitocondriale formeaz nucleul
m onom erului, celelalte 1 0
subuniti codate de gene nu-
cleare form eaz spaiul
perinuclear (fig.3.11). Funciile
subunitilor i II constau n
fonnarea ccntrclor metalice de
oxido-reducere i a tenninaiilor
de transfer al protonilor, funciile
F ig u ra 3.11. Organizarea tridim ensional n m onom er
celorlalte subuniti sunt subunitilor codificate de genele nucleare din structura
[ discutabile. E confirmat c citocromului oxidazic. Subunitile codate de genele (a)
protonii antrenai n fonnarea mitocondriale, b hem ul a i aJ} n fiecare monomer
atomii de Cu**
gradientului transmembranar
i n sinteza apei sunt transportai pe ci diferite. Cile efective de transport al H+sunt
determinate dc caviti, n care sunt fixai aminoacizii capabili de formarea legturii de
hidrogen. Alte caviti, orientate haotic, pot conine molecule de ap mictoare. Cavitile
pot s-i ndeplineasc rolul la modificrile confonnaionale ale resturilor de aminoacizi,
la inducia lor sub influena proceselor de oxido-reducere sau a modificrilor fixrii leg-
tunlor n centrele metalofixatoare.
Controlul riguros la viteza de intrare a oxigenului joac rolul decisiv la funcionarea
enzimei, dac torentul de e' e suficient, apoi surplusul de oxigen n centrul de reducere al
su favorizeaz formarea particulelor de oxigen activ. Sunt depistate 2 canale pentru
oxigen n subunitatea III i n hemul A v Molecula de oxigen nu poate trece liber prin
cavitatea canalelor, ceea ce confmn controlul riguros al difuziei de oxigen prin ele.
Expulzarea moleculelor de ap sintetizat n centrul de reducere a oxigenului n
partea citoplasmic e, de altfel, strict controlat. Sunt depistai aminoacizii hidrofili,
aranjai liniar n jurul hemului A3,i pn la atingerea cu subunitile I i lis e
formeaz o cale hidrofilcanal posibil pentru ap. Aminoacizii sunt compact aranjai,
aa nct torentul invers al apei e practic imposibil. Analiza RS confirm lipsa unor alte
structuri, ce ar ndeplini aceast funcie. Modificrile confonnaionale ale acestor canale
sunt induse de modulatorii strilor de oxido-reducere i ligandofixatoare ale centrului de
reducere a oxigenului.
Transferul schematic al electronilor n lanul respirator este prezentat n felul unntor:
1 NADH- FMN v Fe 2- S 2(+2)

NAD FM N H 2 FC2_ S 2(+3) QH 2

Complexul enzimatic -NADH-Q reductaza


2.
QH2^ - Cit.b (+ 3 )4 ^ F e -S (+ 2 )^ cit.C] ( + 3 K y c l t c ( +2)

cit.b ( + i ) r Fe S(+3) cit.C ! (+ 2) c it.c (--3)

2 Complexul enzimatic QH 2 - citocrom reductaza


cit.c (+2 ) ^ x cit.a (+3) cit.a 3 (+2 K ^ Cu (+2 ) H 20

cit.c (+3)* cit.a (+2 ) - ^ 4'" cit.a 3 (+3 )>^/^ Cu (+ ) - ^ 4 ^ 0 2

Complexul enzimatic - citocrom oxidaza

Revenind la lanul respirator, ne-am referi la unele probe ce confirm faptul c


proteinele acestuia funcioneaz n secvena descris mai sus.
a) Valoarea potenialului redox devine pozitiv la deplasarea spre oxigen.
b) Fiecare protein din acest lan e specific numai pentru un anumit donator i un
anumit acceptor de hidrogen.
c) Din membrana mitocondrial s-au extras complexe structurale izolate funcional
legate ntre ele prin transferul de electroni (4 complexe i doi componeni de legtur).
Inhibitorii lanului respirator. Studiul transferului de electroni s-a facilitat datorit
utilizrii metodei de inhibiie specific, ce blocheaz etapa concret a procesului
(fig.3.5).
1 .Complexul I este inhibat de rotenon (insecticid de origine vegetal folosit de indienii
americani ca otrav pentru peti), Na amital - (barbiturat), pericidin (antibiotic), care
blocheaz transferul electronilor pe segmentul NADFP la coenzima Q.
2 .AntimicinaA (antibiotic foarte toxic) comport aciune de blocaj transportului de

electroni ntre QH 2 i citocromul c.


3.Cianida blocheaz funcia citocromului aa3 (aa3 este blocat i de ).
4. Complexul II este inhibat de ctre malonat, care acioneaz ca inhibitor competitiv.
Coenzima Q este inhibat de doxorubicina, preparat din clasa antraciclinelor.
5. ATP sintetaza este blocat i de compuii arsenicului, care n forma ionilor de
arseniat substitue ionii fosfai, blocnd formarea ATP
6 . Componentele lanului respirator pot fi inactivate n deficit de fier, deficit al vit.
B2, hipoxie sau prin atacul radicalilor liberi asupra coenzimei Q.
S-a constatat c pn la fiecare blocaj proteinele sunt mai reduse, iar dup blocaj
mai oxidate. Cnd echivalenii de reducere intr n lanul respirator prin complexul I, se
consider c lanul funcioneaz prin ramura lung, intrarea prin complexul II se asigur
prin ramura scurt (fig.3.5).
Fluxul de electroni de la NADH la O, e un proces exergonic i poate fi exprimat
prin:
NADH + H++ 2 0 , + 3P, + 3ADP ^ N AD++ 3ATP + 4H20 (-52,6kcal/mol)
Trei moli de ATP conin numai 21,9 kcal/mol. Rezult c randamentul utilizrii energiei
libere va fi de 42%. Procesul dc transfer al electronilor e cuplat de fosforilarea ADP i
sinteza ATP. Potenialul redox n punctele de fosforilare trebuie s fie mai mare dect
0,224V necesar pentru sinteza de ATP. Lanul respirator e o cascad, datorit creia
celula acumuleaz energia liber eliminat de combustibilul celular ntr-o form accesibil.
Generarea radicalilor liberi Procesul de transferare a patru electroni finalizeaz
cu formarea apei, ns se tie c hemul transfer numai un electron. Modul ncare
joncioneaz patru electroni pentru reducerea moleculei de oxigen nu este distinct:
0 2 + 4H+ + 4e- 2H20
La reducerea incomplet, cu adiia a 2e\ se fonneaz ap oxigenat (H 2 0 2). La
adiia unui electron se formeaz radicalul superoxid( :0 2). Ultimele dou substane
sunt toxice i, interacionnd cu restul acizilor grai din lipidele membranare, lezeaz
membranele celulare.
Celulele aerobe se protejeaz graie aciunii enzimelor:
1) Superoxiddismutaza enzim-metal ce transform superoxidul n H ,0,:
2 0 2- (:0 2 ) + 2H+ ^ H20 2 + 0 2

2) Catalaza transform H ,0 , n 1 1,0 i 0 2:


2H 2 0 2 ^ 2H20 + 02
3) Peroxidaza:
H 2 0 2 + RH 2 2 H ,0 + R
Interaciunea oxigenului poate evolua n felul urmtor:

O, :0 2- 1 . OH < L H ,0
-e H:U

Arsenalul mecanismelor de protejare nu dispune de enzime ce ar neutraliza OH',


dar benefice sunt sistemele de neutralizare a : O,' i 1I,0 sistnd fonnarea OH. Deosebit
de expuse efectelor nocive ale radicalilor liberi sunt mitocondriile compartimentul
celular unde se efectueaz reaciile de oxido-reducere n prezena oxigenului molecular.
Sunt afectate primordial fagocitele i eritrocitele. Deficitul unuia dintre sistemele dc protecie
celular are consecine severe i inposibilitatea de neutralizare a radicalilor liberi este
implicat n patogenia diferitelor afeciuni, ca: ateroscleroza, bolile mitocondriale, bronitele
cronice, emfizemul pulmonar, canceml, diabetul zaharat, distrofiile musculare, insuficiena
renal, maladiile degenerative neurologice, accidentele cerebrovasculare.

2 : 0 2'+ 21l+- ^ ~ 0 2 + H2 0 2 - - - - - - - - 1 /2 0 2 4- H20

2GSH Ghitation

2NADP 2NADPH +2H

M ecanismele fosforilrii oxidative (cuplarea oxidrii cu fosforilarea)


Se postuleaz mai multe ipoteze:
a) Una din ipoteze este c n cadrul procesului de transfer al electronilor are loc
fonnarea unui produs intennediar covalent, macroergic, precursor al ATP (n analogie cu
procesele similare).
b) O alt ipotez presupune c energia oxidrii este preluat de o protein ce se
gsete ntr-o confonnaie activ, care ulterior stimuleaz sinteza ATP. Investigaiile n-au
confinnat atare ipotez.
c) Piter Mitchell postuleaz, n 1961, mecanismul hemiosmotic.
Savantul a presupus c anume cuplarea transferului de electroni i sinteza ATP se
datoreaz gradientului de protoni, ce se stabilete ntre partea interioar i cea exterioar
a membranei interne mitocondriale. Anume transferul electronilor (energia eliberat la
transferul lor) pompeaz H+din interior spre exterior, sporind concentraia ionilor 1
n exterior - regenereaz potenialul membranar cu semnul (+).

F ig u ra 3 .1 2 . M oilelul hem io
sm otic. In aceast sim pl
prezentare a teoriei hemiosmotice
aplicat mitocondriei, electronii
din N A D H i alt su b stra t
oxidabil trec printr-un lan de
proteine aranjate sim etric n
m em brana in tern . F lu x u l
elec tro n ilo r este cu p la t de
transferul de protoni de-a lungul
membranei, producnd att un
gradient chimic (bpH), ct i un
gradient electric(Ayf). Membana
in te rn m itocondrial este
impermeabil pentru protoni;
protonii pot reintra n matrice
doar p rin ca n a lele p ro to n -
specifice (FJ. Fora motrice ce
co n d u ce p ro to n ii n a p o i n
matrice asigur energia pentru
sin teza ATP, catalizat de
complexul F t asociat cu Fo M atrice (N)
Energia electronilor se stocheaz, deci,
iniial n gradientul protonilor, apoi apare o
for proton-motrice ce condiioneaz
sinteza ATP n complexul enzimaticATP-
azic (fig.3.12.).
Esena general a mecanismului const
n faptul c actul primar de stocare a ener Pi
giei l constituie transferul protonilor prin
membrana intern, cu formarea gradientu-
lui proton.
Numeroasele date experimentale con
firm conceptul lui Mitchell:
1) S-a confinnat generarea gradientului
n cele trei puncte ale lanului respirator.
Gradientul protonic generat n ele se utili
zeaz la sinteza moleculelor de ATP.
2) S-a dem onstrat c pH matricei
mitocondriale crete, iar a mediului extern F igura 3.13a. Complexulmitocondrial ATP-sintaza
al mitocondriilor scade, mediul fiind mai
acid.
3) A fost argumentat teza c transferul IT din mitocondrii n timpul transferului elec
tronilor i revenirii lor prin moleculele de ATP-sintaza sunt comparabile cu viteza lor
din cadrul proceselor de fosforilare oxidativ n mitocondriile intacte.
Teoria hemiosmotic postuleaz c ionii de H+ translocai n exterior datorit energiei
de transfer a electronilor revin n mitocondrii prin canale speciale, ionice, localizate n
complexul ATP-azic. Acest flux de protoni este fora motrice care determin sinteza
cuplat a ATP din ADP i Pi.
Complexul enzimatic,denumit ATP-sintaza sau F Ft -ATP-aza,se compune din
factorii Fo iy F,.] Ultimul se afl n matricea mitocondrial. Savantul Efraim Racker
l-a izolat i n aceast stare izolat de Fo scindeaz ATP (F(- ATPaza). Masa
molecular e de 380 kDa i conine nou subuniti incluse n cinci tipuri diferite, fiind
joncionate i coninnd cteva locusuri de fixare pentru ADP i ATP. F, e fixat de Fo,
aceasta fiind parte component a membranei interne, o transverseaz complet. Zero (nu
e dect o liter) nseamn c aceast parte a complexului leag un antibiotic toxic
oligomicina ce simultan inhib fosforilarea oxidativ.
Structura complexului F F,, dedus prin studii biochimice i cristalografice de John
E.Walker, este redat n fig 3.13a. n Fj trei subuniti a si 3 sunt aranjate precum
feliile alternate ale unei portocale. n centru se afl subunitatea y. Cele dou subuniti
ale Fose asociaz fenn cu subunitile a i ale F ,, meninndu-le strns lng membran,
n Focilindrul membranar al subunitilor este ataat ia subunitile y, i e ale Iui F(. n
timp ce protonii curg prin membran din direcia P spre N - via Fo, complexul cilindric
se rotete i subunitile Fj i schimb conformaia; subunitatea se asociaz cu
fiecare n parte.
n fig. 3.13b este redat conformaia lui F,, vzut din direcia N membranar, cu
cele trei subuniti i 3 a la periferie i subunitatea n centru. Pe fiecare subunitate
, la interfaa ci cu a , este
a-ADP p re z en t un site de legare
nucleotidic. Subunitatea se
asociaz primar cu una din cele
trei perechi a, fornd trecerea
lor n diferite conformaii cu
generare de ATP.
n cursul evoluiei, s-au
d e zv o ltat ctev a tipuri de
tran sp o rtato ri activi ATP-
dependeni, difereniindu-se n
structur, mecanism, localizarea
n e su tu ri sp ec ific e i
compartimente intracelulare
(vezi tab.3.1)
ATP -azele de tip P sunt
transportatori ai ATP-ului ce
F igura 3.13b. Conformaia complexului Fr vzut conduc cationii fosforilai
din direcia N membranar reversibil de ctre ATP, ca parte
a ciclului de transport. Toate
ATP-azele de transport de tip P au asemnri n secvena aminoacidic, mai ales n
apropierea reziduului Asp ce sufer fosforilare, i toate sunt sensibile la inhibiie de ctre
analogul fosfat -vanadatul. Fiecare este o protein integral cu multiple regiuni de
deschideri membranarc ntr-un singur polipeptid, unii avnd i o a doua subunitate
(fig.3.14a).
Transportatorii de tip P sunt larg rspndii. n esuturile animale, Na+, K !- ATP-aza,
un anticonductor pentru Na+, K+; Ca2+- ATP-aza, un uniconductor pentru Ca2+. l ipul P
al ATP-azei menine dezechilibrul n compoziia ionic dintre citozol i mediul extracelular.
Celulele parietale ale stomacului mamiferelor au o ATP-az de tip P ce pompeaz H+i
KHde-a lungul membranei plasmatice, deci acidific i coninutul stomacal. La plantele
superioare, ATP-aza de tip P pompeaz protonii afar din celul, stabilind o diferen de
2 uniti pH i 250mV de-a lungul membranei plasmatice.
O ATP-az de tip P similar din mucegaiul pinii, Neurospora, pompeaz protonii din
celul pentru a stabili un potenial negativ pe partea intern a membranei, utilizat pentru a
conduce aportul de substraturi i ionii din mediul nconjurtor prin transport activ secundar.
Bacteria folosete ATP-aza de tip P pentru a pompa n afar ionii metalelor grele, precum
i Cd2+, Cu2+.
O r g a n is m T ip de R o lu l
sa u e s u t m em b ran
A TP-azele de tip P
Na esu tu ri Plasm M enine sczut N a , riclicind
anim ale K~ n interiorul celulei, creaz
potenial transm em branar
electrolitic
+ C elule acid-
secretorii Plasm A cidifiaz coninutul stom acal
(parietale)ale
m am iferelor
"1
Fungi Plasm C reaz gradientul FT pentru a
(N eurospora) dirija transportul secundar
+ Plante Plasm extracelular n interiorul celulei
superioare

2+ esuturi Plasm M en in e C a2+ sczut n


anim ale citozol
2+ M iocite R eticulul S cchestrcaz C a2+ in tra c c lu la r,
anim ale endoplasm atic m eninnd C a2k sc z u t n
citozol
C d 2+, H g2+, C u2+ B acterii Plasm P om peaz ionii m etalelor grele
din celule
A T P -a zele de tip V
H+ A nim ale V ezicule
secretorii,
lizozom ale, C reaz un pH mic n
endozom ale com partim ent, activnd
+ P lan te V acuolar proteazele i alte enzim e
superioare hidrolitice
+ Fungi V acuolar
A T P -a zele de tip F
H+ E ucariote Partea intern 1
a m itocondriei C atalizeaz form area de ATP
H+ Plante Tilacoid [ din ADP + Pi.
superioare
H+ Procariote Plasm
T ransportatori in u lti m edica m en to i
Celule Plasm ndeprteaz o m are varietate dc
anim ale produse naturale hidrofobe i
tum orale droguri sintetice din citozol,
inclusiv vinblastina, doxorubici-
na, actinom icina D, m itom icina,
taxolul, colchicina, purom icina
O clas diferit de ATP-aze responsabile de transportul ionilor este corelat cu
acidifierea compartimentelor intracelulare la multe organisme. Vacuolele lungilor i ale
unor plante superioare menin un pH ntre 3 i 6 , cu mult sub cel ce nconjoar citozolul
(pH=7,5), prin activitatea ATP-azei de tip V - pomp de protoni ATP-azele de tip V
(V de la vacuole) sunt responsabile i de acidifierea lizozomilor, endozomilor, complexului
Golgi i veziculelor secrctorii din celulele animale.
Structural, nu sunt nrudite cu ATP-azele de tip P, nu sufer fosforilarea ciclic i
defosforilarea, i nici nu sunt inhibate de vanadat. Toate ATP-azele de tip V au o structur
complex similar, cu un domeniu integral (transmembranar) (V0) ce servete drept canal
protonic, i un domeniu periferic (V() ce conine site-ul ATP de legare i activitatea ATP-
azic (fig.3.14.b). Mecanismul prin care ATP-aza de tip V cupleaz ATP - hidrolizarea
pn Ia transportul protonic, nu este nc pedeplin cunoscut. Pompele protonice de tip V
sunt asemntoare structural i, probabil, ca mecanism, cu o a treia familie de pompe
protonice, ATP-azele de tip F.

Figu r a .3 .14. Structura sitbuuitar a trei tipuri de A TP-uze transportatoare.


a) A TP-azele de tip P au, n general, dou tipuri de subuniti proteice integrale. Subunitatea a care este
esenial, are un reziduu Asp fosforilut n timpul transportului medicamentelor.
b) ATP-azele de tip Vau un domeniu periferic compus din 7 tipuri diferite de subuniti, incluznd
trei A i trei B, i un domeniu integral V(l, cu trei tipuri de subuniti ce includ multiple copii ale lui c.
c) ATP-azele de tip F au un domeniu periferic F t omolog cu V al ATP-azelor de tip V. Poriunea
integral a ATP-azelor de tip F, F0, de asemenea are trei tipuri de subuniti cu multiple copii ale lui c.
Pompele de tipul P, cum ar f i Na*, *, ATP-aza mic doi ioni n direcii opuse. Pompele de tip V i F
mic protonii ntr-o direcie.

ATP-azele de tip /'joac un rol central n reacia de conservare a energiei la bacterii,


mitocondrii i cloroplati. Ele catalizeaz trecerea transmembranar a protonilor, condus
prin hidrolizarea ATP, ca i reacia invers n care fluxul de protoni determin sinteza ATP
(fig.3.14c). n al doilea caz, ATP-azele de tip F sunt denumite ATPsintaze. Gradientul
protonic n fosforilarea oxidativ i fotofosforilare este stabilit de o alt categorie de
pompe protonice ce au ca surs substratul oxidativ sau lumina solar. ATP-azele de tip
F/ATP-sintazele sunt complexe multisubunitare ce asigur pori transmembranari (proteina
integral F0) pentru protoni i molecule (proteina periferic F^.ce fololsesc energiea
eliberat din protoni (F0) pentru a fomia
puni fosfoanhidridicede ATP. Sintetizarea
ATP i activitatea ATP-azic se afl n
proteina F, (fig.3.14c). jj
La mijlocul anilor 1980 a devenit
evident c unele tumori sunt rezistente la
un numr de compui antitumorali.
Investigaiile au artat c membranele
2,4 DNP transport
plasmatice ale acestor tumori conin un H prin MIM,
transportator - ATP-dependent ce poate neutraliznd
gradientul protonic
exporta muli compui medicamentoi
diferii, prevenind acumularea lor n
celulele tumorale i efectele lor de inhibiie
tumoral. Medicamentele transportate
difer chim ic, dar sunt hidrofobe.
Transportatorii de medicamente prezint Matricea
pH
o protein integral, cu masa molecular [H ]
de 170 kDa, 12 segmente membranare Difuzia Membrana
i dou site-uri de legare a ATP-ului. Ele mitocondrial
intern (MIM)
sunt re sp o n sa b ile de elim in area Partea
medicamentelor din citozolul celulei citozolic OH
a MIM
tumorale. Exportul de medicamente are pH
loc prin h id ro liz a re a A TP-ului. [H I

Transportatorii de medicamente sunt, de


asem enea, i can ale io n ice, care
favorizeaz n mod specific trecerea CI
la diminuarea gradientului de concentraie
independent de ATP n boala genetic H
fibroz cistic defectul detenninant este
n gena care decodeaz o protein H H
tra n sp o rta to a re de C l' (re g la to r
transmembranar CFTR), ce poate fi H H
n ru d it cu tra n sp o rta to ru l de
medicamente n celulele tumorale. no2
2,4 Dinitrofenol
F igu ra 3.15. Influena DNP la transportul
de 1 n mitocondrii
Decuplanii fosforilrii oxidative
La fosforilarea oxidativ contribuie:
a) integritatea membranei interne a mitocondriilor-orice leziune conduce la pierde
rea capacitii de fosforilare oxidativ, n timp cc transferul electronilor poate continua.
Fr integritatea membranei interne, gradientul de II * n-ar putea exista;
b) impermeabilitatea membranei interne pentru ionii H+, O H , K+, Cl'. Dac ar fi
permeabil, procesele de fosforilare oxidativ nu ar avea loc.
Procesele fosforilrii oxidative pot fi decuplate cu ajutorul unor substane chimice ce
inhib fosforilarea ADP, neafectnd transferul electronilor- ageni decuplani. Energia nu
se acumuleaz n ATP, ci doar trece n cldur. Decuplanii mresc permeabilitatea
lalV (protonofori). Ca substane lipofile, ei leag ionii de o parte a membranei i-i
transfer pe cealalt, unde concentraia lor e mai mic (fig.3.15).
Muli ageni decupleaz procesul fosforilrii oxidative - decuplantul clasic e 2,4-
dinitrofenol (decupleaz oxidarea de fosforilare). La fel, drept decuplani pot servi unele
hidrazone, izotiocianai etc.
Acest fenomen are drept scop i meninerea homeostazei termice - energia
neutilizat ce se disipeaz sub fonn de cldur. Procesele respective decurg intensiv n
esuturile adipoase brune, saturate n mitocondrii, cu un coninut mare de citocromi.
Asemenea esuturi caracterizeaz animalele care hiberneaz; de altfel, le posed i nou-
nscuii. In calitate de decuplani servesc acizii grai, eliminarea crora e reglat de
adrenalin.
Alt grup dc substane sunt ionoforele care leag i transfer ionii prin membran -
Valinomicina (K+), Gramicidina (Na, K, i ali ioni monovaleni).
S-a constatat c sub aciunea noradrenalinei eliberat la nivelul terminaiilor nervoase
simpatice, se sintetizeaz o protein decuplant - termogenina. Efectul ci are loc n
esutul adipos brun, dezvoltat la nou-nscut, ct i la mamiferele care hiberneaz. Frigul
sau o alimentare abundent elibereaz termogenina, care decupleaz fosforilarea oxidativ,
cu producerea de cldur. Efectul calorigen e caracteristic i hormonilor tiroidieni, care
n final modific penncabilitatea membranei mitocondriaie pentru protoni, mpiedicnd
generarea gradientului electrochimic.
Dar multe nuane ale mecanismelor fosforilrii oxidative nu sunt elucidate. De exemplu,
nu se tie:
1. Care anume este mecanismul ce faciliteaz lanul de transfer al electronilor-
pomparea H+din matrice n exterior?
2. De unde se iau aceti protoni? Fie c sunt cei care particip direct la reaciile
chimice catalizate de enzime, reprezentnd o cale nemijlocit de la NADH, alta-d in
soluie sau, indirect, la interaciunea conformaional ntre centrele catalitice i de fixare
n diferite poriuni ale complexului enzimatic.
n 1988, M.Hartmut a expus argumente incontestabile n favoarea teoriei lui Mit
chell, n urma studierii cristalelor proteinei membranare din complexul clorofil - protein
a unor bacterii. Cu ajutorul analizei roentgenostructurale, a demonstrat c sub aciu
nea luminii electronii se desprind de la substrat i se deplaseaz de la un complex la
altul. Golul rmas n proteina dat este compensat de transferul unntorului electron de
la proteina precedent (fig.3.16).
La scindarea ATP n citozol, se formeaz ADP3' i P2'. Care este mecanismul de
transfer al ADP n mitocondrii i cum ATP sintetizat va prsi mitocondriile?
Se tie c membrana mitocondrial e impermeabil pentru substane ionizate.
Membrana intern conine dou sisteme specifice dc transport: adeninnucleotid
translocaza, cu funcia de transfer al ADP3- din citozol n mitocondrii, n schimb de
ATP4', n direcie invers (1:1).
Transferul are loc datorit modificrilor conformaionale ale moleculei AN-
translocazei, ce reprezint o protein foarte specific. Se cunoate un inhibitor al
e i-antractilozidul, secretat de o plant (ciulin sau scaiete). Al doilea sistem specific
e fosfattranslocaza, cu funcia de transportator al fosfatului n mitocondrii, nsoit de
deplasarea ionilor de hidrogen.

F igura 3.16. Modelul tridimensional (a) i aranjarea spaial a cofactorilor n interiorul modelului
pentru proteinele centrului fotoreactant n bacteriile Rhodopsendomonas viridis (b)

Bolile mitocondriale
Mutaiile genelor care codific proteinele sau moleculele de RNA mitocondrial
cauzeaz bolile mitocondriale mult mai semnificative n patologia general, pe msura
evoluiei cunotinelor actuale despre funcionarea normal a mitocondriilor. Proteinele
mitocondriale pot fi codificate de gene nucleare (fiind importate n mitocondrii dup ce
au fost sintetizate n citoplasm) sau de gene din DNA mitocondrial. Bolile mitocondriale
pot fi cauzate de anomalii ale unuia din complexele din membrana intern (antrennd un
deficit energetic important), de anomalii aleribozomilor i ale biosintezei intramitocondriale
a proteinelor, de anomalii ale transporturilor din membranele mitocondriale etc.
Cele mai importante particulariti ale acestor afeciuni sunt:
a) transmiterea mendelian, dac mutaia afecteaz o gen nuclear;
b) transmiterea matriliniar (exclusiv pe linie matern), dac mutaia afecteaz o gen
a DNA mitocondrial, deoarece DNA mitocondrial este transmis pe linie matern;
c) segregarea replicativ, care const n repartiia aleatorie a mitocondrii lor afectate
i ale celor nonnale n unna diviziunii celulare, ceea ce antreneaz un mozaicism tisular
(exprimarea difereniat a simptomatologiei n funcie de esut sau chiar n cadrul aceluiai
esut);
d) acumularea progresiv a mutaiilor n DNA mitocondrial ca urmare a atacului
radicalilor liberi produi prin funcionarea lanului respirator. Dup atingerea unui anumit
nivel al anomaliilor induse de radicalii liberi, apare expresia clinic a afeciunii, n primul
rnd n organele dependente de un aport constant de energie (miocardul, muchiul scheletic,
sistemul nervos).
Citopatiile mitocondriale
Anomaliile sau deficitul total al proteinelor din lanul respirator sunt denumite genetic
citopatii mitocondriale. Acestea sunt cauzate de deficitul ereditar al unuia dintre
complexele enzimatice respiratorii. Simptomatologia debuteaz precoce, nc n perioada
neonatal n cazul deficienelor grave sau, ulterior, n cazul n care activitatea enzimatic
rezidual pennite sinteza unui numr mic de molecule de ATP. Tabloul clinic depinde de
gradul de afectare a mitocondriilor din diferite esuturi, deoarece nu toate celulele aerobe
sunt n egal msur purttoare ale anomaliilor mitocondriale. esuturile cele mai afectate
sunt cele cu necesiti energetice maximal, n primul rnd sistemul nervos, miocardul i
muchiul scheletic. Frecvent, pacienii prezint semne de encefalopatie metabolic,
cardiomiopatii, hipotonie sever, steatoz hepatic, insuficien renal, etc. Pe plan
bioumoral predomin acidoz lactic consecutiv inhibrii retroactive a ciclului Krebs i
conversiei piruvatului n lactat. O alt modificare caracteristic este accentuarea
cetogenezei cauzat de creterea nivelului cetonemiei i a raportului -hidroxibutirat/
acetoacetat (deoarece -hidroxibutirat dehidrogenaza este activat la creterea raportului
NADH/NAD+).
Cele mai frecvente afeciuni cauzate de disfuncii ale proteinelor sau ale RNA
mitocondrial sunt:
a) sindromul OXPHOS care reunete afeciunile cauzate de disfuncia unuia dintre
complexele lanului respirator;
b) sindromul MERRF, afeciune neurodegenerativ produs de prezena unei mutaii
n gena mitocondrial care codific tRNA-Lys, ceea ce condiioneaz perturbarea
biosintezei tuturor proteinelor mitocondriale;
c) sindromul MELAS, afeciune neurodegenerativ fatal, produs de prezena unei
mutaii n gena mitocondrial pentru un alt tip de RNA de transfer (tRNA leu)-UUR.
Anomaliile mitocondriale secundare
Anomaliile mitocondriale secundare sunt cauzate de diminuarea aportului tisular de
oxigen (anoxie sau hipoxie n insuficienele respiratorii ori cardiocirculatorii severe) sau
de intoxicaiile cu ageni care blocheaz complexele mitocondriale. Drept exemplu ar
servi monooxidul de carbon sau cianurile care blocheaz ireversibil complexul IV, prin
stabilizarea formei fierice a ionului de fier.
Sistemele - navet de transport al echivalenilor de reducere
Este evident c NADH++H +care se produce la nivelul mitocondriilor, se reoxideaz
prin ptrunderea n lanul respirator. Dar care este soarta celui ce genereaz n citoplas
m, doar mitocondriile intacte sunt impermeabile pentru NAD(P)? Reoxidarea va de
curge pe ci indirecte denumite sisteme navete, fiind indispensabile de funcionarea
cilor metabolice citozolice. Prin membran vor fi transferai nu NADH, dar numai
electronii lor. Primul mecanism e naveta glicerol-fosfat, ce opereaz n ansamblu
astfel: NADH i H+rezultat din di verse reacii de reducere din citoplasm se asociaz
cu apoenzima specific, fonund glicerol-3-P-dehidrogenaza (fig.3.17). Drept acceptor
servete DI 1AP (dihidroxiacetonfos-
fatul - intermediar glicolitic). Mem Glicoliz
brana extern mitocondrial este Glicerol I
permeabil pentru glicerol-3-fosfat NAD' 3-fosfat NADH + H*
care difuzeaz cu uurin n spaiu dehidrogenaza >
\^ c ito z o lic ).^ /
intermembranar. Pe suprafaa extern
a membranei interne mitocondriale
este lo c aliza t G -3-P -D H Glicerol 3-fosfat Dihidroxiacetonfosfat
mitocondrial, care - 1 reoxideaz
(glicerolfosfatul) nDHAP, iar cei
doi atomi de H sunt preluai de coen-
zima acestei enzime de tip flavinic
(FP). Hidrogenii sunt preluai la
aceast enzim prin intennediul CoQ
n lanul respirator. DHAP revine n
citoplasm i suita de reacii se reia.
Mecanismul menine n citoplasm F igu ra 3.17 Mecanismul-navet glicerol 3-fosfat
o concentraie necesar de NAD'.
Proccsul e deosebit de activ n muchii scheletali i creier.
E mai complicat mecanismul de transfer al H+la naveta malat- aspartat (fig.3.18).
In schema rcspectiv, 2,5 indic sisteme de transfer al aminoacizilor, dicarboxila-
ilor. Accst mecanism funcioneaz intens n inim, ficat, rinichi. Astfel, se asigur
reoxidarea NADH citozolic i reglarea cuplurilor NADH/NAD+ extra i intra
mitocondriale. Naveta dat cedeaz electroni n lanul respirator, formnd 3ATP.
Naveta malat-aspartat nclude urmtoarele sisteme enzimatice i de transport:
- malat dehidrogenaza (MDH) cu izoformele sale-citozolic i mitocondrial;
aspartatamino transferaza (AST), de asemenea citozolic i mitocondrial;
- transporttorii, care funcioneaz ca sisteme antiport - malat-cetoglutarat i
aspartat - glutamat.
Echivalenii reductori (NADI H H+) citozolici sunt preluai de MDH i utilizai pentru
reducerea oxaloacetatului n malat. Ultimul este transportat n mitocondrii i retransfonnat
n oxaloacetat graie aciunii MDH mitocondriale. NADH+H+mitocondrial este preluat
NAD*
NAD M alat

M a lat ^
NAD1 dchidrogcna NA DH
M alat
dehidrogenaza

Oxaloacetat O x a lo a c e ta t

Clutamat G utamat

oc-cetoglutarai a-cetoglutarat

A sp a rta t-
A sp a rta t-
am ino transferaza
arnino tran sferaza

S p a iu l
intermembranar M a trice (N)

F igu ra 3.18 Mecanismul-navet malat-aspartat

ca substrat al complexului I. Oxaloacetatul este transaminat sub aciunea AST, genernd


acidul aspartic, care ulterior este trasportat n citozol prin intermediul transportatorului
comun aspartat-glutamat. AST citozolic regenereaz oxaloacetatul prin transaminarea
aspartatului. Ciclul glutamat-aspartat furnizeaz oxaloacetatul necesar funcionrii nave
tei n cauz.
Reglarea fosforilrii oxidative
Intensitatea fosforilrii oxidative este riguros controlat. Un anumit control se
poate exercita prin compui i factori direct implicai n proces. Rolul major i revine lui
ADP ce se cupleaz cu P, formnd ATP. Controlul se exercit:
a) Prin acceptorfosfat exprimat prin mrimea P/O (denumit i ct de fosforilare). El
reprezint numrul de molecule de fosfor neorganic, transformat n form organic,
cu referire la atomul de oxigen utilizat, (respectiv, pentru cele trei puncte de fosfori
lare e egal cu 3 :2 : 1).
b) Electronii se deplaseaz prin lanul respirator, cu condiia fosforilrii simultane a
ADP n ATP. Coninutul de ADP determin viteza de fosforilare oxidativ. La sporirea
ei, viteza maxim de utilizarea 0 2 dureaz atta timp, ct ADP se transform n ATP.
apoi revine la valoarea iniial. Reglarea fosforilrii oxidative prin ADP se numete
control respirator, care depinde direct de necesitile energetice ale celulei.
c) Fosforilarea oxidativ e reglat i de sarcina energetic celular (vezi mai sus).
Oxigenazele. Citocromul P450 i reaciile de oxido-reducere. Aproape 90% din
O, este redus de complexul citocromoxidazic aar Unele esuturi conin enzime ce cata
lizeaz reacii de oxido-reducere n care atomii de oxigen se includ nemijlocit n molecule
i fonneaz grupa OH sau carboxilic - COOH. Enzimele ce catalizeaz tipul dat de
reacii se numesc oxigenaze.
Dioxigenazele sunt enzime ce catalizeaz reacii care includ n molecula substratului
organic ambii atomi de 0 2, exp: pirocatehaza. Monooxigenazele reprezint enzime ce
catalizeaz reacii de includere a unui atom de 0 2, cellalt fiind redus la H ,0. Acestc
enzime necesit dou substraturi-unul adiioneaz un atom, iar al doilea-cosubs-
tratul este donator de H pentru reducerea atomului de O, la H ,0:
AH + BH 2 + 0 2 ^ AOH + + H20
Primul substrat se hidroxileaz, de aceea enzimele sunt denumite i hidroxilaze;
monooxigenazele se divizeaz n subclase n dependen de natura cosubstratului
(FMN, FAD, NAD, NADP, a-cetoglutarat).
Numeroase i complexe sunt reaciile de oxido-reducere, cu participarea citocromu
lui P4 5 0 (prezent n reticulul endoplasmatic). Acest citocrom poate interaciona cu 0 2 i
cu , formnd cu ultimul un complex ce absoarbe lumina la 450 nm.

Citocromul P4 5 0 catalizeaz reaciile de hidroxilare a substratului (RH - ROH),


iar cellalt se reduce la H2 0 , adiionnd echivaleni redui ai NADH, NADPH sau proteine
fiero-sulf.
Particip la: 1) hidroxilarea steroizilor; 2) inactivarea substanelor strine, mai ales
puin solubile n ap; 3) hidroxilarea medicamentelor-hidroxilare ce amplific solubilitatea
lor, favoriznd procesele de dezintoxicare i eliminare din organism.

P.Mitchell J. E.Walkcr
c a p i t o l u l IV. GLUCIDELE I METABOLISMUL LOR
STRUCTURA. PROPRIETILE. FUNCIILE
Glucidele reprezint axa metabolic n regnul vegetal, pentru sinteza crora se utilizeaz
energia luminii. Ele reprezint forma de existen a majoritii organismelor,
deoarece glucidele de felul zahrului, amidonului sunt sursa principal de calorii necesare
omului adult, tuturor animalelor i multor bacterii.
Glucidelor le revine funcia fundamental de aprovizionare cu energie i carbon a
celulelor incapabile de fotosintez, iar unele, ca amidonul i glicogenul, reprezint rezerva
de glucoz.
Polimerii glucidici insolubili ndeplinesc funcii structurale n pereii celulari ai bacteriilor,
plantelor, n esutul conjunctiv i n membranele celulare animale.
Un alt tip de glucide servesc la interaciunea celulelor, determinnd specificitatea
biologic a suprafeelor celulelor animale. Glucidele sunt componente ale acizilor nucleici.
Majoritatea reprezentanilor acestei clase de substane organice sunt compui ai
carbonului interacionat cu apa (CFfO)n. Exist ns i glucide care nu respect acest
raport, iar unele dintre ele conin atomi de azot, fosfor sau sulf.
n funcie de comportarea lor la hidroliz, glucidele se clasific n:
1 ) oze - monozaharide, glucide nehidrolizabile, substane incolore, solide, cristalice,

uor solubile n ap, de regul, dulci. Baza lor reprezint un lan neramificat de atomi de
carbon legai ntre ei prin conexiuni ordinare. Unul dintre aceti atomi e fixat printr-o
legtur dubl cu 0 2, formnd grupa carbonil. La ceilali atomi dc carbon e adiionat
grupa hidroxilic. n funcie de natura grupei i carbonul pe care l conin, deosebim
aldoze (C =0 la captul terminal, ca grup aldehidic) i cetoze (C = 0 n orice alt
poziie). Dup numrul diferit de atomi de carbon n molecula lor distingem: trioze,
tetroze, pentoze, hexoze etc.( vezi pag. 215).
2 ) ozide - glucide care prin hidroliz pun n libertate una sau mai multe molecule de

oze (holozide); unele din ele elibereaz un compus n plus de natur neglucidic
(numit aglicon) i se numesc heterozide (glucozide).
Fiecare monozaharid exist n dou forme, alctuind n natur aldo- sau cetofor-
ma. Cele mai rspndite sunt hexozele (D-glucoza, D-fructoza). Aldopentozele (D-
riboza i 2-dezoxi-D-riboza) sunt componente ale acizilor nucleici.
Toate monozaharidele, cu excepia dihidroxiacetonei, posed unul sau mai muli
atomi chirali de carbon i se atest sub form de izomeri optici activi: gliceraldehida
conine un atom chiral i poate fiina n fonn de doi stereoizomeri; aldohexozele au 2 4,
adic 16 izomeri. Stereoizomerii se deosebesc prin modul n care rotesc planul luminii
polarizate, denotnd aceleai proprieti fizice i chimice. Stereoizomerii se numesc
enantiomeri i sunt situai unul fa de cellalt, la fel ca reflectarea oricrui obiect n
oglind. Prin convenie, ei au fost desemnai D i L. Configuraia absolut a celor patru
substitueni n jurul carbonului asimetric stabilit prin studii de difracie a razelor X
este redat prin formule de perspectiv i plane; ca compus de referin este luat
gliceraldehida (GA):
H 0 H 0 H 0
V1 V
1
V
H -C -O H H -C -O H H O -C -H
L 1.
H -C -O H H -C -O H
CH2OH 1
CH2OH CH20H
D-gliceraldehida D-eritroza D-treoza
Pe n t oze
D -a ld o z e
(a)
V I.
V V L
V
H O -C -H
H -C -O H H O -C -H H -C -O H
I. L I.
H -< p -O H H-Cf-OH H O -C -H H O -C -H
I. I.
H -C -O H H -C -O H -- H -C -O H
I I I I
CH2OH CH2OH CH20 H CH2OH

D -rib oza D-arabinoza D-xiloza D-lixoza


Hexoze
0
H
V1.
0 H
Y
0 H
V1
0 H
V1
0
V
H-C-OH
H
V1
HO-C-H
0 H
Y
0

H(: - oh
H
V1
HO-(3-H
- c - - HO-C-H H-C-OH HO-C-H
h - c'- oh H-C-OH HO-C-H HO-C-H H-C-OH H-C-OH H0-(: - h H 0-(3-H
H-i'-OH H-C-OH H-C-OH H-y-OH HO-C-H HO-C-H H0-(
rH HO-(H
H-O-OH H-C-OH
I H-C-OH H-C-OH H-C-OH
1
CH2OH
H-C-OH
CH2OH
1
H-<3-0H
<: 2
h oh
H-<p-OH
<20
CH2OH CH2OH CH20H CH20H
D-alloza D-altroza D-glucoza D-manoza D-guloza D-idoza D-galactoza D-taloza

Treoze Tetroze P en t o z e

CH2OH C H 2OH
CH2OH CH2OH !
A to m ii d e c a r b o n I I C=0 C=0
m ai accentuai p rezin t c= o c=o I
centre chiralice I ! H - C OH H O -C -H
CH2OH H- -C -O H I
I H - 9 -O H H -C -O H
CH2OH I
CH2OH CHaOH
Dihidroxiacetona D-eritruloza D-ribuloza D-xiluloza

Hexoze
CH2OH CH2OH CH2OH CH2OH
I I
C=0 C=0 L o A=o
I
- i H O -C -H H -C -O H H O -C - -H
I I
H -C -O H H -C -O H H O -i-H H O -C - -H
I I I
H - C OH H -C -O H H -C -O H H -C -O H
D -c c to z e I I ?- !
CH2OH CH20H CH20H CH20 H
(b) D-psicoza D -fru cto za D-sorboza D-tagatoza

I!
- -
-
2 2
D - GA L - GA

Multe aldoze posed civa centri chiralici. Astfel, s-a stabilit c seriile D i L vor
confirma configuraia atomului maximum asimetric, deplasat de la atomul de carbon
al grupei carbonilice, dar nu i sensul de rotaie + sau - al planului luminii polarizate de
ctre zahrul respectiv.
Monozaharidele, scheletul crora e compus din 5 i mai muli atomi de carbon, n
soluie capt forma de structuri ciclice nchise, n care grupa carbonil formeaz o
conexiune covalent cu una din grupele hidroxil legat cu atomul de carbon al lanului de
baz:
OH

O R 2
Gruparea hidroxil, aparut la fostul carbon carbonilic, este denumit hidroxil
semiacetalic sau glicozidic. Structurile monozaharidelor, coninnd cicluri de 5
atomi, se numesc furanozice (prin analogie cu heterociclul furri), pe cnd cele de 6
atomi se numesc piranozice (heterociclulpirari).
Pentru trecerea de la formulele liniare de proiecie la cele ciclice (de perspectiv) se
aplic urmtoarea regul: deasupra planului moleculei se indic grupele, ce se gsesc I
pe lng atomii de carbon n L-configuraie (cu excepia C-5 n piranoze i C-4 n fiiranoze);
mai jos - atomii de n D configuraie. Pentru lanul lateral, pe lng C-5 (piranoze) i
C-4 (furanoze), regula se inverseaz. Avantajul const n faptul c ele (grupele) pot fi
rotite n spaiu sub orice unghi, fr ca acestea s-i piard proprietile.
Ca urmare a reaciilor de ciclizare, fostul carbon carbonilic devine carbon asimetric, I
adoptnd dou configuraii sterice diferite - a i anomer. Stereoizomerul care are I
aceeai configuraie la -1 ca i ultimul atom asimetric ce detennin seria monozaharidului
(D sau L), este denumit a-anomer. Stereomerul de configuraie contrar al acestor
doi atomi e denumit -anomer. Reaciile de semiacetalizare sunt reversibile, forma
liniar carbonic se afl n echilibru cu diverse structuri ciclice posibile n soluiile apoase.
Cetohexozele fonneaz, n majoritatea cazurilor, inelul ftiranozic n poziia , cu legtura
semiacetalic. Aldohexozele, ns, pot forma atare inel care e mai puin constant dect
cel piranozic.
Proprietile chimice ale monozaharidelor sunt determinate att de gruprile
funcionale caracteristice, ct i de ansamblul catenei.
2 0 2
2

. 41 ---- r
2I
= 0
- D - fru c to fu ra n o z a
3I
Furan
2 Q
""C H 5 I N
W //
\4V /
2
H 62 f 1
D - fru c to z a
- D - fru c to fu ra n o z a
6,
2
} - \
/
I 4 \ 1
11

2I
P iran
/
- D -g lu c o p ira n o z a

2
---
6I \
2 4
.
1

D - g lu c o z a ^

- D -g lu c o p ira n o z a

Proprietile reductoare se manifest la introducerea lor n soluiile unor sruri


complexe de metale (cupru, argint, bismut), ai cror ioni sunt redui la valene
inferioare (Fehling, Benedict). La baza reaciei se afl ionii de Cu2+, complexai de ionii
tartrat (F) sau citrat (B), cu formarea oxidului cupros, - precipitat rou. n reaciile
Tollens i Nylander (Ag+i Bi3+) are loc depunerea metalelor respective n forma de
precipitat negru. n testele Fehling i Benedict, monozaharidele sufer oxidri
complexe, cu ruperea catenei de atomi de carbon, obinndu-se diferii produi de reacie.
Se produce o oxidare n mediu alcalin, ce decurge neuniform i complicat.
n cazul oxidrii ntr-un mediu acid, se obin acizi uronici (oxidarea la gruparea
alcool primar) sau zaharici (aldarici):
COOH

I
( ) 4 (CHOH ) 4
(CHOH ) 4 I
2 COOH
CH2OH
j Aldoza (glucoza) A c id aldu ron ic
A c id ald on ic
(gluconic) 1 (glucuronic)

COOH
I
(CHOH ) 5

COOH
A c id aldaric (glucozaharic)

Srurile acizilor gluconici sunt foarte solubile i pennit includerea n alimentaie a unor
elemente necesare ca fierul sau calciul. O form utilizat de calciu n medicin este
gluconatul de calciu, n care Ca44-previne hipocalcemiile i apariia tetaniilor, iar acidul
gluconic servete ca substrat energetic.
La tratarea monozaharidelor cu acizi minerali concentrai (HC1, H 2 S 0 4) i cuplarea
imediat cu diveri fenoli (reacia Selivanoff cu rezorcin), fructoza pierde trei
molecule de ap, transformndu-se n oximetilfurfurol
care, mpreun cu rezorcin, formeaz un compus rou- C H = N NHC 6 H 5
viiniu I
Condensarea unor monozaharide cu fenilhidrazina C = N NH Q H c
(C 6 H 5 -NH-NH2) formeaz ozazone, substane galbene, I
(CHOH ) 3
cristalizate. Monozaharidele identice dup C, i C 2
reprezint cristale identice (glucoz, fructoz). Galactoza CH2OH Ozazon
formeaz o ozazon distinct de glucoz.
Condensarea cu compui ce conin gruprile amino ale unor proteine este respon
sabil de formarea n organism a proteinelor glicozilate (hemoglobina, unele proteine la
diabet zaharat).

COH CH2OH CH2OH CH2OH


I I I I
H -C -O H H -C -O H c=o H O -C -H
I I I
H O -C -H H O -C -H H O -C -H H O -C -H
I I ) I
H -C -O H H -C -O H H -C -O H H OH
I
H -C -O H
I

H -C -O H
I
H -C -O H H -C -O H
I I !
CH2OH CH2OH CH2OH CH2OH
D - glucoza D - sorbitol D - fructoza D - manitol
Reducerea monozaharidelor genereaz polioli. CH 2 OH
n organism reaciile sunt catalizate de enzime NAD-
dependente. Glucoza i fructoza se reduc la D-sorbitol,
galactoza - galactitol.
Un important poliol este i ribitolul, derivat al - - O '
ribozei, un component al vit. B,. Compui rspndii n
regnul vegetal sunt sorbitolul, manitolul i galactitolul.
0-
D -g lu co zo -1-fosfat
n organizmele vii este prezent inozitolul att n stare
liber, ct i fosforilat sau ca un component al fosfolipidelor, esterul hexafosforic al su
(acidul fitic) fiind prezent n plante i servind drept o surs veritabil de fosfat. Srurile
sale de calciu i magneziu se
c h 2o h CH2OH numesc fitin.
O etap im p o rtan t n
meninerea ozelor n celul i n
metabolizarea lor este procesul de
esterificare cu acid fosforic.
La interaciunea gruprilor
se m ia c e ta lic e , ce fo rm eaz
glicozidele. n soluie, exist numai
o singur form ireversibil ( a sau
D -acetilglucozam in O ). Gruparea semiacetalic se blo
ch eaz. D eriv ai de n a tu r
glicozidic sunt oligozaharidele i polizaharidele. Reacia cu o component
neglucidic (aglicon) conduce la O-, S-, N- glucozide. Ultimele, componenta monoza-
haridic a crora constituind-o D-ribo- sau D-dezoxiribofuranoza i agliconul - baz
azotat, sunt nucleozidele. Mucopolizaharidele coninglucozamina i galactozamina,
N-acetil glucozamina. Glucozamina se afl n antibioticul streptomicina (n forma N-
metilat). O aminoglucid mai complex, format dintr-un rest de acid piruvic i alte
resturi de monozoamin este acidul neuraminic - o component esenial a glicolipidelor
i glicoproteinelor. n glicozidele cardiotonice, drept aglicon servete compusul steroidic.

R- ,
H -C -O H
I
H -C -O H
I
CH2OH

Acidul N-acctilneuraminic (acid sialic)


OLIGOZAH ARIDELE
Oligozaharidele reprezint compui glucidici obinui prin condensarea a dou sau a
mai multor monozaharide (maximum 10). Mai importante sunt dizaharidele. Prin con
densarea a dou molecule de
monozaharid rezult dizaharide
reductoare (ele pstreaz un
hidroxil semiacetalic - maltoza, ,
lactoza) i nereductoare (partici
p ambii hidroxili semiacetalici -
zaharoza: oc-glucopiranozid - - 2
fructofuranozid, glucid foarte rspndit
n regnul vegetal, mai ales n trestia
Zaharoza
de zahr i sfecl, cu o valoare
nutritiv deosebit). Zaharoza n- , 2
are anomer liber al carbonului i
nu posed proprieti reductoare.
Este un produs intermediar n foto-
sinteza plantelor i o form de
transport al glucidelor. OH M altoza
Maltoza (oc-glucopiranozid - 4-
glucopiranoza), glucid reductor, 2 2
rezult la hidroliza enzimatic a
amidonului i glicogenului.
Lactoza (-galactopiranozid-
4-glucopiranoza) este un glucid OH
reductor, sintetizat din glucoz, se Lactoza OH
conine n laptele mamiferelor.
POL1ZAHARIDELE
Glicanii (homo- i hetero-) sunt compui glucidici care formeaz, prin hidroliz, mo
nozaharide sau derivai ai acestora.
Homozide. Amidonul prezint un poliglucid deosebit de rspindit n regnul vegetal.
Se fonneaz n plantele verzi, n procesul de fotosintez. n continuare, este scindat
hidrolitic pn la glucoz, vehiculat n diverse esuturi, resintezat i depozitat sub fonn
de granule. Se conine n semine de gru - 63-67%, orez - 70-80%, porumb - 60-
6 6 %, fasole-40-43% . n starea pur, amidonul se prezint ca o pulbere alb, granular,

hidroscopic. Este insolubil n ap rece, iar in ap cald formeaz soluie coloidal.


Structural, amidonul este constituit din resturi de a-D- glucopiranoz legate 1-4 i 1-
6 . Cota amilozei este de 20-30% din totalul amidonului, iar circ 70-80% i revine

amilopectinei. n ultima structur apar legturi 1 -6 %, fapt care confer macromoleculei


o structur ramificat. Amiloza cu iodul d o coloraie albastr intens, iar amilopectina
-roie-violet.
Celuloza, ca i amidonul, este un homopolizaharid ce conine mai mult de 10000
resturi de D-glucoz racordate prin legturi glicozidice 1,4. Glucoza n celuloz rcpre-
zmt configuraia . O particularitate nensemnat n structura ei implic consecine
eseniale pentru proprietile glucidului. Avnd o configuraie , lanurile dc celuloz
sunt foarte ntinse, formnd o structur liniar, neramificat, fibre insolubile.
C eluloza-polizaharid predominant n regnul vegetal, este cel mai rspndit n
biosfer, constituind componentul primordial al pereilor celulari ai plantelor. Celobiozu
este unitatea structural a celulozei, reprezentnd un dizahand fonnat din dou molecule
de -glucoz. Celobiaza scindeaz enzimatic celobioza.
Celuloza este hidrolizat de o enzim specific - celulaza, sintetizat de unele
bacterii i ciuperci, fiind constiftientul
sucului
_ intestinal al animalelor inferioare. 1 'HU.7
La animalele rumegtoare, numeroasele
bacterii ce paraziteaz n tubul digestiv
sintetizeaz i elimin enzim ce scindeaz ~~(J
celuloza la D-glucoz, fermentnd-o pn t/n Celuloza
la acizii grai, cu o caten scurt, C 0 2,
metan (CH4), ultimul fiind eliminat prin recurgiti. Microorganismele, ulterior, sunt
scindate de enzimele intestinale. O simbioz dintre microorganisme i vac, unde
primele au posibilitate s se bucure de o via scurt, dar fericit, ntr-un mediu cald,
plcut. n stare pur, celuloza este o substana amorf de culoare alb, fr gust i miros.
Nu se dizolv n ap sau n alte soluii (cu excepia reactivului Schweitzer -
hidroxidtetraamoniacocupric - [Cu(NH3)J(OH)2). Acizii minerali tari o precipit, iar n
prezena NaOH (2N) fibrele de celuloz sufer o imbibare limitat - fenomen ce st la
baza procedeului tehnologic denumit mercerizare.
La om, celuloza este necesar penru mrirea peristaltismului intestinal. Organismul
uman nu dispune de enzim capabil s scindeze legtura -glicozidic i, deci, ea nu
poate fi utilizat ca surs de energie.
Chitina - polimer de glucozamin, cu o cantitate echimolecular de acid acetic, se
unete n lanuri lungi prin legturi de tip 1,4--glucozidic. Se conine n carapacea
crustaceelor i a insectelor, e rezistent la acizi i alcali, e insolubil n majoritatea
solvenilor. Carcasa este consolidat de carbonatul de calciu.
CH.,
0=0
CH,OH TI CH.OH H N11
j -4 !____ Q I_____
I .
'i / oh \ H/,
-y H \ r ~X/oH
, , OH H , vH
V H
A hX _ 0A _
NH .
I
c=o
CH, CH,
Segment de chitin - homopolimer compus din N-acetit-D-glucozamin l,4

O mucopolizaharid omogen este i acidul sialic, constituit din resturi de acid


neuraminic - N-acetilat legat prin legturi 2-4. Este constituent al glicoproteinelor
membranare i protejeaz celulele de atacul enzimatic i al toxinelor chimice. Neuraminidaza
virotic scindeaz acidul sialic i faciliteaz ptrunderea viruilor n organism.
Citozolul celulelor bacteriene e protejat de peretele celular. Aceast carcas
este transversat de legturi covalente formate de lanuri polizaharidice compuse din
N-acetil-D-glucozamin i N-acetilmuramic, acizi, racordai prin legturi 1,4.
Lanul lateral peptidic (,,,D) variaz de la specie la specie. Structura fortificat
de legturi covalente transversale ce contureaz celula e denumit m urein sau
peptidoglican.

,CH2OH CH2OH
N-acetilglucozamina 6 Acidul -N-acetilmuramic
o -O
5
4
OH o.
/I CH3
NH O N H C = 0

0= C - C H 3 H3c C H - C = 0
M ureina A -B -C -D

Antibioticele (penicilina) inhib sporirea nummlui de bacterii i frineaz ultima etap


de sintez fermentativ a peptidoglicanilor la microorganismele sensibile. In saliv se
ntlnesc i polizaharide extracelulare de origine bacterian: dextranii,- polimeri ai
glucozei ( a - 1-6; - 1-3 i 1-2), i levanii, - polimeri ai fructozei (1-2). Aceti polimeri
sunt adevrai liani ai plcii dentare, se formeaz pe contul zaharozei considerat, din
acest motiv, cea mai cariogen.
Heterozide. Componenta glucidic se leag cu atomul de oxigen, sulf sau azot al
agliconului prin hidroxilul semiacetalic. Sunt rspndite heterozidele ndeosebi n regnul
vegetal i au fost izolate din diverse organe ale plantelor. La animale s-au decelat n
unele esuturi i umori. n funcie de natura agliconului se disting:
1.0-heterozide - rezultante prin condensare cu un hidroxil alcoolic, fenolic, sterolic
sau heterociclic;
2. S-heterozide - formate prin condensare cu tioli;
3. N-heterozide - generate prin condensare cu grupri aminice ale unor compui
organici.
Aproape toate glicozidele naturale sunt -glicozide, dar pot exista sub ambele forme.
Preponderent, componenta glucidic este D-glucopiranoza i nu posed proprieti
reductoare. Glicozidazele, enzimele hidrolitice hidrolizeaz aceti compui dar sunt
prezente n alte celule unde glicozidele nu sunt constitueni fiziologici.
O-heterozide. Sunt glicozide n care agliconul este un compus cianhidric, din care
face parte i amigdalina. Ea prezint un diglucid -geniobioza i un aglicon - nitrilul
acidului mandelic. n natur, amigdalina se afl n migdale amare, n smburi de piersici,
caise, prune. La hidroliz formeaz 2 molecule de - D-glucoz, una de aldehid
benzoic i una de acid cianhidric:
C2H27N O n + 2H2 2C6H 120 6+ C 6H5C II0 + HCN
Enzimele florei intestinale sunt capabile s hidrolizeze amigdalina, cu eliberarea acidului
cianhidric. Absorbia lui genereaz efectul toxic.
Amigdalina i laetrele se consider ca ageni antitumorali - tumorile posednd activitate
-glucuronidazic sau -glucozidazic elibereaz HCN - cauza morii celulare.

o c C,H,
Amigdalina CN

Laetrele

Din aceast grup de heterozide fac parte i glicozidele cardiotonice - digitaloidele,


strofantozidele.
S-heterozide. Sunt compui care la hidroliz elibereaz oze i senevoli. Ultimii sunt
esteri ai acidului izotiocianic - R - N = C = S. Atare compui se afl n seminele unor
plante din familia crucifere, liliacee, leguminoase etc.
Sunt desemnate i 2 clase de compui chimici n componena crora intr o fraciune
glucidic i o fraciune protidic (glicoproteide) sau lipidic (glicolipide). Legturile sunt
covalente, iar cuantumurile compuilor sunt foarte diferite. Fraciunea glucidic este
reprezentat printr-un lan scurt denumit glican (proteoglicanii). La aceast clas de
glicoproteine se refer hormonii hipofizari, glicoproteinele sanguine, haptoglobulinele etc.
Glicolipidele - decelate n creier, n esutul nervos i iau parte n neurotransmitere la
nivelul receptorilor, sunt implicate n recunoaterea celular, n imunitatea tisular etc.
DIGESTIA I ABSO RBIA GLUCIDELOR
Glucidele stau la baza existenei majori
Dextrincle
tii organismelor. Ele ne parvin prin amidonului
alimentare sub form de polizaharide Cavitatea j Izomaltoza
Maltoza
bucal ') -amilaza
(amidon, glicogen), dizaharide (zaharoz, Lactoza
Zaharoza
maltoz, lactoz), monozaharide (glucoz, Celuloza
fructoza, galactoz, pentoz). Procentajul A m idon
Lactoza
lor variaz n dependen de vrst. In pro Zaharoza pH sc z u t
Celuloz stopeaz
cesul digestiei sunt hidrolizate pn la aciunea
monozaharide-singura form absorbabil. amilazei
salivare
Cota amidonului e de 50% din glucidele
utilizate de om. Componentele amidonului
sunt rapid hidrolizate de a-amilaz de
natur salivar i continu sub aciunea ot-am ilaza
p an cro atic
amilazei pancreatice. Enzima hidrolizeaz
legturile interne a - 1,4, formnd maltoz,
maltotrioz i a-dextrine.Ultimele sunt Iz o m a lto z a
Ficat
alctuite din cteva resturi de glucoz legate Maltoza
Lactoza
1,6 suplimentar la cele 1,4. Maltoza i Zaharoza
maltotriozele sunt hidrolizate pn la glucoz
de maltaz, pe cnd a-dextrinele sunt hi-
Circula,
d ro liz a te de a -d e x trin a z ( a - 1,6- portal E n zim ele
legate dc
glucozidaz). membrana
^ celulei
Dextrinele sunt substane lipicioase, mucoasei
constituind materia prim de baz a cleiu (izomaltaza
glucoamilaza
lui. Cartoful la fierbere elimin amiloza lactaza
zaharaza)
ce confer culoare apei. Din coninutul de J^ elu lo z jj
am idon al cartofului rm n 80% de
amilopectin.
D izaharidele sunt hidrolizate de F igu ra 4.1. Digestia glucidelor
dizaharidaze, reprezentate de enzime spe
cifice: lactaz (-galactozidaz), maltaz (a-glucozidaz), zaharaz (a-glucozidaza
sau -fructozidaz). Enzimele sunt sintetizate de ctre enterocite.
Substratul morfologic al digestiei i absorbiei intestinale este constituit din membrana
enterocitelor, care se profileaz luminai n fonn de perie i de textur de mucopolizaharide,
ce cptuesc suprafaa luminal (glicocalix). Hidrolazele nu sunt eliminate n cavitatea
intestinal. Ele se concentreaz i acioneaz pe marginea periei celulelor, iar
monozaharidele sunt eliberate n vecintatea imediat a sistemelor de transport (fig.4.1)
Pentru absorbie sunt necesari ionii de Na+, care formeaz cu monozaharidele compui
ce sunt transportai n celule. Na+activeaz ATP-aza ce amplific scindarea ATP i
eliberarea energiei necesare pentru absorbie. Na+eliberat este retransferat. Procesul
activ const n fosforilarea monozaharidei (exist investigaii experimentale care confirm
sporirea fosforului organic i reducerea celui neorganic, precum i micorarea glucozei).
Inhibitorii fosforilrii oxidative blocheaz absorbia monozaharidelor. Acidul fosforic este
pus n libertate de o fosfataz. Procesul de fosforilare a monozaharidelor este stimulat de
vitaminele Bj i C, metionin i hormonii suprarenali (sistem simport glucoz - sodiu).

Partea apical ( Partea bazal

3Na+
2Na+
N a+, K +- ATPaza

" \ Glucoza

GluT2 (difuzia facilitat)


Glucoza

Sim portorN a

LUM ENU L INTESTINAL SNGELE

F igu ra 4.2. Trasportul glucozei n celulele epiteliale intestinale

Se consider c transportatorul leag n locuri separate att glucoza, ct i Na+. Na+


mrete afinitatea transportatorului monozaharidelor.Glucoza iese uor din celul prin
difuzie facilitat, iar Na+este expulzat contra gradientului de concentraie prin intervenia
enzimei ATP-azei Na+, K+dependent (fig.4.2). Aceast enzim menine gradientul de
concentraie a Na+i, deci, rencrcarea transportului cu glucoz. Anabaina inhib pompa
de sodiu i, simultan, transportul glucozei. Schema structural i modelul conformational
al enzimei Na+, K+- ATPazei sunt redate n fig 4.2.a.

Figura 4.2a. Enzim N a *, K ' - ATP-aza


a) schema structural n care a i sunt subuniti polipeptidice;b) modelul conformaional
O alt surs de glucoz e glicogenul - forma rezerv a glucozei, uor mobil.
Glicogenul reprezint un polimer foarte ramificat, compus din resturi de glucoz,
unite n cea mai mare parte prin oc-1,4 legturi glucozidice. Ramificarea se datoreaz
legturii a - 1,6. La fiecare 10 resturi revine o legtur oc-1,6. Glicogenul se depoziteaz
n cantiti majore n ficat, revenindu-i pn la 7% din cota total. Degradarea glicogenului
i digestia glucidelor poate fi analizat n fig.4.1 i 4.3.

F igu ra 4.3. Degradarea glicogenului de a-amilaz (salivar i pancreatic)

Energia dependent de coninutul glucozei din umorile organismului atinge circa 40


kcal. Pentru glicogen valoarea numeric e de 600 kcal. Glicogenul se conine n
citozol sub form dc granule cu diametrul da la 100-400 , fiind dependent de mrimea
moleculelor.
Transferul intracelular al glucozei
Glucoza strbate membrana celular cu ajutorul unor transportatori pasivi. Acetia
permit circulaia glucozei n ambele sensuri, deoarece funcionarea lor nu necesit consum
de energie. Transportatorii glucozei, denumii genetic GluT, constituie o familie de
glicoproteine transmembranarc, codificate de gene diferite. Fixarea glucozei pe faa
extracelular a membranei antreneaz o modificare confonnaional a proteinei
transportatoare, care determin trecerea glucozei pe partea cealalt a membranei i
eliberarea ei n interiorul celulei.
Exist mai multe tipuri de transportatori GluT, a cror exprimare genetic este
dependent de tipul de esut i care difer ntre ei prin afinitatea pentru glucoz, exprimat
prin Km:
a) transportatorii GluT 1 sunt prepondereni la nivelul eritrocitelor, placentei; Km este
de aproximativ 1mM, concentraie mult inferioar celei de glicemie, ceea ce favorizeaz
intrarea glucozei n celule, chiar n condiii de hipoglicemie, n perioadele dintre mese;
b) transportatorii GluT 2 sunt prepondereni n ficat i pancreas; Km se cuprinde
ntre 15-20 mM, concentraie mult superioar celei de glicemie postprandial, ceea ce
determin intrarea rapid a glucozei provenite din absorbia intestinal n hepatocite, n
condiii de hiperglicemie; n caz contrar, n situaii de hipoglicemie ptrunderea glucozei
n hcpatocitc este minim;
c) transportatorii GluT 3 sunt prepondereni la nivelul encefalului, placentei i au aceleai
caracteristici ca i GiuTl;
d) transportatorii GluT 4 sunt prepondereni la nivelul esutului adipos i muscular;
Km este dc aproximativ 5 mM, valoare apropiat de cea a glicemiei; sinteza i afinitatea
lor pentru glucoz este reglat de ctre insulin;
e) transportatorii GluT 5 sunt prezeni n special la nivelul epiteliului intestinal, unde
intervin i n transportul fructozei.
Reglarea exprimrii i afinitii transportatorilor pentru glucoz
Reglarea este asigurat de insulin. Sensibilitatea la insulin este variabil n dependen
de esuturi:
- n ficat transportatorii GluT 2 sunt numeroi i aparent independeni fa de
concentraia insulinei plasmatice; randamentul funcionrii lor este ridicat, astfel nct
concentraiile extracelulare i intracelulare ale glucozei se echilibreaz aproape instantaneu;
intrarea glucozei n hepatocite nu este deci etapa limitat de viteza metabolismului su.
- n esutul adipos i muscular transportatorii GluT 4 sunt dependeni de insulin,
care stimuleaz sinteza i afinitatea lor pentru glucoz, acesta fiind unul din cele mai
importante mecanisme de reglare a metabolismului glucidic, deoarece transportul
intracelular al glucozei constituie etapa limitat de vitez a metabolizrii sale n aceste
esuturi.
Patologiile medicale
Deficienele dizaharidazelor localizate la nivelul marginii de perie a enterocitelor
cauzeaz malabsorbia glucidelor. Cel mai frecvent este deficitul ereditar al lactazei,
care provoac intoleran la lactoz, manifestat la nou-nscui prin diaree n urma ingestiei
de lapte.
Malabsorbia congenital a glucozei i galactozei se manifest prin diaree sever
n perioada neonatal, care poate cauza moartea prin dehidratare. Afeciunea este
cauzat de deficitul cotransportatorului glucoz-Na+i impune suprimarea glucidelor din
alimentaie, cu excepia fructozei i a inulinei (polimer de - fructoz 1-2).
Insulinorezistena periferic a fost evideniat la nivelul celulelor musculare, unde
transportatorii GluT 4 rspund deficitar la secreia de insulin. Ca urmare, membranele
celulare devin relativ impermeabile pentru glucoz, a crci degradare intracelular este
mult mai diminuat. Aceast anomalie determin hipersecreia de insulin la nivelul
insulinorezistenei periferice. Acest sindrom biochimic a fost descoperit la pacienii cu
diabet zaharat, obezitate sau diverse afeciuni metabolice ereditare.
Glicogenoliza
A fost studiat de Cari i Gerty Cori. S-a demonstrat c glicogenul e scindat de
ortofosfat, formnd un tip nou de zahr, identificat glucozo-1-fosfat (ester Cori). Aceti
savani au cptat i au cristalizat enzim glicogen fosforilaza (GF), ce catalizeaz
aceast reacie.
E
a) Glicogen(n) + Pj Glucozo-l-P + Glicogen(nl)
Ortofosfatul scindeaz legtura glicozidic dintre atomul de carbon C -1 al restului
terminal i C-4 al restului nvecinat. Ruperea legturii este specific meninndu-se a-
conformaie la C -l. In vivo reacia este deplasat n direcia scindrii glicogenului,
cauzat de raportul P/G-l-P *- 100. Scindarea fosforilitic e econom, zahrul
eliberat efosforilat. n continuare, glucoza fosforilat nu di fundeaz din celul n raport
cu glucoza liber. Sub aciunea glicogen fosforilazei glicogenul se scindeaz ntr-un
grad mic. Legturile a - 1,6 n punctele de ramificare nu sunt sensibile la G-F (glicogen-
fosforilaz). Efectul ei se stopeaz la restul terminal situat de la ramificare cu 4 resturi
de glucoz. E necesar o nou enzim. O transferaza transfer blocul din trei resturi de
glucoz de pe o ramur extern pe alta. Enzim hidrolitic e atestat ca enzim de
deramifiere (debranching enzim). Mai departe, fosforilaza i continu nestingherit
aciunea pn n apropierea unui nou punct de ramificare. Ca urmare a aciunii acestor
enzime, se obin G-l -P i mici cantiti de glucoz.
b) G-l-Peste convertit la G-6-P sub aciunea fosfoglucomutazei. n centrul activ al
enzimei e prezent o serin fosforilat. n cadrul catalizei grupa fosforil posibil e transferat
la OH al C6din G -1-P cu formarea G -1,6-diP, dup care grupa fosforil a acestui produs
intermediar este transferat pe restul Ser n centrul activ i n final se formeaz G-6-P,
regenernd enzim fosforilat. Amestecul rezultant conine 95% G-6-fosfat. Enzim
necesit, drept cofactor, ionul de Mg2+;

E O
C H 20 - P = 0 E
O 6 CH2OH6 2-
C H 2O H C H 20
5X----- o
2-
Convertirea G -l-P n G-6-P I]O 2 O ~PO 3
OH OH
G-l-P E O G -l, 6-diP
E

6 2- I. 6 2
C H 20 C H 2O - P O 3
o
) n ficat G'6-P (ester Robinson) este hidrolizat sub aciunea enzimei glucozo-6-
fosfcitaz. Enzima se conine n rinichi i intestine.
G-6-P + H2.0 Glucoza + P I

Ficatul menine glucoza n snge la un nivel relativ constant. El elibereaz glucoza n


timpul activitii intensive (efort fizic) sau n intervalul dintre alimentri. Glucoza eliberat
e utilizat n primul rnd de muchi i creier (fig. 4.4). Glicogenoliza nu necesit aport
energetic suplimentar.

Legtura a - 1,6
C a p tu l
reductor

G lucoz
a-glucozidaza
lizozomal

T ip II: B oala P om pe
(dcficit dc a-1,4 -glucozidaza lizozomal)
- dcfect nnscut dc enzima lizozomal;
- generalizat (ficat, inim, muchi);
- concentraii excesive de glicogcn n
C a p e t e le vacuole anormale din citozol;
nereductoare - valori normale ale zahrului sanguin;
- cardiomegalie sever, de regul,
cu moarte timpurie;
- structura glicogenului este normal.

T ip V: S in drom u l M cA rdle
(deficiena glicogen fosforilazei din muchii sche
letici)
- muchiul schclctal este afectat, enzima
hepatic este normal;
- slbiciune temporar i crampe ale muchilor
scheletali dup efort;
- lactatul nu crete n snge n timpul unui efort
Glicogcn fosforilaza marc;
- dezvoltare mental normal;
- mioglobinuric la vrst naintat;
- pronostic bun;
G lucozo-1 -P - n muchi nivel crescut de glicogen cu structur
normal;

i
V V
Dextrine limite

* V*
:V
V* Debrancing enzim
Glicozil transferaza

20 ..
Ami lo( 1:6) ------- Debrancing
glucozidaza ^ enzima
Glucoza
Q . 1

fTfp I: Boal Von Gicrke


- este afectat ficatul, rinichii i intestinul;
- hipogliccmic sever n caz dc post; G liicozo-l-P + Glucoz
- ficat gras, hepatomegalie;
- hiperlactatacidemic i hiperuriccmie;
Fosfogluco mutaza
f- structura glicogcnului este normal,
\ rezerve crcscutc dc glicogcn. Muchi Glicoliz

E ste
^ e lib e ra t
Gluco:
n snge
F igura 4.4. Schem atic e redat degradarea glicogenului cu dereglrile respective

n afar de maladiile menionate, sunt cunoscute i alte glicogenoze ca:


a) afeciunea Cori defect e enzima a - 1,6 glucozidaza (enzima de deramifiere), este
implicat n proces ficatul, inima, muchii scheletali (maladia Forbes);
b) maladia Anderson este cauzat de deficiena enzimei de ramifiere ( a - 1,4-1,6
transglucozidaza), este afectat ficatul, splina, intestinul, unde se acumuleaz glicogen cu
catene neramificate. Progreseaz ciroza ficatului i evoluia este fatal pn la vrsta de 20
ani;
c) glicogenoza Hers se caracterizeaz prin diminuarea activitii fosforilazei hepatice,
avnd n consecin depuneri masive de glicogen normal n ficat. Manifestrile clinice sunt
asemntoare unei forme atenuate a maladiei Von Gierke;
d) insuficiena fosfofructo kinazei cauzeaz maladia Tarui - sunt afectai muchii
scheletali, eritrocitele ce determin o hemoliz intens, acumularea lactatului. Diagnosticul
i tratamentul este mult mai complicat la asocierea a mai multor tipuri de glicogenoze;
e) deficitul de glicogen sintelaz provoac o hipoglicemie, cu accentuarea cetogenezei
i se caracterizeaz prin retard de cretere, deces precoce;
f) sunt descrise i glicogenoze de tip IX i X, cu deficit respectiv defosforilaz kinaz
i proteinkinaz ce conduc la hipoglicemie i hepatomegalie.
Majoritate glicogenozelor sunt afeciuni ereditare ce duc la acumularea glicogenului n
esuturi i afectarea metabolismului glucidic, cu generarea simptomelor clinice ca:
hepatomegalie, hipoglicemie, hipotonie muscular, deficit energetic n caz de efort fizic.
GLICOGENOGENEZA
Practic, are loc n orice esut, procesul fiind deosebit de activ n ficat i muchii
I scheletali.
1. a-glucoza + ATP D-G-6-P + ADP
Reacia este catalizat de hexokinaz, ce necesit ioni de Mg+.
2. D-G-6-P G-l-P
Reacia e catalizat de enzim fosfogluco-mutaza.
3. G -l-P + UTP * Glucoz-UDP + PP,
Reacia-cheie a sintezei glicogenului e activarea glucozei catalizat de enzima-G-1-P
I uridil-transferaz.
O alt enzim, pirofosfataza, hidrolizeaz ;la 2P.:
PP i+ H2,0 2 Pi.
4. Transferul grupelor glucozil de la UDP pe captul nereductor al moleculei ramificate
I de glicogen e catalizat de glicogen sintaz (GS):
UDP-G + Glicogenn UDP + Glicogen n+]
n procesul acestei reacii se formeaz o legtur a - 1,4 ntre C-l al restului de
j glucoz i al C-4 restului terminal glucozid din lanul glicogenului.
Echilibrul e deplasat n dreapta spre sinteza glicogenului. Enzim, ca activator,
I necesit ramura (iniiator, primer) moleculei de glicogen, cu nu mai puin de 4 resturi
de glucoz, la care enzim, consecutiv, adiioneaz grupe glucozidice din captul
I nereductor. Rolul UDP-glucozei a fost evideniat de biochimistul argentinian Luis
I Leloir, decemndu-i-se Premiul Nobel n 1970.
Ramificarea se realizeaz sub aciunea 4-6 transglucozidazei (enzim de ramifie-
I re) i implic transferul fragmentului oligozaharidic, cel puin 6, la captul nereductor
al ramurii ce conine nu mai puin de 11 resturi de glucoz pe OH al C6al glucozei din
I aceeai ramur sau alta, dar orientat spre interiorul moleculei. Ca rezultat, se formeaz
o ramur nou. Glicogen sintaza poate ataa la ea resturi de glucoz. n situaia n care
nu exist un primer glicogenic se recurge la un primer de natur proteic-glicogenina.
I Ultima prezint o protein catalitic glucozil transferazic, care permite iniierea procesului
de sintez i adugarea succesiv a ctorva resturi glucozil. Procesul presupune transferul
unui rest glucozil din UDP-glucoz pe gruparea OH a tirozinei din molecula glicogeninei.
Sinteza glicogenului necesit un aport energetic echivalent cu 2 molecule de ATP.
Ramifierea amplific solubilitatea glicogenului i numrul de capete nereductoare
(fig. 4.5).
Reglarea proceselor de liz i sintez a glicogenului
Aadar, glicogenul se supune mai lesne aciunii glicogen fosforilazei i glicogen
j sintazei.
Enzimele respective se regleaz reciproc atunci cnd una e activ, cealalt e inhibat.
Glicogen fosforilaza i glicogen sintaza sunt prezente n dou forme: fosforilatc i

1
defosforilate. Controlul metabolic variat i complex este realizat att prin reglarea cova-
lent, ct i prin cea alosteric. S-a stabilit c: G-Fa e activ n forma fosforilat i G-Fb
e mai puin activ defosforilat, pe cnd G-Sa e activ n forma defosfori lat i G-Sb
mai puin activ - fosforilat.
G licozo - 6-fosfat

F osfogluco m utaza

UTP + G lucozo - 1-fosfat


Tirozina

y j i r o f o l f o rilaza UD P-glucoza
Glicogenira
(UDP# >
HO'
Glicogcn
PPi
in iiato r
UDP
HOH A tsin ta z a

Pirofosfataza

2Pi
UDP -

G licogen sintaza

L e g tu ra a - 1,6

UDP

, , ......... L eg tu rile a - 1,4 ^ S G lucozil (4:6)


4 m It | I (k j I 4 $ b i * tran sferaza

Elongarea ulterioar la capctc-


lc n c rc d u c to a rc cu aju to ru l
g lic o g c n s in ta z c i, r e z u ltn d
\ t formarea dc legturi a - 1,4.

Capetele R a m ific a re a u lte r io a r , cu


nereductoare form area dc legturi a - 1,6 dc
ctrc glucozil 4:6 transferaza

F igu ra 4.5. Metabolismul glicogenului Glicogen

Interconversia celor dou forme ale G-F se realizeaz graie aciunii antagoniste a
dou enzime: glicogenfosforilaz kinaza i glicogenfosforilazfosfataza. Kinaza fos-
forileaz restul de serin n centrul activ al G-Fb, cu ajutorul ATP. Fosfataza scindeaz
hidrolitic P de la G-Fa.
Glicogen fosforilaz kinaza (G-F-K) reprezint o enzim constituit din 4 tipuri de
subuniti, fiecrei fiindu-i proprii 4 copii. Subunitateay- subunitate catalitic; a - -G
au funcii reglatorii; e reprezentat de calmodulin - protein ce fixeaz Ca2+i care, n
funcie de concentraia citoplasmic a acestuia, i modific conformaia.
nsi enzima glicogen fosforilaz kinaza are dou forme interconvertibile: transforma
rea formei inactive n activ are loc prin fosforilarea realizat la a i , cu contribuia
ATP i a kinazei (Proteinkinaza dependent de AMPc). Se inactiveaz de ctre o
fosfoprotein fosfataza. AMPc e mesagerul secund format ca rspuns la aciunea
adrenalinei, glucagonului care stimuleaz activitatea kinazei (AMPc dependent), efectund
fosforilarea kinazei i activnd C-Fb, concomitent fosforilnd-o i accelernd scindarea
glicogenului. G-Fb n muchi e activat de AMPc (modulator pozitiv), iar ATP este
modulator negativ. Activitatea final e determinat de raportul AMP/ATP. Glicogen
fosforilaza a este AMP independent.
Studiul roentgencristalografic al ^ Cap. N terminal
form elor a i b ale glicogen *'" \ '"A Locusul de fostorilare
fosforilazei au favorizat perceperea Locusul de fixare 1 J *=/ _
mecanismelor catalitice i reglatorii ale . ^ , _ *
acestei enzime cardinale a metabolis
mului. S-a stabilit c 841 de resturi
de aminoacizi sunt aranjate compact n
3 domenii structurale: domeniul amino-
terminal (310); domeniul fixator de
glicogen (160) i carboxiterminal
(371). Centrul catalitic e localizat n
adncul subunitii formate din resturile
Centrul activ
aminoacide ale celor 3 domenii, fiind
aprat de mediul apos ce faciliteaz
predominarea fosforilrii fa de hidro- Figura 4.6. Imaginea schematic a carcasei
liz (fig.4.6). -carbonice din fosforilaza a
Vit.B 6 necesar pentru activitatea
enzimei se fixeaz n apropierea locului de fixare a G -1-P. Molecula enzimei nlesnete
un locus de fixare a glicogenului la o deprtare de 30de la centrul activ, ce favorizeaz
fosforilarea multor capete de glicogen, nedisociind i resociind dup fiecare ciclu
catalitic. Conine, de altfel, i dou locusuri alosterice de reglare la hotare ntre
subuniti (AMPc i locusul de fosforilare a serinei). Enzim se studiaz ncontinuu, dar
i n prezent se poate afirma c ea reprezint un integrator fin informativ al metabo
lismului energetic celular.
Proteinkinaza (PK) favorizeaz fosforilarea conform reaciei:
G-Sa + 2ATP G-Sb + 2ADP,
pe cnd fosfoprotein fosfataza (FPF) detaeaz fosforul, activnd sintaza:
G-Sb + 2H 2O - G-Sa + 2P I

Aceste dou enzime reglatoare ale glicogen sintazei sunt identice cu cele dou
ale glicogen fosforilaz kinazei. De aceea, enzimele se regleaz reciproc. O aciune
adiional ntreprins de celul pentru a evita desfurarea simultan a defosforilrii
i a fosforilrii const n inactivarea fosfoprotein fosfatazei de ctre o protein -
inhibitorul defosfataz, activ prin fosforilare AMPc dependent. Aceast fosforilare
este realizat, ns, cu reziduu de treonin, nu i de serin, ca n celelalte cazuri. Prin
ataarea inhibitorului de fosfataz la FPF este suprimat numai aciunea hidrolitic a
enzimei asupra reziduurilor de fosfoserin, nu i asupra celor de fosfotreonin. G-S se
regleaz de ctre modulatorii alosterici, G-Sb se activeaz de ctrc glucozo-6 -fosfat i
aceast form e denumit dependent.
Sporirea concentraiei de AMPc produs prin activarea adenilatciclazei (activat de
glucagon i adrenalin) activeaz proteinkinaza AMPc dependent ce efectueaz fos
forilarea simultan a G-F-K, G-F, G-S i a inhibitorului de FPF (ultimul inactiveaz
FPF), excluznd funcionarea simultan a celor dou enzime antagoniste (PK i FPF).
Procesul de glicogenoliz se va declana, suprimndu-se sinteza (fig. 4.7).
H ,0

G -Sa G-Sb
ATP ADP

FPF
O
Pi
G l(n ) _ A . G l( n - l) + G lu c o z o -l-P

F igura 4.7. Reglarea sintezei i lizei glicogenului

Reducerea concentraiei de AMPc (adic a concentraiei de glucagon i adrenalin)


sau, respectiv, creterea concentraiei de insulin (activeaz fosfodiesteraza) inactiveaz
proteinkinaza AMPc dependent i, deci, sisteaz fosforilarea G-F-K, G-F, G-S i a
inhibitorului FPF.
Inhibitorul devine inactiv, permite aciunea FPF, care defosforileaz cele trei
enzime implicate n glicogenoliz. Ca urmare, G-S se activeaz. Activarea glicogeno-
lizei coincide n timp cu inactivarea glicogen sintezei.
Glicoliz (calea Em bden-M ejerhof)
Glucoza ndeplinete roluri metabolice multiple n organism, fiind indispensabil
tru el, i servete drept combustibil excelent pentru esuturi. Utilizarea glucozei drept
s de energie necesit parcurgerea glicolizei - degradarea ci incomplet pn la piru-
it i, ncontinuu, pn la ,.
Calea central a catabolismului e universal, se deosebete prin caracterul reglrii
ntezei scindrii i prin evaluarea metabolic a piruvatului.
1. Reacia de fosforilare a glucozei
CH2OH 2 0 PO 3
-O
M jL
2

OH
1

OH
+ ATP
Hexokinaza

HO
OH

' OH
OH
1
+ ADP + H

a-D -glucoza a-D -g lu co za- 6-P


Enzima fosforilrii - hexokinaza - e prezent n toate celulele, are o structur
tridimensional, legarea se face dup tipul induciei coordinative. Molecula enzimei sufer
modificri conformaionale profunde (fig. 4.8).
E reprezentat de izoforme diferite - toate Glucoza
catalizeaz aceeai reacie, dar cu viteze diferi
te. Glucoza n muchi fosforileaz cu vitez ma
xim i enzima e inhibat de G-6 -P - produs i
inhibitor alosteric.
n ficat, glucokinaza se caracterizeaz prin:
a) e specific numai pentru D-glucoz;
b) G-6 -P n-o inhib;
c) confer Kmmare (1 OmM), comparativ cu
0,1 OmM pentru hexokinaz. E activ la
F ig u r a 4 .8 . Im a g in e a 's c h e m a tic a a-
concentraii mari de glucoz, ce favorizeaz de scheletului de carbon diit hexokinaza din
punerea ei n glicogen. La bolnavii de diabet drojdii. Dou subuniti identice interacio
zaharat cantitatea glucokinazei e redus, avnd neaz nesimetric
consecine grave: nivelul glucozei n snge e nalt, iar nivelul glicogenului n ficat e sczut;
d) Kmmare ofer posibilitate creierului i muchilor s utilizeze glucoza primordial la
o cantitate mic n snge.
2.Urmtoarea reacie reprezint conversia glucozo-6 -fosfatului la fructozo- 6 fosfat
(ester Neuberg).
2-
CH 2O - P O 3
2- 6
O jP -O zH C O CH2OH
5' '2
2 OH
Fosfogluco izomeraza

OH a-D-elucozo-6 -P
w

OH a-D-fhictozo-6 -P
Enzima fosfogluco izomeraza este o aldolaz, ce necesit prezena Mg2+ i
transform aldoza n cetoz. Grupa carbonil e transferat din poziia 1 n 2.
3. Fosforilarea fructozo-6 -fosfatului este reprezentat prin urmtoarea reacie:
a-D -F- 6 -P + ATP a -F -1,6 -diP + ADP + H+
Enzimafosfofructo kinaza catalizeaz reacia ireversibil care prezint un indice
important de control al glicolizei. Reprezint o enzim compus, inhibat de ATP, citrat,
acizi grai. Reacia decurge lent i determin viteza glicolizei, n ansamblu.
4. Scindarea fructozo-l,6 -bifosfatului n 2 trioze:

C H 20 C H = 0

C = 0 + Cc Hu
Oo H
I
Fructozodifosfat
aldolaza
C H 2O H C H 20
2-
OH
a -D -fru c to z o -l, 6-diP DHAP G A -3-P

Enzima e ofructozodifosfat aldolaz (aldolaz), ce nu necesit Mg2+, dar la unele


organisme necesit Zn2+. Produsele sunt momentan utilizate n alte reacii. Reacia e
dependent de temperatur, fapt ce grbete fonnarea rezultantelor.
5. Conversia triozelor fosforilate prezint urmtoarea reacie:

2 -
C H 2O - P O 3

c=o Triozofosfat
Hc -
izomeraza 2.
C H 1 OH C H 2O - P O 3
DHAP G A -3-P

Enzima e o triozofosfat izomeraz. Reacia e deplasat spre formarea cetoformei


- DHAP (95%), dar pe msura utilizrii gliceraldehid-3-P are loc formarea lui.
Aadar, n cele 5 etape ce reprezint prima faz a glicolizei, molecula de glucoz,
utiliznd dou molecule de ATP, s-a scindat n dou trioze.
A doua faz a glicolizei, n care se includ cele dou molecule de GA-3-P n
aceleai reacii chimice, sunt reacii de oxido-reducere cuplate cu fosforilarea la nivel
de substrat i sintez de ATP.
1) Oxidarea fosforilant a gliceraldehid-3-fosfatului prezint prima reacie a acestei
faze. Enzima e o gliceraldehidfosfat dehidrogenaz. Grupa aldehid se oxideaz i
nu se formeaz acidul carbonic, dar un amestec din anhidrid a acidului fosforic i a
acidului 3-fosfogliceric, adic 3-fosfoglicerolfosfat, care, de fapt, este un acilfosfat, ce
se caracterizeaz printr-o valoare de AG = 11, 8 kcal. O parte considerabil a energiei
libere, ce se elimin la oxidarea grupei aldehidice, se pstreaz n grupa fosfat a
acilfosfatului (la C-l).
H 2

0 = (/ c o o ~ '
- - + NAD+ + Pi <--------- - - + NADH +
2 G ceraldehid I 2-
2 0 " fosrat dehidrogenaza CH 2 O
PO 3
GA3 P 1,3-DPG 1
P i= H 0 -P -0
!_
Mecanismul de aciune a dehidrogenazei complex:
a) adiia unei grupe SH din centrul activ al enzimei la
gliceraldehid-3-fosfat, cu formarea unui semitioacetat (legtur covalent):

R -C f + E - S H ^ = ^ R -C H -S -E
XH I
OH
b) enzima transfer I de la substrat la NAD+, fixat rigid cu centrul activ. n urma
transferului apare complexul macroergic acilfosfat, care ulterior interacioneaz cu P
liber, genernd 3-P-G-P i regenernd enzima liber:

E SCHRE S ~ C R P ~ C R + E - S H
I ^ ^ - II II
OH NAD NADH + H o Pi

Enzima e compus din 4 subuniti identice. Fiecare lan polipeptidic conine 330
aminoacizi. Grupele SH pot fi legate de iodacetat (ICH,COOH) - inhibitor necompetitiv.
2) Fosforilarea la nivel de substrat (AG = -4,5kcal) este rezultatul transferului
restului fosforil pe ADP, reacie catalizat de fosfoglicerat kinaz:

COO 2' 2+ fO O '

H -C -O H + ADP < Fosfoglicerat


J L ,. > H- C~ 0 H + ATP
CH 2 O - P O 32' kinaZa CH 2 O 2'
1,3-DPG 3-PG

3) n continuare, are loc transfonnarea 3-fosfogliceratului n 2-fosfoglicerat, sub


aciunea unei mutaze specifice i n prezena obligatorie a ionilor Mg2+:
(AG = +i,06 kcal)

COO' COO'
2+ I,
C H -O H Mg C H -0 -P 0 3

2- Fosfoglicerat nutaza
CH 2 0 PO 3 CH2OH
4) Enzima enolaza catalizeaz reacia reversibil de dehidratare. n cadrul acestui
proces are loc repartiia energiei n molecul:

f 00' 2_ Mg 2 + fo o - 2_
H -C -O -P O 3 ^ 4 - 'O
Enoaza )|
CH 2 OH H2 O H20 CH2
2-PG 2-P-enolpiruvat

Modificrile energiei libere n aceast reacie sunt AG = 4,2 kcal - AG = -14,8


kcal. Enzima este inhibat de fluorid (F ) n prezena fosfatului. Realmente, fluorid
fosfatul ce leag ionii Mg44 este inhibitorul autentic.
5) Transformarea 2-fosfoglicerat n piruvat e catalizat de enzima piruvat kinaza.
Are loc o fosforilare la nivel de substrat. Forma enol rapid se transform n ceto
(nefermentativ), ce predomin la pH = 7,0 (AG = -7,5kcal/mol):
COO' COO
I 2 M g2+
C 0 ~ P 0 i '+ ADP-------- OH + ATP
I K+ I
CH 2 CH 2
2-P-enolpiruvat Enoilpiruvat

Reacia e deplasat n dreapta, fora motrice o constituie degajarea de energie. Reacia


e ireversibil.
In glicoliz se observ reacii chimice de 3 tipuri:
1) scindarea scheletului hidrocarburic al glucozei, cu fonnarea piruvatului (via C);
2) fosforilarea ADP de compui SME (via P);
3) via transferului de electroni (via H).
E de menionat c:
1. Enzimele ce catalizeaz reaciile glicolitice n citozol sunt solubile.
2. De la glucoz pna lapimvat sunt antrenai 9 metabolii intennediari fosforilai, care
ndeplinesc urmtoarele funcii:
a) la pH=7,0 fosfatul poart sarcin negativ, membranele celulare sunt impenneabilc
pentru moleculele cu sarcin i, deci, intermediarii glicolizei nu pot prsi celula. Glucoza,
lactatul, piruvatul au sisteme de transport specifice;
b) aceti metabolii reprezint componentele necesare n procesul fennentativ de
acumulare a energiei metabolice - transferul la ADP, cu sintez de ATP;
c) grupele fosfat ndeplinesc funcii de identificare, fapt ce atest c moleculele

corespunztoare. Aproape toate enzimele necesit ioni de M g'1, care fonneaz complexe
cu grupele fosfat n ADP, ATP, la fel ca i intennediarii glicolizei. O anumit specificitate
manifest fa dc complexele cu ioni de Mg^.
Soarta piruvatului. Piruvatul se afl la rscrucea drumurilor metabolice. Poate fi
utilizat n urmtoarele direcii:
1. La organismele aerobe e supus decarboxilrii oxidative - calea studiat mai sus.
Reacia sumar a degradrii este schematic redat n continuare:

G lucoza + 2P + 2A D P + 2NAD+
1

f Calea E m bden-M ejcrhof


2 piruvat + 2ATP + 2N A D H + 2H + + 2H 20

Teoretic, eliberarea energiei libere are un randament egal cu:


3 8 x 7 ,3 /6 8 6 X 100% = 40%
n celula intact eficacitatea transformrilor e i mai mare = 70%, cauzat de
concentraia intracelular a O,, concentraia P, ADP, ATP nu e egal, dar mai mic dect
1 .0 N1

2 . n condiii anaerobe are loc reducerea piruvatului n lactat - glicoliz anaerob

- surs principal a ATP la efort fizic:


Piruvat + NADH + H+ L actat+ N A D +
Necesarul de NADH este asigurat de oxidarea gliceraldehid -3-fosfatului. Reaciile
au loc n mod coordonat i permit generarea imediat a energiei.
Reacia este deplasat spre dreapta. NAD+regenerat poate fi utilizat n glicoliz.
Enzima reprezint lactat dehidrogenaza. Am mai menionat c ea este o izoenzim, ce
difer dup Kmpentru piruvat, Vmax i gradul de inhibiie alosteric de piruvat.
Izoenzim ce conine 4 subuniti identice (H4) este LDH,, care are o Kra mic pentru
piruvat i este inhibat puternic de acesta. Fonna compus din uniti identice - (M4)
- LDH5-a re K)timare, nu se inhib de piruvat i are o activitate catalitic mult mai
mare dect LDH r
Stoichiomeria glicolizei anaerobe:
Glucoza + 2ATP + 2P. + 2NAD++ 2NADH + 2H++ 4ADP
^ 2Lactat + 2H+ + 4ATP + 2H20 + 2NADH + 2H+ + 2NAD++ 2ADP
Sumar: Glucoza + 2P 1 + 2ADP - 2Lactat + 2ATP + 2H++ 2H0
-------- 2

Obinerea unei cantiti mici de ATP eliberat rapid este avantajoas pentru necesitile
imediate de energie sau activitatea unor esuturi cu necesiti energetice minime. In esuturile
anaerobe, inclusiv i n ficat, acidul lactic este transformat n acetil-CoA i utilizat ca
substrat n ciclul Krebs.
3 .0 alt cale de metabolizare este sinteza etanohtlui. Unele microorganisme, de
exemplu drojdiile, fermenteaz glucoza la fel pn la piruvat. Apoi:
a) Piruvat + HOH ^ CH 3 ~ C H = 0 + C 0 2
Enzima epiruvat decarboxilaz (Mg2+, TPP). Reacia n celul e ireversibil. Enzima
nu se conine n esuturile animale.
b )C H 3- C H = 0 + NADH + H+ = = CH 3 CH,OH + NAD+
Enzima reaciei este alcool dehidrogenaz. n 1856, Louis Pasteur a argumentat
fermentaia zahrului n alcool, prin aciunea microorganismelor. n condiii sterile,
fermentaia nu are loc. De pe bobiele de poam proaspete s-a izolat cultura de drojdie
i s-a determinat c ea e responsabil de fermentaia sucului. Transformarea vinului n
oet e cauzat de alte microorganisme.
Reglarea glicolizei. Viteza reaciilor catabolice principale ce asigur scindarea
glucozei i utilizarea energiei chimice sub fonna de ATP, n fiecare moment se regleaz
n corespundere cu necesitile celulei n ATP, indiferent de calea n continuare a
utilizrii ATP - biosinteza, transfer activ sau lucru mecanic. Enzimele reglatoare percep
diferite semnale ale cilor metabolice i sunt receptive la ele.
Prima reacie reglatoare (1) e catalizat de hexokinaza ce fosforileaz glucoza
liber cu ajutorul ATP n poziia 6 . E o enzim alosteric ce se inhib de G- 6 -P.
Glucokinaza ficatului nu se inhib, i surplusul de glucoz e transfonnat prin G -1-P n
glicogen. In condiii normale, insulina stimuleaz sinteza gluc